The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008711	Burkholderia mallei strain 6 chromosome 1, complete sequence	3501048	184758	196324	3501048	plate,protease,transposase,terminase,portal	Leptospira_phage(28.57%)	13	NA	NA
WP_144245086.1|184758_185878_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.0	6.2e-49
WP_004202811.1|186258_187005_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_004204996.1|187225_187846_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004199894.1|187846_189229_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_004199892.1|189251_190010_+	cytochrome c1	NA	NA	NA	NA	NA
WP_004185176.1|190102_190714_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_004199890.1|190783_191305_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_004199888.1|191526_192024_+|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	100.0	2.6e-55
WP_004199886.1|192020_193076_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	99.4	5.7e-206
WP_004202809.1|193119_193476_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_004199884.1|193478_193775_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	98.0	2.8e-49
WP_144245087.1|194582_195702_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	1.4e-48
WP_004204912.1|195841_196324_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP008711	Burkholderia mallei strain 6 chromosome 1, complete sequence	3501048	467749	525353	3501048	protease,tRNA,transposase,portal	Vibrio_phage(17.65%)	52	NA	NA
WP_162473628.1|467749_469158_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.7	1.7e-80
WP_004190029.1|469329_470100_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_024900631.1|470131_470971_-	polyphosphate kinase	NA	NA	NA	NA	NA
WP_004190092.1|471097_472570_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004189326.1|472572_474063_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004189769.1|474175_474475_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_024900632.1|474840_475884_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189331.1|476003_477077_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004523092.1|477073_477586_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004189575.1|477769_480178_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004189171.1|480189_481338_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_024900633.1|481660_482437_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004189570.1|482433_483219_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_004189793.1|483640_484093_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004189241.1|484112_484745_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004190026.1|484838_485573_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_004189647.1|486040_486724_-	response regulator	NA	NA	NA	NA	NA
WP_004189034.1|486724_489133_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004188929.1|489134_489725_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004189046.1|489721_491131_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|491508_492366_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004189288.1|492475_493111_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004200737.1|493231_494215_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004201745.1|494246_494750_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.7e-12
WP_004190020.1|494978_496169_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004190199.1|496228_496600_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004200734.1|496810_499420_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004189230.1|499641_500697_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188904.1|501146_502163_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004189208.1|502283_503153_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004200732.1|503190_503595_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004187628.1|503985_505206_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_144245090.1|505367_506488_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.7	1.2e-47
WP_004200731.1|506559_507042_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004188977.1|507038_507323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200730.1|507395_508487_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	92.3	2.0e-193
WP_004200729.1|508885_509296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189258.1|509432_510308_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.3	9.6e-74
WP_004190014.1|510318_511431_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	30.8	3.2e-37
WP_004201742.1|511459_512554_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004189434.1|512696_513665_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189874.1|513767_514337_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004189689.1|514923_515472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189592.1|515735_517184_+	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	33.5	4.9e-30
WP_004200727.1|517202_518816_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_004200726.1|518975_519917_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004190110.1|519913_521008_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	3.8e-19
WP_004197761.1|521409_521826_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004197759.1|522003_522558_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_024900531.1|522773_523121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524603.1|523606_524167_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_038802950.1|524232_525353_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 3
NZ_CP008711	Burkholderia mallei strain 6 chromosome 1, complete sequence	3501048	924387	959131	3501048	holin,protease,transposase	Streptococcus_phage(27.27%)	30	NA	NA
WP_004198632.1|924387_924741_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004198631.1|924758_925589_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_004198630.1|925772_927263_-	6-aminohexanoate-cyclic-dimer hydrolase	NA	NA	NA	NA	NA
WP_004198629.1|927359_928052_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
WP_024900621.1|931169_932303_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004195764.1|932493_933702_-	MFS transporter	NA	NA	NA	NA	NA
WP_004185224.1|934014_934695_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_004195767.1|935079_935373_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004195769.1|935612_936803_+	cation transporter	NA	NA	NA	NA	NA
WP_004195771.1|936981_937440_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004195773.1|937530_938187_-	hypothetical protein	NA	A0A2L0UZL4	Agrobacterium_phage	38.2	1.1e-32
WP_004195775.1|938183_938828_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004553005.1|939428_940064_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	63.1	1.6e-22
WP_144245094.1|940192_941655_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	6.8e-80
WP_004189292.1|941813_943424_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|943436_943619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|943591_944851_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|945118_945697_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_144245095.1|945911_947031_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	5.2e-48
WP_004191998.1|949106_950571_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004185841.1|950731_951310_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.7	1.1e-44
WP_004197496.1|951506_952889_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	27.5	6.1e-30
WP_004200482.1|952883_953114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555967.1|953346_954375_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004196455.1|954355_954562_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_004185994.1|954735_955527_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004185840.1|955735_956398_+	adenylate kinase	NA	NA	NA	NA	NA
WP_144245096.1|956514_957976_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	5.2e-80
WP_004196460.1|958080_958284_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|958816_959131_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
>prophage 4
NZ_CP008711	Burkholderia mallei strain 6 chromosome 1, complete sequence	3501048	1130780	1139622	3501048		Bacillus_phage(16.67%)	8	NA	NA
WP_004189214.1|1130780_1132181_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	2.1e-78
WP_004200795.1|1132149_1133136_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.5	8.8e-15
WP_004190173.1|1133194_1134187_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|1134258_1134576_+	competence protein ComE	NA	NA	NA	NA	NA
WP_004532363.1|1134899_1135802_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_024900718.1|1136027_1137335_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004188957.1|1137513_1138437_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
WP_004190087.1|1138779_1139622_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
>prophage 5
NZ_CP008711	Burkholderia mallei strain 6 chromosome 1, complete sequence	3501048	2296104	2362425	3501048	tRNA,transposase	Leptospira_phage(20.0%)	55	NA	NA
WP_144245106.1|2296104_2297224_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	1.2e-49
WP_004192968.1|2297689_2299030_-	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	8.2e-32
WP_004192556.1|2299083_2300841_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004198606.1|2301337_2301604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193003.1|2301677_2302991_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_024900821.1|2302974_2303673_-	response regulator	NA	W8CYM9	Bacillus_phage	36.2	6.4e-28
WP_004192043.1|2303914_2304460_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004198602.1|2305887_2306664_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004522525.1|2306874_2307564_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004193161.1|2307560_2308274_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004553879.1|2308296_2309076_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	3.9e-26
WP_004191758.1|2309970_2311059_+	porin	NA	NA	NA	NA	NA
WP_004193987.1|2311515_2311854_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_004198600.1|2311914_2313615_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.8	5.8e-91
WP_024900822.1|2313735_2314914_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011807749.1|2315545_2315935_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004199405.1|2315913_2316810_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	43.1	2.1e-07
WP_004192356.1|2316868_2317396_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.8	9.0e-51
WP_004193515.1|2317556_2318996_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004192728.1|2319084_2319843_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004192161.1|2319881_2321189_+	MFS transporter	NA	NA	NA	NA	NA
WP_004193604.1|2321369_2322560_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_004193146.1|2322564_2324544_-	fused uroporphyrinogen-III synthase HemD/membrane protein HemX	NA	NA	NA	NA	NA
WP_004193185.1|2324543_2325533_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_004199404.1|2325567_2325747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191560.1|2325859_2328844_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_041283509.1|2328990_2330454_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	6.8e-80
WP_144245107.1|2330617_2331737_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	1.8e-48
WP_004526841.1|2332754_2333159_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004197408.1|2333217_2333622_-	integration host factor subunit alpha	NA	A0A1P8CWT5	Bacillus_phage	41.1	2.8e-12
WP_004193113.1|2333694_2336127_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004191909.1|2336214_2337228_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	7.8e-27
WP_004192938.1|2337376_2337736_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004191477.1|2337766_2337964_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_071810680.1|2338156_2338681_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	28.7	4.1e-11
WP_004191232.1|2338730_2340638_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.5	1.7e-123
WP_004205973.1|2341096_2343334_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_004197416.1|2343378_2343732_-	RidA family protein	NA	NA	NA	NA	NA
WP_011832186.1|2343805_2344942_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024431237.1|2345109_2346012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192063.1|2346037_2346943_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004193204.1|2347130_2347688_+	ester cyclase	NA	NA	NA	NA	NA
WP_004197421.1|2347702_2348803_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_004548137.1|2348846_2349569_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004191181.1|2349972_2350614_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_004192091.1|2350615_2351320_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_004191840.1|2351572_2352118_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_004197424.1|2352687_2354220_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_004193006.1|2355148_2356222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191805.1|2356597_2357029_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_004192152.1|2357073_2357853_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004193882.1|2358033_2359707_+	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_144245108.1|2360313_2361433_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	6.2e-49
WP_024900959.1|2361478_2361892_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.0	5.8e-29
WP_004521230.1|2361891_2362425_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP008711	Burkholderia mallei strain 6 chromosome 1, complete sequence	3501048	2385968	2463501	3501048	tRNA,transposase,coat	Klosneuvirus(20.0%)	59	NA	NA
WP_004191922.1|2385968_2388836_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	2.8e-146
WP_004192544.1|2388922_2389804_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.9	1.9e-69
WP_004526815.1|2389864_2390482_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_004192128.1|2392975_2394340_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004193573.1|2394336_2395041_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192096.1|2395368_2395755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193727.1|2396030_2396261_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_004192573.1|2396425_2397463_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004193713.1|2397475_2398495_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_004191536.1|2398487_2399369_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004192875.1|2399613_2400663_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004192697.1|2400763_2401909_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024900516.1|2401921_2402722_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.4	3.9e-13
WP_004191266.1|2402735_2404736_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_004196072.1|2404746_2406732_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_004192432.1|2406728_2407649_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_004196071.1|2407648_2408452_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_004193939.1|2408568_2409273_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_051517624.1|2409269_2411555_-	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2R8FFL6	Cedratvirus	26.2	2.4e-07
WP_004191272.1|2411547_2412483_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004193685.1|2412487_2412937_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_004196068.1|2412837_2413182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024900518.1|2413178_2414327_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004193399.1|2414542_2414878_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_004193543.1|2414977_2415529_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_004196065.1|2415820_2416498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144245109.1|2419203_2420324_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_011807697.1|2420354_2421071_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_004192193.1|2421217_2422183_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024900630.1|2422703_2425328_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	5.5e-80
WP_004204969.1|2426004_2427225_+	CoA transferase	NA	NA	NA	NA	NA
WP_004534928.1|2427548_2427758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193654.1|2428037_2429747_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.5	8.8e-188
WP_004192426.1|2430078_2430561_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	3.7e-19
WP_004193860.1|2430579_2430966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196725.1|2433267_2433447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192265.1|2433443_2434304_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_004191662.1|2434347_2435763_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_004193177.1|2435996_2437580_+	acid phosphatase	NA	NA	NA	NA	NA
WP_024900629.1|2437777_2438971_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_024900628.1|2439589_2440777_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004192651.1|2440949_2442569_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004192810.1|2444558_2445191_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004552891.1|2445191_2447273_-	response regulator	NA	A0A1V0SGR3	Hokovirus	26.8	1.7e-12
WP_004196717.1|2447683_2448649_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_024900626.1|2448664_2451076_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004526784.1|2451120_2451960_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004526783.1|2451977_2452502_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191870.1|2452578_2453139_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_024900625.1|2453191_2453737_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004542449.1|2453723_2453909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531175.1|2453994_2454216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196705.1|2454553_2455447_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004538381.1|2455863_2457150_+	MFS transporter	NA	NA	NA	NA	NA
WP_004192394.1|2457194_2458187_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004193855.1|2458654_2458936_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004191144.1|2459188_2459458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024900624.1|2460352_2461666_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_144245078.1|2462380_2463501_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 7
NZ_CP008711	Burkholderia mallei strain 6 chromosome 1, complete sequence	3501048	3002675	3011912	3501048		unidentified_phage(16.67%)	7	NA	NA
WP_024900817.1|3002675_3004223_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
WP_004194373.1|3004259_3004787_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004194274.1|3004783_3005467_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.6e-05
WP_004194137.1|3005531_3006347_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004194350.1|3006522_3008529_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	9.7e-53
WP_004194374.1|3008562_3009693_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	2.9e-22
WP_004194034.1|3009959_3011912_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
>prophage 1
NZ_CP008710	Burkholderia mallei strain 6 chromosome 2, complete sequence	2146721	188166	221408	2146721	plate,transposase	Leptospira_phage(40.0%)	26	NA	NA
WP_144245062.1|188166_189287_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	6.2e-49
WP_162473618.1|189317_189518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004195426.1|189521_190823_+	cystathionine gamma-synthase family protein	NA	A0A1V0SL56	Klosneuvirus	23.2	3.1e-12
WP_004195424.1|190990_191215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004195418.1|191651_192353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004195415.1|192469_193342_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_024900547.1|193637_194195_+	putative glycolipid-binding domain-containing protein	NA	NA	NA	NA	NA
WP_045598292.1|194314_194728_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_144245063.1|194790_195911_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.7	1.5e-47
WP_004528803.1|197131_197764_-	GTP cyclohydrolase I	NA	S4VV34	Pandoravirus	35.4	1.1e-21
WP_004551882.1|197768_198062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201911.1|198020_198266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162473488.1|198225_199449_-	peptidase	NA	NA	NA	NA	NA
WP_024900597.1|200166_204198_-	type VI secretion system protein ImpL	NA	NA	NA	NA	NA
WP_004184888.1|204209_204875_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004206515.1|204871_206269_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004200965.1|206301_207099_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004200966.1|207108_207501_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004200968.1|207529_208291_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_024900598.1|208287_209352_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004206518.1|209369_212012_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004184913.1|212037_215061_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_024900599.1|215087_218171_-	AAA domain-containing protein	NA	A0A223W0B1	Agrobacterium_phage	29.5	4.6e-78
WP_024900600.1|218157_219180_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004200971.1|219167_220910_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004184744.1|220946_221408_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP008710	Burkholderia mallei strain 6 chromosome 2, complete sequence	2146721	398817	455154	2146721	transposase,holin	Leptospira_phage(28.57%)	48	NA	NA
WP_144245065.1|398817_399938_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	3.1e-48
WP_004202495.1|400079_403088_+	sarcosine oxidase subunit alpha family protein	NA	NA	NA	NA	NA
WP_038799547.1|403077_403713_+	sarcosine oxidase subunit gamma	NA	NA	NA	NA	NA
WP_004188502.1|403712_404174_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_009925642.1|404674_404914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202502.1|404811_405024_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004198134.1|405020_405236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187926.1|405676_405880_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	67.2	2.7e-19
WP_004198135.1|405901_406084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188047.1|406080_406296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187451.1|406247_406544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202506.1|406657_407083_-	DUF3761 domain-containing protein	NA	NA	NA	NA	NA
WP_004188692.1|407371_407632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188126.1|407848_408781_+	2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	24.8	2.0e-13
WP_004188566.1|408819_409305_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_009934486.1|409892_412064_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	25.2	4.9e-18
WP_004188466.1|412067_412520_+	response regulator	NA	NA	NA	NA	NA
WP_004188253.1|412516_413995_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_004198884.1|415737_419115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154218748.1|419583_419886_+	DNA polymerase III subunit gamma/tau	NA	NA	NA	NA	NA
WP_004188051.1|420194_421892_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	29.0	1.2e-48
WP_004187839.1|421911_423381_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004202513.1|423423_424011_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_038802950.1|424368_425488_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004186983.1|425656_426556_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004201077.1|426597_426888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186962.1|426777_428097_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_162473623.1|428168_430313_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A219Y950	Aeromonas_phage	54.9	5.8e-104
WP_004186989.1|430385_431357_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004186987.1|431507_432041_+	4-vinyl reductase	NA	NA	NA	NA	NA
WP_004186960.1|432101_434165_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_024900507.1|434167_436093_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004202150.1|436097_437270_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004186884.1|437266_438052_+	drug:proton antiporter	NA	NA	NA	NA	NA
WP_011204351.1|438103_439345_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004186910.1|439365_440511_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004186918.1|440620_441484_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004186811.1|441664_443320_+	APC family permease	NA	NA	NA	NA	NA
WP_004186920.1|443406_444282_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_021252052.1|444425_445298_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186939.1|445460_447014_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_004530058.1|447010_448048_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_004198249.1|448044_448167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200640.1|448275_449418_+	porin	NA	NA	NA	NA	NA
WP_004200641.1|449472_450699_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_004198575.1|450816_452520_-	peptidase	NA	NA	NA	NA	NA
WP_004186852.1|452991_453936_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_011204354.1|454203_455154_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 3
NZ_CP008710	Burkholderia mallei strain 6 chromosome 2, complete sequence	2146721	630334	714993	2146721	protease,transposase,integrase	Leptospira_phage(41.67%)	56	695574:695593	720906:720925
WP_038802950.1|630334_631454_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_024900511.1|631657_636469_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004551771.1|636993_637512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184606.1|637841_638360_-	membrane protein	NA	NA	NA	NA	NA
WP_004184536.1|639199_640921_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_004201091.1|641117_642434_-	TolC family protein	NA	NA	NA	NA	NA
WP_004184640.1|643246_643432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184575.1|643568_645692_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	24.9	2.5e-27
WP_004184588.1|645688_646711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004528592.1|646723_648019_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004202541.1|648032_649529_+	OmpW family protein	NA	NA	NA	NA	NA
WP_004524222.1|649917_650844_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_004537006.1|650930_651188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080747472.1|651598_653206_+	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_004184552.1|653184_653901_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004184355.1|653979_655278_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_076841794.1|655453_655897_+	metal transporter	NA	NA	NA	NA	NA
WP_004528582.1|656000_657071_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004536930.1|657206_657797_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.4	5.8e-22
WP_038730458.1|657817_658102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184538.1|658159_658474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184214.1|658574_659099_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004197859.1|659128_659359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197860.1|659766_661527_+	fatty acyl-AMP ligase	NA	A0A2K9KZV5	Tupanvirus	21.9	4.6e-06
WP_004184602.1|661523_663284_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004184547.1|663280_665074_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004184201.1|665084_665375_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_024900541.1|665834_666638_+	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_123809469.1|678744_679864_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	5.2e-48
WP_004197866.1|680253_680526_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004184766.1|680638_682033_-	heavy metal sensor histidine kinase IrlS	NA	W8CYF6	Bacillus_phage	28.9	1.2e-20
WP_024900560.1|682730_685964_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	24.1	5.2e-72
WP_004197872.1|686009_687479_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004197873.1|687489_688875_-	TolC family protein	NA	NA	NA	NA	NA
WP_004197875.1|689110_689395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524134.1|689792_689933_-	bacteriophage protein	NA	NA	NA	NA	NA
WP_038709382.1|690603_691089_-	membrane protein	NA	NA	NA	NA	NA
WP_004197880.1|691418_691904_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_024900559.1|692171_693662_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_004197883.1|693961_694570_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004199606.1|694701_696702_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	46.2	1.1e-104
695574:695593	attL	CGCCGACGAAGCCGGGCGTG	NA	NA	NA	NA
WP_004537230.1|696755_697268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011204480.1|698082_699849_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004199157.1|699979_700651_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004184876.1|700801_701899_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004199160.1|701895_704997_+	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.0	3.6e-46
WP_004266238.1|705131_706670_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004202576.1|706684_706981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199609.1|707026_707644_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	44.6	6.9e-34
WP_004197695.1|707640_709338_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004197696.1|709334_710015_+	1,6-didemethyltoxoflavin N1-methyltransferase	NA	NA	NA	NA	NA
WP_024900397.1|710088_711780_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	24.7	1.5e-06
WP_004197698.1|711876_712323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038796399.1|712491_712710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199610.1|712693_713851_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_038802950.1|713872_714993_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
720906:720925	attR	CGCCGACGAAGCCGGGCGTG	NA	NA	NA	NA
>prophage 4
NZ_CP008710	Burkholderia mallei strain 6 chromosome 2, complete sequence	2146721	1316278	1382777	2146721	plate,transposase,tRNA	Leptospira_phage(18.18%)	49	NA	NA
WP_004203245.1|1316278_1317091_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_004203246.1|1317090_1319718_-	membrane protein	NA	NA	NA	NA	NA
WP_004188178.1|1319853_1320975_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004525190.1|1320973_1321135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187693.1|1321316_1322384_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_004187882.1|1322432_1323083_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_004187125.1|1323160_1323310_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_004187091.1|1323306_1324716_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_004187288.1|1325107_1326403_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004187652.1|1326395_1327343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187998.1|1328062_1328590_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187349.1|1328750_1331474_+	alpha-ketoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_004188364.1|1331725_1332970_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_144245068.1|1334181_1335301_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	4.0e-48
WP_004196172.1|1335632_1336892_-	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	22.6	2.1e-05
WP_004190757.1|1338113_1339214_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.0	6.3e-22
WP_024900854.1|1339322_1340852_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.9	2.8e-12
WP_004190433.1|1340953_1341988_-	lipase secretion chaperone	NA	NA	NA	NA	NA
WP_004553588.1|1341991_1343086_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004190808.1|1343409_1345647_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_004190837.1|1345734_1346130_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004190603.1|1346290_1346827_-	cytochrome b	NA	NA	NA	NA	NA
WP_004190805.1|1347095_1347731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204344.1|1347861_1348626_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	38.7	4.7e-08
WP_004190911.1|1348904_1349216_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011204342.1|1349660_1349993_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004190614.1|1350191_1351607_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	30.2	2.1e-41
WP_004190588.1|1351595_1351739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190461.1|1352053_1352731_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_004190245.1|1352693_1353632_-	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	25.3	1.4e-14
WP_004190776.1|1353628_1355053_-	cytosine permease	NA	NA	NA	NA	NA
WP_011204340.1|1355569_1356550_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_144245069.1|1357203_1358324_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	1.8e-48
WP_162473620.1|1358354_1359431_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_004196151.1|1359360_1360014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203275.1|1360088_1362293_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004203276.1|1362289_1364944_-	type VI secretion system ATPase TssH	NA	A0A1S6UBG5	Serratia_phage	30.9	2.7e-79
WP_024900789.1|1364922_1366413_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004190509.1|1366409_1368281_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004196148.1|1368285_1368846_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004190698.1|1368864_1369356_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004190849.1|1369415_1370924_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004190671.1|1370916_1371495_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190988.1|1371557_1372637_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004190797.1|1372689_1375287_-	protein kinase	NA	A7IVH4	Paramecium_bursaria_Chlorella_virus	25.1	1.0e-14
WP_004190273.1|1375285_1375513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190681.1|1376409_1380039_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190689.1|1380041_1381358_-	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004190585.1|1381373_1382777_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 5
NZ_CP008710	Burkholderia mallei strain 6 chromosome 2, complete sequence	2146721	1865782	1918117	2146721	integrase,transposase,portal	Burkholderia_phage(33.33%)	47	1891539:1891558	1908239:1908258
WP_004190269.1|1865782_1866787_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_024900472.1|1866859_1868389_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	27.9	1.3e-46
WP_004190833.1|1868784_1869864_+	putative membrane protein	NA	NA	NA	NA	NA
WP_144245077.1|1869929_1871049_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004190721.1|1871077_1871965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190171.1|1872213_1873434_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.3	1.0e-238
WP_004533441.1|1874017_1874872_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190802.1|1874967_1875561_+	LysE family translocator	NA	NA	NA	NA	NA
WP_004195676.1|1875802_1876213_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004190743.1|1876465_1877704_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_024900588.1|1877768_1878224_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_004190582.1|1879508_1881152_+	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_004190469.1|1881310_1881940_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_004190954.1|1881936_1883277_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004190659.1|1883362_1884142_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004190540.1|1884234_1885155_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004190343.1|1885221_1886097_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190990.1|1886194_1886578_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_004195687.1|1886775_1888698_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_024900587.1|1888732_1889581_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_004190506.1|1890124_1890826_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.3	2.9e-20
WP_004190258.1|1890827_1891502_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004195689.1|1891514_1892315_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1891539:1891558	attL	CTTGAAGCCGTACTTCGCGA	NA	NA	NA	NA
WP_004204469.1|1892755_1893454_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004190691.1|1893704_1894853_+	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_004190391.1|1894949_1895108_+	DUF3563 domain-containing protein	NA	NA	NA	NA	NA
WP_004190960.1|1895220_1895640_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_004190487.1|1895777_1896230_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038730270.1|1896349_1896601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190835.1|1896732_1897545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190439.1|1897535_1898531_-	homoserine kinase	NA	NA	NA	NA	NA
WP_004190726.1|1898624_1899023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190957.1|1899178_1900705_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_004195697.1|1900788_1901475_-|integrase	tyrosine-type recombinase/integrase	integrase	E5E3N4	Burkholderia_phage	81.6	3.3e-93
WP_009950031.1|1901471_1901759_-|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	94.4	6.4e-43
WP_004203322.1|1904100_1904364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190352.1|1904799_1905291_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004190916.1|1905950_1906235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190924.1|1906386_1906656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004530319.1|1906652_1907402_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_004190446.1|1907403_1910184_+	DNA polymerase I	NA	A0A1J0GVZ7	Streptomyces_phage	31.0	5.6e-51
1908239:1908258	attR	TCGCGAAGTACGGCTTCAAG	NA	NA	NA	NA
WP_004190401.1|1910502_1911885_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038763983.1|1912218_1914012_-	membrane protein	NA	NA	NA	NA	NA
WP_004204467.1|1914351_1914573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190499.1|1914725_1915601_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004190656.1|1915659_1916529_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_038802231.1|1916653_1918117_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
