The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008695	Streptococcus pyogenes strain M23ND chromosome, complete genome	1846477	30660	43047	1846477		Synechococcus_phage(28.57%)	8	NA	NA
WP_038433059.1|30660_34386_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.2	9.6e-38
WP_009880323.1|34619_36074_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
WP_038433060.1|36101_37124_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.7	2.4e-63
WP_002986700.1|37291_37846_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	2.4e-25
WP_038433061.1|38029_39577_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	5.7e-45
WP_038433062.1|39635_40760_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_038433063.1|41012_42278_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_038433064.1|42558_43047_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	1.9e-18
>prophage 2
NZ_CP008695	Streptococcus pyogenes strain M23ND chromosome, complete genome	1846477	153902	257257	1846477	terminase,capsid,protease,tRNA,portal,head,holin,bacteriocin,tail	Streptococcus_phage(56.34%)	116	NA	NA
WP_038433782.1|153902_155027_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_096466706.1|155095_156193_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_002985455.1|156212_156905_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.6	1.0e-30
WP_002990498.1|156897_157827_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_080286774.1|158136_158835_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	62.9	2.3e-78
WP_002993974.1|159002_159767_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_011184346.1|159874_162376_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	48.0	1.8e-202
WP_038433120.1|162710_163904_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_038433121.1|163924_165271_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.8	2.8e-56
WP_002985434.1|165683_166574_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	8.8e-06
WP_011017561.1|166570_167548_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	74.2	1.2e-138
WP_011054317.1|167544_168456_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.7	1.0e-105
WP_011017563.1|168632_170048_-	recombinase family protein	NA	A5GZ62	Lactococcus_phage	47.2	1.4e-109
WP_002985420.1|170170_170476_-	membrane protein	NA	NA	NA	NA	NA
WP_002985417.1|170485_171250_-	helix-turn-helix transcriptional regulator	NA	E8ZDN4	Streptococcus_phage	64.5	2.0e-83
WP_021340643.1|171611_171761_+	hypothetical protein	NA	J7KH12	Streptococcus_phage	91.8	4.3e-19
WP_021341080.1|171746_171962_-	hypothetical protein	NA	J7KBX0	Streptococcus_phage	95.7	2.5e-28
WP_080286776.1|172020_172179_+	hypothetical protein	NA	J7KH24	Streptococcus_phage	90.4	6.4e-21
WP_001008979.1|172277_172919_-	hypothetical protein	NA	J7KJ31	Streptococcus_phage	100.0	1.5e-116
WP_002985407.1|172970_173159_+	helix-turn-helix transcriptional regulator	NA	A0A0B5A7F0	Streptococcus_phage	63.3	2.6e-13
WP_002985404.1|173207_173969_+	phage repressor protein/antirepressor Ant	NA	A0A0C5AEJ9	Bacteriophage	61.9	1.6e-85
WP_011889039.1|174109_174292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985395.1|174378_174516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002985392.1|174517_174703_+	hypothetical protein	NA	Q938N3	Temperate_phage	83.6	2.0e-21
WP_002985388.1|175185_175572_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	55.0	2.8e-25
WP_002985387.1|175552_175786_+	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	6.1e-36
WP_011017992.1|175782_175923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011017565.1|175931_176138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922475.1|176193_176526_+	hypothetical protein	NA	J7KGX3	Streptococcus_phage	78.7	2.2e-42
WP_010922474.1|176525_177515_+	recombinase RecT	NA	A0A286QMX3	Streptococcus_phage	44.2	5.8e-59
WP_000594115.1|177511_177712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038433123.1|177704_178502_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	84.2	2.3e-130
WP_002985383.1|178678_179020_+	hypothetical protein	NA	M1NS23	Streptococcus_phage	38.7	3.1e-12
WP_002985380.1|179016_179529_+	hypothetical protein	NA	Q708P9	Streptococcus_phage	73.2	8.4e-62
WP_011017567.1|179515_179713_+	hypothetical protein	NA	A3F626	Streptococcus_phage	86.5	9.9e-11
WP_011017568.1|179706_179991_+	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	100.0	7.0e-50
WP_002987593.1|179987_180257_+	hypothetical protein	NA	A0A1P8VVR6	Streptococcus_phage	100.0	3.1e-47
WP_011017569.1|180266_180680_+	hypothetical protein	NA	Q938M1	Temperate_phage	65.2	6.4e-36
WP_011017570.1|180676_180961_+	hypothetical protein	NA	A3F628	Streptococcus_phage	79.8	4.6e-33
WP_021340166.1|181452_181680_+	hypothetical protein	NA	A3F630	Streptococcus_phage	76.0	1.9e-26
WP_011054812.1|181704_181890_+	hypothetical protein	NA	A0A097PBF0	Streptococcus_pyogenes_phage	100.0	7.0e-27
WP_032461638.1|182176_182680_+	DUF1642 domain-containing protein	NA	A0A097PAV5	Streptococcus_pyogenes_phage	99.4	1.5e-92
WP_002987493.1|182676_182847_+	hypothetical protein	NA	A0A097PAS8	Streptococcus_pyogenes_phage	100.0	2.9e-27
WP_011017574.1|183122_183560_+	DUF1492 domain-containing protein	NA	A0A097PBF1	Streptococcus_pyogenes_phage	97.9	6.7e-76
WP_038433125.1|184142_185072_+	DNA adenine methylase	NA	A0A126HAU2	Lactococcus_phage	71.5	2.4e-99
WP_002987543.1|185198_185576_-	type II toxin-antitoxin system HicB family antitoxin	NA	I3NLB2	Bifidobacterium_phage	44.0	3.3e-15
WP_001132273.1|185627_185813_-	type II toxin-antitoxin system HicA family toxin	NA	D6PSW1	Lactobacillus_phage	54.0	1.7e-09
WP_002985375.1|186048_186387_+	HNH endonuclease	NA	J7KH36	Streptococcus_phage	90.7	3.0e-55
WP_002985371.1|186557_187025_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
WP_002985368.1|187027_187258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038433127.1|187239_189015_+	amino acid transporter	NA	J7KKD1	Streptococcus_phage	96.6	0.0e+00
WP_002985365.1|189011_189182_+	hypothetical protein	NA	J7KK43	Streptococcus_phage	62.5	2.3e-08
WP_002985363.1|189174_189399_+	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
WP_038433129.1|189432_190653_+|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.4	1.3e-185
WP_021341143.1|190630_191296_+|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	78.6	5.4e-93
WP_029714355.1|191319_192504_+|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	76.3	2.3e-163
WP_021341088.1|192648_192951_+|head,tail	phage head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	87.8	2.6e-42
WP_029714354.1|192947_193295_+|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	84.5	2.1e-48
WP_021340627.1|193291_193669_+	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	73.6	1.8e-45
WP_021341057.1|193665_194091_+	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	85.8	2.9e-68
WP_021341058.1|194107_194719_+|tail	phage major tail protein	tail	J7KKC8	Streptococcus_phage	73.0	1.8e-74
WP_021733367.1|194771_195098_+	hypothetical protein	NA	J7KK85	Streptococcus_phage	75.0	6.4e-39
WP_021299462.1|195145_195295_+	hypothetical protein	NA	J7KBS0	Streptococcus_phage	85.7	1.7e-15
WP_038433133.1|195307_199231_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	48.5	1.9e-238
WP_011527559.1|199230_199938_+|tail	phage tail family protein	tail	Q938K2	Temperate_phage	71.9	6.8e-94
WP_038433135.1|199934_202079_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	94.4	0.0e+00
WP_011017589.1|202075_203086_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	75.8	7.8e-136
WP_014635603.1|203098_204985_+	gp58-like family protein	NA	Q938J9	Temperate_phage	84.6	2.0e-217
WP_002983467.1|204996_205428_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	89.5	1.3e-63
WP_011017592.1|205430_206048_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	89.3	5.0e-77
WP_002987582.1|206057_206333_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
WP_000609113.1|206329_206557_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	5.8e-31
WP_002985329.1|206672_207878_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	83.3	1.6e-204
WP_002985327.1|207945_208653_-	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
WP_002985324.1|208763_209522_-	DNase Mf2	NA	NA	NA	NA	NA
WP_038433138.1|209833_211252_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_038433140.1|211404_212952_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_011017595.1|213108_213831_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038433141.1|213850_215050_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002985307.1|215146_215407_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_038433143.1|215521_216463_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_002985303.1|216856_217306_+	flavodoxin	NA	NA	NA	NA	NA
WP_011889032.1|217481_217766_+	chorismate mutase	NA	NA	NA	NA	NA
WP_038433144.1|217758_219021_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	50.3	1.6e-93
WP_002985298.1|219135_219483_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_038433145.1|220497_221067_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_011017600.1|221067_223020_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.2	8.9e-144
WP_011017601.1|223387_225112_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_038433147.1|225243_225702_-	YueI family protein	NA	W6LLD2	Streptococcus_phage	39.7	1.8e-18
WP_002985288.1|225928_227236_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	96.6	1.2e-240
WP_002985285.1|228005_228167_+	TOMM family cytolysin streptolysin S	NA	NA	NA	NA	NA
WP_038433148.1|228388_229339_+	streptolysin S biosynthesis dehydrogenase SagB	NA	NA	NA	NA	NA
WP_023611474.1|229335_230394_+|bacteriocin	bacteriocin biosynthesis cyclodehydratase SagC	bacteriocin	NA	NA	NA	NA
WP_038433149.1|230413_231772_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_002985272.1|231746_232418_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_038433150.1|232414_233098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990429.1|233120_234044_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	38.1	6.7e-33
WP_002985266.1|234052_235180_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002985264.1|235176_236295_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_038433152.1|236866_239599_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011017607.1|239876_240377_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	32.4	5.4e-05
WP_038433154.1|240570_242529_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	34.9	9.9e-103
WP_011017609.1|242542_243565_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	27.9	3.6e-19
WP_002985249.1|243956_244154_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_002985244.1|244188_244905_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_002985242.1|244922_245417_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_038433156.1|245416_245953_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_011889023.1|245968_247474_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_002985236.1|247492_248368_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_038433158.1|248530_249937_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_002994425.1|249949_250366_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_011889022.1|250631_250889_+	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_002994428.1|250953_252225_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_011017613.1|252228_252417_+	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
WP_003057440.1|253598_254642_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.3	4.6e-30
WP_038433160.1|254851_257257_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP008695	Streptococcus pyogenes strain M23ND chromosome, complete genome	1846477	292669	300068	1846477		Streptococcus_phage(66.67%)	6	NA	NA
WP_011889006.1|292669_294880_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	6.5e-268
WP_002985142.1|294987_296151_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_002985140.1|296147_296834_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_038433180.1|296927_298094_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	5.8e-34
WP_002985134.1|298154_298496_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	40.2	5.9e-19
WP_038433181.1|298715_300068_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	1.3e-29
>prophage 4
NZ_CP008695	Streptococcus pyogenes strain M23ND chromosome, complete genome	1846477	394877	495068	1846477	integrase,terminase,capsid,protease,tRNA,portal,head,holin,transposase,tail	Streptococcus_phage(65.67%)	105	493456:493515	505368:506421
WP_038433218.1|394877_395777_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_038433219.1|395849_397088_+	GTPase HflX	NA	NA	NA	NA	NA
WP_038433220.1|397080_397716_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_002984894.1|397730_398660_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_038433221.1|398659_399424_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_038433222.1|399420_401631_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.0	8.7e-71
WP_002990109.1|401780_402299_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.4	3.9e-30
WP_011184446.1|402379_403063_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	36.8	2.2e-09
WP_002990106.1|403059_403716_+	endonuclease III	NA	NA	NA	NA	NA
WP_038433223.1|403787_404474_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002984887.1|404463_405252_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_011184448.1|405291_406398_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_002992970.1|406455_407325_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.6	2.4e-101
WP_002990099.1|407324_407918_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_002984881.1|408161_409202_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	1.1e-68
WP_011888953.1|409284_410424_-|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	56.3	1.2e-119
WP_011285632.1|410551_410818_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_011888747.1|410829_411216_-	hypothetical protein	NA	M1PFJ2	Streptococcus_phage	55.5	3.3e-34
WP_011888748.1|411218_411569_-	helix-turn-helix transcriptional regulator	NA	C5J980	Streptococcus_phage	62.6	1.1e-33
WP_038433225.1|411876_412092_+	hypothetical protein	NA	M1Q1B4	Streptococcus_phage	79.7	1.2e-25
WP_011285629.1|412303_413110_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	82.1	7.9e-123
WP_011284879.1|413251_413491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054585.1|413657_413843_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_038433227.1|413920_414232_+	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	80.4	8.2e-44
WP_011888947.1|414233_414404_+	hypothetical protein	NA	A7J273	Streptococcus_phage	89.3	1.2e-20
WP_030127424.1|414396_414600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038433229.1|414596_414983_+	hypothetical protein	NA	A7J274	Streptococcus_phage	89.0	3.3e-58
WP_038433231.1|415126_415477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023611025.1|415473_415677_+	hypothetical protein	NA	A7J276	Streptococcus_phage	98.5	1.6e-32
WP_002988708.1|415765_416065_+	hypothetical protein	NA	A7J277	Streptococcus_phage	100.0	1.8e-43
WP_038433232.1|416064_417222_+	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	97.9	8.8e-216
WP_086934854.1|417230_417794_+	DUF2815 family protein	NA	D2J040	Enterococcus_phage	58.5	3.3e-51
WP_038433233.1|417836_419759_+	DNA polymerase	NA	A7J280	Streptococcus_phage	99.1	0.0e+00
WP_038433235.1|419763_422148_+	DNA primase	NA	A7J282	Streptococcus_phage	94.8	4.8e-277
WP_015898615.1|422533_422809_+	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	97.8	7.7e-46
WP_038433239.1|422805_424128_+	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.7	5.1e-252
WP_164972002.1|424128_424299_+	hypothetical protein	NA	A7J285	Streptococcus_phage	92.3	9.0e-21
WP_011054882.1|424291_424564_+	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
WP_011054881.1|424696_425113_+	transcriptional regulator	NA	A7J289	Streptococcus_phage	99.3	3.3e-72
WP_011106637.1|425202_425655_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	100.0	6.9e-76
WP_038433241.1|425644_426922_+|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	99.8	3.1e-246
WP_038433243.1|426937_428470_+|portal	phage portal protein	portal	A7J292	Streptococcus_phage	99.8	4.5e-292
WP_032465703.1|428429_429878_+|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	99.8	1.2e-278
WP_011054876.1|429905_430094_+	hypothetical protein	NA	A7J294	Streptococcus_phage	100.0	7.4e-24
WP_011888934.1|430098_430365_+	hypothetical protein	NA	Q938K9	Temperate_phage	96.6	2.9e-37
WP_011888933.1|430532_431102_+	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	100.0	1.9e-83
WP_002983429.1|431114_432002_+	hypothetical protein	NA	A7J297	Streptococcus_phage	100.0	2.1e-161
WP_011054873.1|432013_432370_+|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	100.0	4.6e-59
WP_011054872.1|432380_432659_+	hypothetical protein	NA	A7J299	Streptococcus_phage	100.0	1.9e-47
WP_011106640.1|432655_433000_+	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	98.2	5.1e-55
WP_011054870.1|433003_433363_+	hypothetical protein	NA	A7J2A1	Streptococcus_phage	98.3	1.2e-57
WP_011054869.1|433374_433974_+|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	97.1	1.7e-90
WP_023079225.1|434027_434483_+	phage protein	NA	A7J2A3	Streptococcus_phage	98.7	1.2e-75
WP_011054867.1|434557_434791_+	hypothetical protein	NA	A7J2A4	Streptococcus_phage	97.4	6.4e-33
WP_038433245.1|434805_439188_+	tape measure protein	NA	A7J2A5	Streptococcus_phage	73.8	6.7e-224
WP_038433247.1|439199_440042_+|tail	phage tail family protein	tail	A7J2A6	Streptococcus_phage	97.1	2.0e-156
WP_038433248.1|440051_442034_+|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	93.9	0.0e+00
WP_038433249.1|442033_443143_+	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	71.3	1.3e-120
WP_023079897.1|445236_445665_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	80.0	9.2e-54
WP_023079933.1|445667_446279_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.7	3.4e-78
WP_011017397.1|446296_446569_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_003058873.1|446565_446793_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_038433251.1|446911_448129_+	glucosaminidase domain-containing protein	NA	A0A1P8VVM5	Streptococcus_phage	59.7	1.2e-162
WP_002988467.1|448264_449389_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	49.1	3.1e-93
WP_002988472.1|449636_450419_+	exotoxin	NA	A0A097PAT7	Streptococcus_pyogenes_phage	45.8	4.3e-49
WP_011017964.1|450531_450714_+	hypothetical protein	NA	A3F673	Streptococcus_phage	76.7	1.4e-19
WP_038433253.1|451243_453106_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.0	1.4e-90
WP_010922443.1|453405_454341_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	44.8	1.3e-65
WP_002983928.1|454579_455275_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_011017960.1|455381_455903_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_011017959.1|456063_456606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038433256.1|456729_457509_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_011888787.1|458297_458894_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011017958.1|458994_460041_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_038433258.1|460239_461631_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_038433259.1|461710_462406_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_002989155.1|462653_464198_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	29.1	1.1e-35
WP_038433260.1|464504_466124_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.2	1.9e-59
WP_038433262.1|466250_468251_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	33.8	5.5e-64
WP_003061674.1|468274_468553_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	36.0	3.6e-06
WP_038433264.1|468542_469397_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_022554937.1|469436_470177_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_038433267.1|471019_473263_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	58.5	2.6e-54
WP_011888795.1|473333_474374_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_002983977.1|474470_475076_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	53.2	1.8e-58
WP_038433269.1|475152_476133_-|transposase	IS30-like element IS1239 family transposase	transposase	H7BWC8	unidentified_phage	32.0	2.1e-32
WP_011054657.1|476328_476556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023077218.1|476540_476789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922430.1|477476_478697_-	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_011284937.1|478703_479732_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011888796.1|479933_480683_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002995774.1|480756_481473_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_023078855.1|481767_482730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038433275.1|482742_484548_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_038433276.1|484920_486117_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_002984000.1|486182_486890_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	27.2	2.0e-08
WP_038433277.1|486952_488008_+	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_038433280.1|488394_491013_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.9	1.5e-61
WP_030127117.1|491372_491588_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011184659.1|491584_492346_+	DUF3169 family protein	NA	NA	NA	NA	NA
WP_011888803.1|492364_493060_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_158467503.1|493157_493373_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	38.0	2.5e-07
493456:493515	attL	GAAAAATTCTAAAATGAACTTAGCCACTTTTAAGGTATGAAAAAAGCACCTCTAAGAGGT	NA	NA	NA	NA
WP_038433282.1|493555_494554_+|transposase	IS30-like element IS1239 family transposase	transposase	H7BW61	unidentified_phage	35.0	2.1e-32
WP_080286781.1|494510_494696_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	44.6	1.4e-06
WP_011054621.1|494771_495068_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
505368:506421	attR	ACCTCTTAGAGGTGCTTTTTTCATACCTTAAAAGTGGCTAAGTTCATTTTAGAATTTTTCGTAATAAAAAAAATAAACAAAAAGTTAGGTTAACTTAACTTTTTGTTTATTTTTTTAATGTTTTTTGCTACAATAGTCTATACAGATGGAGGCAACTATTGAAAAAATTAAATGTTATTCTTGTTGGTTTATTAAGCATTCTGATGTTGAGTTTAGCTATTGTGTTTATTAATCGTTGGAAACTAAACGAAGATAGTCAGCGTATAGTTTTGGCTGAAAAGAAAAAAAACACGTCAGATTTAGTGATCAAAGCTGTAAAACATATTAAAAAAGATCAAAAAGACTATTATTATTTTTCCCCGATAAAACAAGCAGATGATTTTTTTGTAGATAATTTACCTGTTTCATTATACAAAAAAAAGAATTCAGATAAAGAATTGATTTTGGTAAAGCCTAAACTGCAATCTTCTCACCTAAGATCAGTTAACACTTTGACTATTTCTAAAATAGTTTATCAGAAAAAATTTTTTCATTTGGCTAAAAAATCAGAAAAAGTTATAAGTACATATCACGTTACAGACGACTTGAAACCGTTTCAGGTAAAGGATCTAGTATCAGGACATTTAGAAAGAATACAAGAAGAAGTTGAAAAAAAATATCCAAATGCTGGTTTTAATAGCGATAAGTACAATGGCTTAAAAGAATCTAATTCTTTATTAAGCGATGGCTTTGAGGTAAAATCGGGAAACCTTATTTTTGATAAAAAGCTAACGATACCTTTGACGACATTATTTGATGTTATTAATCCAGATTTTTTAGCAAATAGCGATAGAGCTGCGTATGATAATTATAGGACCTACAAAGAACAGCATCCCAAAAAACTAGTTGCATTAACGTTTGATGATGGTCCAGATCCGACGACGACTCCTCAAGTTTTAGATATTTTGGCAAAATACCAGGCTAAGGGAACTTTCTTTATGATAGGTTCAAAAGTTGTGAATAATGAAAACCTTACTAAACGTGTTAGCGACGCTGGCCATGAAATTGCTAATCA	NA	NA	NA	NA
>prophage 5
NZ_CP008695	Streptococcus pyogenes strain M23ND chromosome, complete genome	1846477	569250	651632	1846477	integrase,terminase,capsid,protease,tRNA,portal,head,holin,transposase,tail	Streptococcus_phage(58.46%)	96	571508:571523	575785:575800
WP_038433313.1|569250_571515_+	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
571508:571523	attL	CACGATAAAAAATAAT	NA	NA	NA	NA
WP_002989605.1|571771_572392_-	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
WP_038433317.1|572755_573844_-|integrase	site-specific integrase	integrase	Q38159	Streptococcus_phage	100.0	3.8e-205
WP_002984270.1|574093_574903_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	J7KDP1	Streptococcus_phage	35.8	3.8e-24
WP_038433318.1|574915_575740_-	helix-turn-helix transcriptional regulator	NA	A0A097PBE5	Streptococcus_pyogenes_phage	84.8	8.4e-120
WP_021340643.1|576095_576245_+	hypothetical protein	NA	J7KH12	Streptococcus_phage	91.8	4.3e-19
575785:575800	attR	CACGATAAAAAATAAT	NA	NA	NA	NA
WP_021341080.1|576230_576446_-	hypothetical protein	NA	J7KBX0	Streptococcus_phage	95.7	2.5e-28
WP_080286776.1|576504_576663_+	hypothetical protein	NA	J7KH24	Streptococcus_phage	90.4	6.4e-21
WP_001008979.1|576761_577403_-	hypothetical protein	NA	J7KJ31	Streptococcus_phage	100.0	1.5e-116
WP_038433319.1|577454_577655_+	helix-turn-helix transcriptional regulator	NA	A0A141E205	Streptococcus_phage	61.4	2.1e-08
WP_011284879.1|577785_578025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054585.1|578191_578377_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_011017882.1|578455_578752_+	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	98.0	3.1e-48
WP_023610888.1|578898_579213_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVN6	Streptococcus_phage	95.2	2.7e-50
WP_009881060.1|579226_580057_+	phage replisome organizer N-terminal domain-containing protein	NA	A0A1S5S918	Streptococcus_phage	54.7	6.4e-67
WP_080286784.1|580043_580676_+	ATP-binding protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	91.9	1.3e-99
WP_011285579.1|580688_581042_+	hypothetical protein	NA	A0A097PAU3	Streptococcus_pyogenes_phage	54.0	2.8e-16
WP_011018143.1|581022_581277_+	hypothetical protein	NA	Q938N0	Temperate_phage	98.8	3.7e-42
WP_011285577.1|581298_581781_+	siphovirus Gp157 family protein	NA	Q938M9	Temperate_phage	99.4	4.1e-50
WP_038433320.1|581781_582456_+	ERF family protein	NA	Q938M8	Temperate_phage	90.2	5.3e-104
WP_038433322.1|582448_582940_+	single-stranded DNA-binding protein	NA	A0A286QNX2	Streptococcus_phage	74.8	5.8e-60
WP_011106686.1|582945_583149_+	hypothetical protein	NA	Q938M6	Temperate_phage	100.0	4.7e-32
WP_011018139.1|583148_583589_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A097PAS0	Streptococcus_pyogenes_phage	98.6	1.6e-80
WP_011018138.1|583585_583942_+	hypothetical protein	NA	A0A1P8VVP9	Streptococcus_phage	100.0	5.0e-61
WP_011054755.1|584183_584468_+	DUF3310 domain-containing protein	NA	Q938M3	Temperate_phage	100.0	5.4e-50
WP_038433325.1|584464_584734_+	hypothetical protein	NA	Q938M2	Temperate_phage	88.8	1.5e-41
WP_038433326.1|584747_585134_+	hypothetical protein	NA	A0A141E1U2	Streptococcus_phage	43.0	2.4e-21
WP_011017570.1|585130_585415_+	hypothetical protein	NA	A3F628	Streptococcus_phage	79.8	4.6e-33
WP_021340166.1|585906_586134_+	hypothetical protein	NA	A3F630	Streptococcus_phage	76.0	1.9e-26
WP_011054812.1|586158_586344_+	hypothetical protein	NA	A0A097PBF0	Streptococcus_pyogenes_phage	100.0	7.0e-27
WP_032461638.1|586630_587134_+	DUF1642 domain-containing protein	NA	A0A097PAV5	Streptococcus_pyogenes_phage	99.4	1.5e-92
WP_002987493.1|587130_587301_+	hypothetical protein	NA	A0A097PAS8	Streptococcus_pyogenes_phage	100.0	2.9e-27
WP_148305426.1|587295_587394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054810.1|587583_588018_+	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	94.4	2.2e-71
WP_021340284.1|588610_588952_+	HNH endonuclease	NA	J7KH36	Streptococcus_phage	90.7	2.5e-54
WP_002985371.1|589119_589587_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
WP_038433329.1|589601_591356_+	amino acid transporter	NA	J7KKD1	Streptococcus_phage	96.6	0.0e+00
WP_002985365.1|591352_591523_+	hypothetical protein	NA	J7KK43	Streptococcus_phage	62.5	2.3e-08
WP_002985363.1|591515_591740_+	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
WP_038433129.1|591773_592994_+|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.4	1.3e-185
WP_021341143.1|592971_593637_+|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	78.6	5.4e-93
WP_029714355.1|593660_594845_+|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	76.3	2.3e-163
WP_021341088.1|594989_595292_+|head,tail	phage head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	87.8	2.6e-42
WP_029714354.1|595288_595636_+|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	84.5	2.1e-48
WP_021340627.1|595632_596010_+	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	73.6	1.8e-45
WP_021341057.1|596006_596432_+	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	85.8	2.9e-68
WP_021341058.1|596448_597060_+|tail	phage major tail protein	tail	J7KKC8	Streptococcus_phage	73.0	1.8e-74
WP_021733367.1|597112_597439_+	hypothetical protein	NA	J7KK85	Streptococcus_phage	75.0	6.4e-39
WP_021299462.1|597486_597636_+	hypothetical protein	NA	J7KBS0	Streptococcus_phage	85.7	1.7e-15
WP_038433133.1|597648_601572_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	48.5	1.9e-238
WP_024623478.1|601571_602279_+	hypothetical protein	NA	Q938K2	Temperate_phage	70.6	1.7e-92
WP_038433331.1|602275_604420_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	94.4	0.0e+00
WP_038433336.1|604416_605421_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	59.8	2.1e-101
WP_052153463.1|605436_607455_+	gp58-like family protein	NA	Q938J9	Temperate_phage	65.0	5.3e-107
WP_002987333.1|607468_607630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038433337.1|607632_608244_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	91.6	7.9e-83
WP_002987582.1|608259_608535_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
WP_000609113.1|608531_608759_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	5.8e-31
WP_038433339.1|608884_610213_+	lysin	NA	Q5MY96	Streptococcus_phage	93.9	2.6e-248
WP_038433341.1|610291_610732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162472510.1|611003_611804_-	streptodornase Sda3	NA	NA	NA	NA	NA
WP_032461628.1|612041_612230_+	hypothetical protein	NA	A3F673	Streptococcus_phage	81.4	6.5e-20
WP_002989607.1|612820_613435_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	6.2e-51
WP_038433345.1|613561_614347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984437.1|614356_615055_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
WP_038433347.1|615054_615426_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038433348.1|615610_618721_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.9	8.3e-120
WP_002984444.1|618800_619814_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_038433350.1|619876_621379_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_011184572.1|621508_622066_+	signal peptidase I	NA	NA	NA	NA	NA
WP_038433352.1|622078_623527_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	91.5	4.6e-254
WP_038433353.1|623798_625613_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A0A1J0F994	Only_Syngen_Nebraska_virus	37.4	2.8e-99
WP_011184569.1|625735_627502_+	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_038433354.1|628914_630048_+|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_002989626.1|630214_630550_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_038433355.1|630656_631298_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002984457.1|631307_631937_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	1.3e-27
WP_002984460.1|631952_632789_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038433357.1|633162_633936_+	CAMP factor pore-forming toxin Cfa	NA	NA	NA	NA	NA
WP_011017829.1|634305_635541_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_038433358.1|635660_636983_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_038433360.1|637512_639831_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.0	2.7e-131
WP_002984469.1|640193_640442_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002984470.1|640478_641090_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_011888836.1|641100_641289_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002984475.1|641301_641841_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984476.1|641881_642082_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	50.0	1.8e-07
WP_021340922.1|642092_642581_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984480.1|642743_643385_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011017823.1|643527_644070_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002989664.1|644187_644889_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	4.9e-36
WP_030127228.1|644903_647540_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002993908.1|647631_648228_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_038433363.1|648238_649195_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_038433364.1|649291_650632_+	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_038433366.1|650747_651632_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP008695	Streptococcus pyogenes strain M23ND chromosome, complete genome	1846477	843630	879500	1846477	terminase,integrase,capsid,portal,holin,tail	Streptococcus_phage(72.09%)	53	860568:860583	877381:877396
WP_080286815.1|843630_844308_-	streptococcal pyrogenic exotoxin SpeI	NA	A0A075M4C7	Staphylococcus_phage	32.0	1.2e-26
WP_038433469.1|844574_845327_-	SH3 domain-containing protein	NA	A3F665	Streptococcus_phage	96.8	1.0e-140
WP_021733507.1|845328_845661_-|holin	phage holin	holin	A3F664	Streptococcus_phage	98.2	2.8e-50
WP_021733504.1|845673_845994_-	hypothetical protein	NA	A3F663	Streptococcus_phage	99.1	1.2e-50
WP_038433470.1|846004_846616_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	91.1	8.8e-82
WP_002987333.1|846618_846780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038433471.1|846788_848807_-	gp58-like family protein	NA	Q938J9	Temperate_phage	58.8	3.9e-126
WP_038433472.1|849924_851883_-|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	82.9	1.3e-97
WP_010922452.1|851879_852575_-	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	29.6	7.6e-05
WP_038433473.1|852571_854929_-	hypothetical protein	NA	M1NRG5	Streptococcus_phage	50.6	1.4e-143
WP_011528785.1|854928_855300_-	DUF5361 domain-containing protein	NA	M1PL84	Streptococcus_phage	59.2	1.2e-33
WP_003047548.1|855314_855578_-	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	54.7	1.7e-18
WP_023079932.1|855588_856164_-	hypothetical protein	NA	A0A1X9I5X2	Streptococcus_phage	64.0	6.8e-60
WP_038433474.1|856179_856515_-	hypothetical protein	NA	A0A1B1IMY2	Lactococcus_phage	66.7	7.5e-35
WP_038433475.1|856515_856752_-	hypothetical protein	NA	M1NRG9	Streptococcus_phage	71.8	2.5e-21
WP_038433476.1|856744_857083_-	hypothetical protein	NA	M1PFF8	Streptococcus_phage	70.3	2.9e-42
WP_038433477.1|857484_857718_-	hypothetical protein	NA	M1PL08	Streptococcus_phage	58.1	1.7e-14
WP_003047529.1|857719_858613_-|capsid	phage major capsid protein	capsid	M1PFL0	Streptococcus_phage	71.3	1.5e-122
WP_038433478.1|858630_859071_-	DUF4355 domain-containing protein	NA	A0A0B5A7G6	Streptococcus_phage	73.1	3.2e-49
WP_038433479.1|859184_860600_-|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.2	8.5e-213
860568:860583	attL	ATTGCCAAGCTTTGTT	NA	NA	NA	NA
WP_002986828.1|860920_861187_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
WP_011054687.1|861179_861332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002994100.1|861408_861633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038433480.1|861638_863132_-	hypothetical protein	NA	M1Q184	Streptococcus_phage	55.6	3.7e-89
WP_038433481.1|863124_864393_-|portal	phage portal protein	portal	A0A1X9I693	Streptococcus_phage	76.2	1.8e-190
WP_038433482.1|864389_864746_-	hypothetical protein	NA	M1PRL3	Streptococcus_phage	57.8	2.4e-07
WP_010922469.1|864894_865239_-	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	68.5	5.5e-41
WP_021733384.1|865347_865767_-	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	80.6	3.0e-57
WP_038433483.1|865868_866528_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	65.2	1.4e-80
WP_038433484.1|866529_866799_-	hypothetical protein	NA	A7J287	Streptococcus_phage	76.1	1.6e-27
WP_011017985.1|866803_866989_-	hypothetical protein	NA	A3F626	Streptococcus_phage	86.5	9.2e-11
WP_002988366.1|866975_867488_-	hypothetical protein	NA	Q708P9	Streptococcus_phage	78.0	2.3e-67
WP_038433485.1|867484_867832_-	hypothetical protein	NA	M1NS23	Streptococcus_phage	38.5	1.2e-11
WP_038433486.1|868009_868807_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	89.4	1.3e-138
WP_038433487.1|868803_869778_-	recombinase RecT	NA	A0A1S5S8V5	Streptococcus_phage	69.4	7.4e-115
WP_011888754.1|869780_870110_-	hypothetical protein	NA	J7KGX3	Streptococcus_phage	87.2	3.8e-47
WP_011017565.1|870165_870372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017992.1|870380_870521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985387.1|870517_870751_-	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	6.1e-36
WP_002985388.1|870731_871118_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	55.0	2.8e-25
WP_011888752.1|871620_871806_-	hypothetical protein	NA	Q938N3	Temperate_phage	91.8	1.8e-22
WP_014411880.1|871807_872119_-	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	78.6	1.4e-43
WP_038433489.1|872250_872544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164993787.1|872540_872699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038433490.1|872730_873492_-	phage antirepressor KilAC domain-containing protein	NA	A0A0C5AEJ9	Bacteriophage	61.1	7.6e-83
WP_023079578.1|873621_873837_-	hypothetical protein	NA	E8ZDN3	Streptococcus_phage	80.3	2.5e-23
WP_023079575.1|874003_874363_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SAF1	Streptococcus_phage	62.0	5.4e-23
WP_038433789.1|874481_875444_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_038433491.1|875642_876785_+|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	5.3e-173
WP_002983920.1|876874_877150_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
WP_002989129.1|877248_877836_-	YpmS family protein	NA	NA	NA	NA	NA
877381:877396	attR	AACAAAGCTTGGCAAT	NA	NA	NA	NA
WP_038433492.1|877813_878656_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002983913.1|878648_879500_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	5.4e-13
>prophage 7
NZ_CP008695	Streptococcus pyogenes strain M23ND chromosome, complete genome	1846477	1201696	1236309	1846477	transposase,integrase,tRNA	unidentified_phage(28.57%)	32	1201720:1201779	1243952:1245025
WP_038433580.1|1201696_1202692_-|transposase	IS30-like element IS1239 family transposase	transposase	H7BW61	unidentified_phage	35.0	2.1e-32
1201720:1201779	attL	TGCCAAATTTCAAGTTGAAGTTAGCCAGTTTTAACATTTCTACTGGCGACTTGTAGTTGA	NA	NA	NA	NA
WP_002982921.1|1203323_1203593_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_011285149.1|1203763_1204792_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.4	1.3e-56
WP_172450305.1|1204781_1205237_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002988171.1|1205208_1205907_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_038433582.1|1206188_1206419_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002982901.1|1206420_1208103_+	ribonuclease J	NA	S0A5H7	Cellulophaga_phage	31.3	1.5e-06
WP_011184944.1|1208330_1209677_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_002982895.1|1209714_1210086_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002982891.1|1210152_1210704_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_002982888.1|1210966_1212163_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_002982883.1|1212355_1213210_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_002982880.1|1213439_1214330_-	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	37.0	1.5e-37
WP_038433583.1|1214566_1216231_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_002982874.1|1216230_1216596_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002982870.1|1216747_1216936_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002982850.1|1217313_1218195_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002988151.1|1218541_1219468_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_038433584.1|1219719_1220697_+|transposase	IS30-like element IS1239 family transposase	transposase	H7BW61	unidentified_phage	35.0	2.7e-32
WP_002988149.1|1220791_1222396_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.4	5.4e-139
WP_002988147.1|1222652_1223228_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_014407835.1|1223444_1224728_-	trigger factor	NA	NA	NA	NA	NA
WP_038433585.1|1225048_1225894_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_002995157.1|1225958_1226519_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_002982824.1|1226532_1227003_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002988136.1|1226992_1227757_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_002988132.1|1227746_1228496_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_011888599.1|1228682_1229264_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_080286798.1|1235065_1235287_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_148305427.1|1235261_1235429_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	45.3	3.6e-06
WP_111718090.1|1235644_1235785_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077707078.1|1236219_1236309_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
1243952:1245025	attR	TCAACTACAAGTCGCCAGTAGAAATGTTAAAACTGGCTAACTTCAACTTGAAATTTGGCAATATTTCGTAGAATTTTCTTTATTTTATACATTTATCTATATGAAAGCGTTATACTCCTCTTTTAATGAGGTTTCAATTAGTTTAATAAAGATTGTCATTCTCTCATGGTAGCGTTTTATTATATCATTACTCTTGTGAGGTAAGTCATTACCTTAGACAAAAATATGGTATAATTAAAAAAATAATACTTGAGTAAGGATAATCTATAAATGATCAAACGATTAATTTCCCTAGTGGTCATCGCCTTATTTTTTGCAGCAAGCACTGTTAGCGGTGAAGAGTATTCGGTAACTGCTAAGCATGCGATTGCCGTTGACCTTGAAAGTGGCAAAGTTTTATACGAAAAAGATGCTAAAGAAGTTGTCCCTGTCGCCTCAGTCAGTAAGCTCTTGACAACCTATCTGGTTTACAAAGAAGTTTCTAAGGGCAAGCTAAATTGGGATAGTCCTGTAACTATTTCTAACTACCCTTATGAACTCACTACAAACTATACTATTAGTAACGTTCCTCTTGATAAGAGAAAATATACCGTTAAAGAACTTTTAAGTGCGTTAGTTGTTAATAACGCCAATAGCCCCGCTATTGCTTTAGCTGAAAAAATAGGCGGAACCGAACCCAAATTTGTTGACAAAATGAAAAAACAATTAAGACAATGGGGCATTTCCGATTCAAAGGTCGTCAATTCAACTGGCTTAACTAACCATTTTTTAGGAGCTAATACTTATCCTAATACAGAACCAGATGATGAAAATTGTTTTTGCGCCACTGATTTAGCTATTATTGCCAGGCATCTCTTATTAGAATTTCCAGAAGTACTGAAATTATCTAGCAAATCCTCCACTATTTTTGCTGGACAAACCATTTACAGTTATAATTACATGCTTAAAGGCATGCCTTGTTATCGAGAAGGCGTGGATGGTCTTTTTGTTGGTTATTCTAAAAAAGCCGGTGCTTCTTTTGTAGCTACTAGTGTCGAAAATCAAATGAGGGTTATTACAGTAGTTTTAAATGCT	NA	NA	NA	NA
>prophage 8
NZ_CP008695	Streptococcus pyogenes strain M23ND chromosome, complete genome	1846477	1439738	1490559	1846477	transposase,bacteriocin,tRNA	unidentified_phage(14.29%)	55	NA	NA
WP_038433659.1|1439738_1441682_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.6	1.5e-119
WP_038433660.1|1442103_1443438_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_038433661.1|1443439_1444438_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_038433662.1|1444568_1445570_-	catabolite control protein A	NA	C6ZCU4	Enterobacteria_phage	28.5	4.7e-24
WP_002985682.1|1445743_1446829_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002985684.1|1446877_1447543_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002985686.1|1447553_1447931_+	VOC family protein	NA	NA	NA	NA	NA
WP_038433663.1|1448075_1449002_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	47.2	4.4e-77
WP_011017476.1|1449212_1449896_+	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_011889091.1|1449895_1450822_+	DUF979 family protein	NA	NA	NA	NA	NA
WP_002994169.1|1450871_1451519_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_010921981.1|1451635_1452355_-	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_011889092.1|1452360_1452828_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	57.0	1.3e-40
WP_011889093.1|1452830_1455164_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.6	5.2e-90
WP_002985700.1|1455257_1455494_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_002990729.1|1455539_1455686_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_011285425.1|1455682_1456876_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011017470.1|1456997_1458500_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	41.6	3.9e-75
WP_038433798.1|1458689_1459283_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_038433664.1|1459279_1460107_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	27.1	5.1e-16
WP_023612156.1|1460278_1461145_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_128650799.1|1461233_1461302_+	peptide pheromone SHP2	NA	NA	NA	NA	NA
WP_011017467.1|1462215_1462485_+	quorum-sensing system protein StcA	NA	NA	NA	NA	NA
WP_038433666.1|1462833_1463232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990760.1|1463324_1464395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038433667.1|1464645_1465047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990766.1|1465225_1465522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038433668.1|1465571_1465766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990771.1|1466059_1466260_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_002990774.1|1466272_1466500_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002987564.1|1467665_1467848_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_002994504.1|1467862_1468108_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_038433669.1|1469065_1469542_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002985743.1|1469561_1470458_-	GTPase Era	NA	NA	NA	NA	NA
WP_002985746.1|1470577_1470985_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002985748.1|1470965_1471463_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002990783.1|1471621_1472197_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_002990786.1|1472242_1473295_-	PhoH family protein	NA	W8D063	Erwinia_phage	50.0	1.2e-46
WP_002990789.1|1473453_1475226_-	oleate hydratase	NA	NA	NA	NA	NA
WP_038433670.1|1475540_1476710_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	40.5	5.5e-16
WP_038433671.1|1476865_1477081_-	YozE family protein	NA	NA	NA	NA	NA
WP_002985759.1|1477077_1477587_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_038433672.1|1477659_1478517_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014635328.1|1478625_1479183_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002985765.1|1479211_1479940_-	UMP kinase	NA	NA	NA	NA	NA
WP_038433673.1|1480261_1480951_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002990800.1|1481056_1481482_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_038433674.1|1481736_1482717_+|transposase	IS30-like element IS1239 family transposase	transposase	H7BW61	unidentified_phage	35.0	2.7e-32
WP_010921962.1|1482811_1483165_+	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_038433675.1|1483234_1485640_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.7	3.8e-88
WP_002990808.1|1485856_1486663_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	36.6	1.5e-20
WP_023605027.1|1486810_1487665_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002985780.1|1487665_1488391_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.6	1.4e-17
WP_011017446.1|1488454_1489387_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038433676.1|1489569_1490559_-|transposase	IS30-like element IS1239 family transposase	transposase	H7BW61	unidentified_phage	35.0	2.7e-32
>prophage 9
NZ_CP008695	Streptococcus pyogenes strain M23ND chromosome, complete genome	1846477	1516543	1522576	1846477		Streptococcus_phage(100.0%)	9	NA	NA
WP_011889118.1|1516543_1517371_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.3	4.5e-129
WP_011284536.1|1517444_1517801_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	6.3e-40
WP_009880724.1|1518098_1518728_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002985833.1|1518774_1519167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017425.1|1519193_1520057_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.3	2.7e-113
WP_002985838.1|1520061_1520385_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_021299187.1|1520789_1521029_-	PSP1 C-terminal domain protein	NA	NA	NA	NA	NA
WP_010921931.1|1521047_1521923_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	43.8	7.7e-63
WP_038433685.1|1521940_1522576_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.9	7.0e-66
