The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009454	Pantoea rwandensis strain ND04 chromosome, complete genome	4327607	1072499	1117198	4327607	tail,integrase,lysis,tRNA,portal,head,plate,transposase,capsid,terminase	Erwinia_phage(63.64%)	57	1075209:1075261	1106990:1107042
WP_038649854.1|1072499_1073204_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	42.5	5.3e-14
WP_038644564.1|1073260_1073965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052059348.1|1074278_1074833_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
1075209:1075261	attL	ACTAAATTTGGTGGCCCCTGCTGGGTTTGAACCAGCGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_038644567.1|1075332_1076370_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	86.9	3.6e-176
WP_038644569.1|1076369_1076960_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	52.6	5.7e-54
WP_038644571.1|1077088_1077352_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	88.4	3.3e-38
WP_038644572.1|1077383_1077893_+	phage regulatory CII family protein	NA	F1BUS6	Erwinia_phage	71.6	2.7e-60
WP_071845585.1|1077903_1078080_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_038644573.1|1078043_1078382_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	57.5	5.8e-27
WP_038644575.1|1078451_1078682_+	DUF2732 domain-containing protein	NA	F1BUS3	Erwinia_phage	57.5	5.0e-14
WP_038644577.1|1078681_1078909_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	61.3	6.0e-20
WP_038644580.1|1078905_1079769_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	55.6	1.0e-80
WP_038644582.1|1079765_1080518_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	80.0	4.1e-121
WP_052059479.1|1080529_1082779_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	80.0	0.0e+00
WP_071845586.1|1082980_1083172_+	hypothetical protein	NA	F1BUR9	Erwinia_phage	85.7	2.1e-21
WP_038644586.1|1083189_1083423_+	DinI family protein	NA	E5G6M1	Salmonella_phage	45.5	7.8e-15
WP_038644590.1|1083891_1084752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038644593.1|1084790_1085048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052059351.1|1085040_1085505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038644596.1|1085925_1086972_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	84.8	9.2e-172
WP_038644598.1|1086971_1088735_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	91.0	0.0e+00
WP_038644600.1|1088880_1089735_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	71.5	1.9e-106
WP_038644602.1|1089782_1090919_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	83.3	3.4e-164
WP_038644604.1|1090922_1091591_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	71.6	1.9e-85
WP_038644606.1|1091681_1092149_+|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	78.1	8.5e-61
WP_038644608.1|1092148_1092352_+|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	70.1	1.7e-21
WP_038644610.1|1092355_1092568_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	54.4	8.7e-13
WP_038644612.1|1092548_1093064_+	lysozyme	NA	E5G6N1	Salmonella_phage	80.4	2.3e-75
WP_038644614.1|1093060_1093450_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	37.2	9.4e-13
WP_038644616.1|1093446_1093869_+|lysis	phage lysis regulatory protein, LysB family	lysis	F1BUQ1	Erwinia_phage	68.8	1.3e-44
WP_038644618.1|1093970_1094438_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	70.3	1.4e-55
WP_038644620.1|1094434_1094881_+	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	70.3	2.2e-50
WP_038644622.1|1094910_1095714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038644624.1|1095790_1096375_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	78.9	8.1e-85
WP_038644626.1|1096371_1096722_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	72.4	7.1e-44
WP_038644627.1|1096726_1097635_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	75.8	3.2e-120
WP_038644628.1|1097627_1098236_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	77.2	1.3e-88
WP_081946711.1|1098232_1099192_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	76.2	1.6e-74
WP_038644629.1|1099200_1099611_+|tail	tail assembly chaperone	tail	A0A2P1JUG3	Erwinia_phage	45.8	7.1e-19
WP_038644633.1|1099730_1100900_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	87.4	1.7e-195
WP_038644634.1|1100912_1101422_+|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	81.8	1.4e-77
WP_038644636.1|1101486_1101765_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	77.8	3.8e-32
WP_071845588.1|1101797_1101923_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	71.4	4.9e-08
WP_038644638.1|1101912_1104375_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	51.3	3.8e-184
WP_038644639.1|1104378_1104906_+|tail	phage tail protein	tail	F1BUT6	Erwinia_phage	76.2	4.6e-63
WP_038644641.1|1104902_1106090_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	67.7	3.1e-147
WP_071845589.1|1106158_1106386_+	transcriptional regulator	NA	F1BUT0	Erwinia_phage	77.3	6.0e-28
WP_038644643.1|1106434_1106842_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	46.7	9.4e-32
WP_038644645.1|1107276_1108059_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
1106990:1107042	attR	ACTAAATTTGGTGGCCCCTGCTGGGTTTGAACCAGCGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_038644647.1|1108195_1108783_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038644649.1|1108779_1109295_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_038644651.1|1109383_1110142_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038644653.1|1110181_1111498_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_034828348.1|1111621_1113466_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_038644656.1|1113826_1115572_-	DNA primase	NA	A0A1S5RG58	Helicobacter_phage	31.3	3.2e-44
WP_001144069.1|1115690_1115906_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_038644658.1|1116184_1117198_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	5.3e-108
>prophage 2
NZ_CP009454	Pantoea rwandensis strain ND04 chromosome, complete genome	4327607	1512354	1520386	4327607	integrase	uncultured_Mediterranean_phage(33.33%)	6	1516221:1516232	1520461:1520472
WP_038649911.1|1512354_1513116_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.5	1.3e-66
WP_038645170.1|1513109_1513736_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.7	6.3e-35
WP_038645172.1|1513902_1515042_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	36.4	1.7e-06
WP_034822992.1|1515093_1516086_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.6e-32
WP_071845596.1|1516198_1518775_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.2	1.8e-27
1516221:1516232	attL	TAAATCCACTCC	NA	NA	NA	NA
WP_038649913.1|1518916_1520386_+|integrase	integrase	integrase	A0A0R6PGY7	Moraxella_phage	26.3	2.0e-23
WP_038649913.1|1518916_1520386_+|integrase	integrase	integrase	A0A0R6PGY7	Moraxella_phage	26.3	2.0e-23
1520461:1520472	attR	GGAGTGGATTTA	NA	NA	NA	NA
>prophage 3
NZ_CP009454	Pantoea rwandensis strain ND04 chromosome, complete genome	4327607	2066786	2074781	4327607		Enterobacteria_phage(28.57%)	7	NA	NA
WP_038645967.1|2066786_2067680_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	39.7	2.7e-47
WP_038645969.1|2067724_2068738_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	43.1	6.5e-74
WP_038645971.1|2070015_2071164_-	acyltransferase	NA	C6ZR20	Salmonella_phage	24.6	7.1e-08
WP_038645973.1|2071212_2072076_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.5	2.6e-111
WP_038645975.1|2072075_2073158_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.2	2.1e-94
WP_038645979.1|2073696_2074023_+	hypothetical protein	NA	A0A222YXE6	Synechococcus_phage	37.4	1.6e-13
WP_038645981.1|2074025_2074781_+	NTP transferase domain-containing protein	NA	A0A1D8KNV9	Synechococcus_phage	47.3	1.9e-54
>prophage 4
NZ_CP009454	Pantoea rwandensis strain ND04 chromosome, complete genome	4327607	2975922	2986117	4327607	tRNA	Tupanvirus(33.33%)	12	NA	NA
WP_038647327.1|2975922_2976669_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	5.1e-07
WP_038647329.1|2976669_2977215_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_038647331.1|2977254_2978238_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_038647333.1|2978328_2978700_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_007892687.1|2978891_2979194_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	5.6e-13
WP_038647335.1|2979198_2981586_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.9	1.6e-09
WP_038647337.1|2981600_2982584_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.3	7.6e-35
WP_121626058.1|2982731_2982776_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_007892678.1|2982896_2983253_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_006118955.1|2983335_2983533_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_034821726.1|2983632_2984184_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	9.8e-16
WP_038647340.1|2984188_2986117_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	2.0e-127
>prophage 5
NZ_CP009454	Pantoea rwandensis strain ND04 chromosome, complete genome	4327607	3623268	3637694	4327607	integrase,tRNA	uncultured_Caudovirales_phage(38.46%)	22	3622864:3622877	3638802:3638815
3622864:3622877	attL	GTTGCAGCCAGCGC	NA	NA	NA	NA
WP_038648407.1|3623268_3624090_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.4	3.4e-44
WP_038650223.1|3624232_3624586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052059435.1|3624639_3625131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038648410.1|3625133_3625688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038648413.1|3626215_3626569_-	bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	90.6	7.3e-57
WP_038648416.1|3626568_3627321_-	translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	81.6	3.8e-119
WP_156102806.1|3627375_3627753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038648422.1|3627760_3628000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052059440.1|3627996_3628557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038648425.1|3628687_3629029_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	51.3	8.2e-29
WP_081946756.1|3629028_3629565_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	73.3	5.2e-70
WP_167540460.1|3629987_3630488_-	glycoside hydrolase family protein	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	84.9	2.3e-80
WP_038648433.1|3630759_3631209_-	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	64.4	8.2e-53
WP_038648436.1|3631353_3631593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038648439.1|3631589_3631883_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	55.7	4.9e-22
WP_038650238.1|3631964_3632363_-	Rha family transcriptional regulator	NA	A0A2I7RX10	Vibrio_phage	50.4	8.1e-20
WP_038648442.1|3632374_3632671_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	60.2	7.6e-23
WP_038648445.1|3632879_3634043_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	73.2	5.2e-168
WP_038650240.1|3634303_3634807_-	DUF1198 family protein	NA	NA	NA	NA	NA
WP_034828233.1|3634983_3635850_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.2	2.0e-31
WP_038648448.1|3635849_3636062_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_038648451.1|3636308_3637694_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	5.1e-45
3638802:3638815	attR	GCGCTGGCTGCAAC	NA	NA	NA	NA
>prophage 6
NZ_CP009454	Pantoea rwandensis strain ND04 chromosome, complete genome	4327607	3731270	3738974	4327607	tRNA	uncultured_Mediterranean_phage(50.0%)	9	NA	NA
WP_038648599.1|3731270_3731741_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.1	5.1e-29
WP_038648601.1|3731834_3732938_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.9	1.4e-48
WP_034831027.1|3732941_3733391_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_038648604.1|3733563_3734001_+	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	50.0	1.6e-05
WP_038648605.1|3734016_3734580_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_038648607.1|3734639_3735608_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.1	7.2e-46
WP_071845629.1|3735618_3737466_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_034831018.1|3737491_3737824_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	36.3	2.6e-11
WP_038648613.1|3737849_3738974_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	3.2e-90
>prophage 7
NZ_CP009454	Pantoea rwandensis strain ND04 chromosome, complete genome	4327607	3807867	3816608	4327607		Streptococcus_phage(28.57%)	9	NA	NA
WP_038648738.1|3807867_3809613_-	amylovoran biosynthesis protein AmsF	NA	A0A1S6L3G8	Erwinia_phage	45.4	2.2e-146
WP_038648740.1|3809814_3810108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038648743.1|3810104_3810455_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	50.9	1.2e-22
WP_038648745.1|3810451_3810919_-	hypothetical protein	NA	H9C148	Vibrio_phage	46.0	5.6e-28
WP_071845630.1|3811100_3811379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038648747.1|3811792_3812524_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	36.2	5.1e-44
WP_038648750.1|3812876_3814130_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.0	3.0e-92
WP_038648752.1|3814140_3815244_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.3	1.3e-59
WP_038648755.1|3815489_3816608_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.4	3.5e-113
