The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009283	Paenibacillus sp. FSL R7-0273, complete genome	7288921	343194	352357	7288921		Caulobacter_phage(25.0%)	11	NA	NA
WP_039869224.1|343194_344223_+	agmatine deiminase family protein	NA	M1I5R4	Acanthocystis_turfacea_Chlorella_virus	38.4	2.3e-66
WP_039869227.1|344249_345125_+	N-carbamoylputrescine amidase	NA	M1GUG4	Paramecium_bursaria_Chlorella_virus	48.8	3.9e-75
WP_039869230.1|345355_346171_+	basic amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039869233.1|346281_346929_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_039878104.1|346945_347668_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	8.3e-23
WP_039869236.1|347823_348270_+	tellurite resistance TerB family protein	NA	A0A1Y0T181	Sinorhizobium_phage	29.3	6.8e-07
WP_039869239.1|348392_348989_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	33.7	5.8e-22
WP_039869242.1|349033_349609_+	TerD family protein	NA	A0A2L1IWC0	Streptomyces_phage	35.9	4.8e-05
WP_039869245.1|349631_350213_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.2	1.3e-26
WP_039869247.1|350336_351584_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_039869249.1|351613_352357_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	52.1	8.2e-58
>prophage 2
NZ_CP009283	Paenibacillus sp. FSL R7-0273, complete genome	7288921	652165	663266	7288921		Mollivirus(25.0%)	9	NA	NA
WP_039869623.1|652165_653461_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.6	3.3e-22
WP_039869626.1|653499_654390_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	32.5	3.5e-39
WP_019913657.1|654452_654698_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	36.7	2.2e-07
WP_039869631.1|654703_655393_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_039869632.1|655370_657617_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.7	3.1e-164
WP_039878185.1|657601_659098_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.3	8.8e-51
WP_039869633.1|659856_660897_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.1	4.4e-65
WP_039869636.1|660896_661511_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.0	7.6e-25
WP_039869639.1|661718_663266_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.3	9.1e-75
>prophage 3
NZ_CP009283	Paenibacillus sp. FSL R7-0273, complete genome	7288921	1444754	1489157	7288921	plate,terminase,integrase,portal,tail	Brevibacillus_phage(42.86%)	49	1438858:1438872	1467121:1467135
1438858:1438872	attL	GGTCAGCTTGTCCGA	NA	NA	NA	NA
WP_039870640.1|1444754_1446881_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	24.7	2.7e-05
WP_039870642.1|1447125_1448352_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	37.3	2.6e-56
WP_039870644.1|1448425_1448893_-	ImmA/IrrE family metallo-endopeptidase	NA	R9TQI1	Paenibacillus_phage	50.0	1.0e-34
WP_039870645.1|1448915_1449290_-	helix-turn-helix transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	32.0	3.3e-07
WP_039870647.1|1449515_1449701_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039870648.1|1449713_1449998_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_156123787.1|1449994_1450156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039870649.1|1450152_1450347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156123788.1|1450681_1450903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039870657.1|1450970_1451867_+	hypothetical protein	NA	A0A1S7FYZ0	Listeria_phage	57.9	2.3e-91
WP_052421195.1|1451883_1452270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039870660.1|1452266_1453463_+	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	54.8	3.1e-115
WP_039870661.1|1453469_1454063_+	DUF2815 family protein	NA	S5MC21	Brevibacillus_phage	43.4	3.1e-31
WP_039870664.1|1454460_1456425_+	XRE family transcriptional regulator	NA	S5M5X4	Brevibacillus_phage	54.1	8.2e-198
WP_039870666.1|1456517_1457276_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_039870670.1|1457984_1460339_+	virulence protein E	NA	S5M5Y2	Brevibacillus_phage	58.2	1.7e-274
WP_039870672.1|1460622_1460904_+	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	50.0	4.5e-17
WP_039870674.1|1460900_1462286_+	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	63.5	7.4e-169
WP_039870676.1|1462282_1462744_+	sigma-70 family RNA polymerase sigma factor	NA	R9TMH4	Paenibacillus_phage	33.3	3.2e-12
WP_039870678.1|1462843_1463482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039870679.1|1463573_1464068_+	hypothetical protein	NA	A0A090DCM3	Clostridium_phage	59.6	6.1e-49
WP_039870681.1|1464060_1465467_+|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	67.8	3.5e-182
WP_047171046.1|1465486_1466938_+|portal	phage portal protein	portal	A0A0K2CNK4	Brevibacillus_phage	53.5	7.5e-140
WP_052421197.1|1466950_1468756_+	hypothetical protein	NA	X5JAI9	Clostridium_phage	47.2	9.5e-84
1467121:1467135	attR	GGTCAGCTTGTCCGA	NA	NA	NA	NA
WP_039870684.1|1469016_1469643_+	hypothetical protein	NA	S5MUG0	Brevibacillus_phage	55.3	1.0e-45
WP_047171047.1|1469663_1469996_+	hypothetical protein	NA	S5M669	Brevibacillus_phage	68.2	5.3e-33
WP_039870685.1|1470018_1471038_+	hypothetical protein	NA	S5MA55	Brevibacillus_phage	70.2	5.3e-132
WP_039870686.1|1471075_1471357_+	hypothetical protein	NA	S5MC61	Brevibacillus_phage	40.0	3.8e-08
WP_039870687.1|1471340_1471709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039870688.1|1471710_1472085_+	hypothetical protein	NA	S5M673	Brevibacillus_phage	42.9	2.3e-16
WP_039870691.1|1472081_1472489_+	HK97 gp10 family phage protein	NA	A0A0A7RVN8	Clostridium_phage	42.9	5.7e-21
WP_052421198.1|1472491_1472911_+	hypothetical protein	NA	A0A0A7RTI2	Clostridium_phage	39.0	7.0e-22
WP_039870694.1|1472907_1473126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039870696.1|1473129_1474446_+	phage-like element PBSX protein XkdK	NA	A0A0K2CNL4	Brevibacillus_phage	52.2	2.3e-119
WP_039870698.1|1474447_1474912_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	64.9	6.5e-53
WP_039870700.1|1474938_1475361_+|portal	phage portal protein	portal	Q708L8	Streptococcus_phage	46.2	7.3e-19
WP_039870702.1|1475593_1475986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052421199.1|1476042_1478814_+	DUF4200 domain-containing protein	NA	A0A0K2CP22	Brevibacillus_phage	35.4	1.7e-76
WP_039870704.1|1478813_1479512_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2CNM3	Brevibacillus_phage	49.3	3.5e-50
WP_039870706.1|1479516_1480482_+	hypothetical protein	NA	S6B1K2	Thermus_phage	45.4	8.1e-74
WP_039870709.1|1480484_1480820_+	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	44.0	3.4e-19
WP_039870711.1|1480816_1481230_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	41.8	3.8e-20
WP_039870712.1|1481222_1482287_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	49.0	4.6e-86
WP_039870713.1|1482283_1482832_+	YmfQ family protein	NA	NA	NA	NA	NA
WP_052421200.1|1482851_1486658_+	hypothetical protein	NA	S6B1J7	Thermus_phage	35.3	3.1e-23
WP_052421201.1|1486696_1487248_+	hypothetical protein	NA	S6C455	Thermus_phage	52.3	3.6e-18
WP_039870715.1|1487440_1487740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156123789.1|1487926_1488328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039870720.1|1488299_1489157_+	hypothetical protein	NA	A0A127AWA8	Bacillus_phage	61.4	2.7e-44
>prophage 4
NZ_CP009283	Paenibacillus sp. FSL R7-0273, complete genome	7288921	2408501	2418774	7288921		Bacillus_phage(66.67%)	9	NA	NA
WP_039871787.1|2408501_2410295_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	32.3	1.7e-37
WP_039871788.1|2410486_2411215_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	1.0e-36
WP_076418481.1|2411396_2412176_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.5	5.7e-17
WP_039871791.1|2412244_2412904_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_039871793.1|2413120_2415781_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	29.7	4.1e-59
WP_047171091.1|2415832_2416705_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	29.9	7.2e-21
WP_039871794.1|2416858_2417608_+	membrane protein	NA	NA	NA	NA	NA
WP_039871795.1|2417617_2418214_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_039871798.1|2418210_2418774_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	39.6	3.1e-17
>prophage 5
NZ_CP009283	Paenibacillus sp. FSL R7-0273, complete genome	7288921	4822804	4830809	7288921		Staphylococcus_phage(57.14%)	9	NA	NA
WP_047171176.1|4822804_4824010_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	34.7	7.4e-08
WP_039875042.1|4824167_4824659_-	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_039875045.1|4824775_4825462_-	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_039875047.1|4825660_4826260_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.1	1.7e-16
WP_039875049.1|4826228_4827020_-	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.5	5.4e-07
WP_039879072.1|4827180_4827648_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.0	6.1e-43
WP_047171177.1|4827696_4828950_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.4	5.9e-117
WP_039875051.1|4828970_4829636_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.0	1.2e-36
WP_039875053.1|4829708_4830809_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.4	4.3e-55
>prophage 6
NZ_CP009283	Paenibacillus sp. FSL R7-0273, complete genome	7288921	6542840	6574313	7288921	plate,integrase,holin,portal,transposase,tail	Clostridium_phage(29.41%)	33	6527791:6527811	6546064:6546084
6527791:6527811	attL	TGAAAAATAAAGTATTAGACT	NA	NA	NA	NA
WP_039877340.1|6542840_6545042_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_039877341.1|6545045_6545870_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_039877342.1|6546134_6547967_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	40.0	4.3e-108
6546064:6546084	attR	AGTCTAATACTTTATTTTTCA	NA	NA	NA	NA
WP_156123855.1|6548283_6548421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039877344.1|6548577_6549918_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_039877345.1|6550085_6551534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039877346.1|6551526_6552357_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_039877347.1|6552566_6553181_-	anti-sigma W factor	NA	NA	NA	NA	NA
WP_039877348.1|6553301_6553868_-	RNA polymerase sigma factor SigW	NA	NA	NA	NA	NA
WP_039877349.1|6554800_6557593_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_039879387.1|6557946_6558210_-|holin	holin	holin	NA	NA	NA	NA
WP_039877350.1|6558283_6558976_-	hypothetical protein	NA	A0A127AWA8	Bacillus_phage	58.0	2.8e-44
WP_144027129.1|6558947_6559178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039877352.1|6559326_6559524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039877353.1|6559525_6559825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039877354.1|6559879_6561688_-	hypothetical protein	NA	E3SP37	Cyanophage	65.8	1.8e-05
WP_039877355.1|6561699_6562311_-	YmfQ family protein	NA	S6BFJ0	Thermus_phage	54.5	1.6e-51
WP_039877356.1|6562661_6563684_-	DUF2793 domain-containing protein	NA	A0A0S0MV96	Pseudomonas_phage	35.8	5.5e-12
WP_039877357.1|6563685_6564099_-	hypothetical protein	NA	A0A0A7S1G0	Clostridium_phage	51.2	8.1e-31
WP_039877358.1|6564102_6565161_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	51.4	4.3e-92
WP_039877359.1|6565153_6565585_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	39.0	3.9e-20
WP_039877360.1|6565581_6565875_-	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	45.2	2.1e-17
WP_039877361.1|6565881_6566844_-	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	48.1	1.9e-86
WP_039877362.1|6566855_6567623_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2CNM3	Brevibacillus_phage	40.4	2.7e-43
WP_039877363.1|6567624_6569484_-	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	35.1	3.6e-54
WP_076418473.1|6569497_6569677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039877364.1|6569676_6570099_-|portal	phage portal protein	portal	A0A0A8WJT4	Clostridium_phage	44.5	2.6e-24
WP_039877365.1|6570208_6570679_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	60.9	4.4e-49
WP_039877366.1|6570680_6572003_-	phage-like element PBSX protein XkdK	NA	A0A0A7RTT5	Clostridium_phage	47.8	1.1e-108
WP_156123856.1|6572002_6572179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039877367.1|6572175_6572601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047171257.1|6573041_6573554_-	transcriptional regulator	NA	A0A0C5AN03	Paenibacillus_phage	61.9	1.1e-40
WP_039877368.1|6573848_6574313_+	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	40.0	2.1e-19
