The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	0	5180	2500626		Acinetobacter_phage(100.0%)	4	NA	NA
WP_001831297.1|465_1554_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_038398323.1|2212_3619_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001831157.1|3615_4182_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	34.7	1.3e-23
WP_001830976.1|4184_5180_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	31.1	3.7e-29
>prophage 2
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	15198	22683	2500626		Anomala_cuprea_entomopoxvirus(25.0%)	8	NA	NA
WP_002439671.1|15198_15897_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.4	2.4e-14
WP_002439673.1|15899_16676_-	ABC transporter ATP-binding protein	NA	A0A2H4UUX5	Bodo_saltans_virus	23.9	4.0e-07
WP_002439674.1|16638_17493_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_038398343.1|17482_18484_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002439678.1|18662_19001_-	membrane protein	NA	NA	NA	NA	NA
WP_038398345.1|19248_21060_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	46.0	1.1e-148
WP_001830968.1|21153_21801_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_038398346.1|21807_22683_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.1	2.4e-16
>prophage 3
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	27507	29115	2500626		Klosneuvirus(100.0%)	1	NA	NA
WP_001830940.1|27507_29115_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.5	9.5e-51
>prophage 4
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	38282	45580	2500626	lysis	Yellowstone_lake_phycodnavirus(25.0%)	9	NA	NA
WP_002439697.1|38282_39548_+	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	24.0	1.3e-10
WP_002439699.1|39679_40429_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_038398353.1|40437_41301_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.7	1.5e-26
WP_001830954.1|41287_41698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001831260.1|42643_42844_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	2.5e-17
WP_002439708.1|43024_43333_-	DUF1033 family protein	NA	NA	NA	NA	NA
WP_001831190.1|43491_43761_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002476740.1|43800_44427_+|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001831251.1|44449_45580_+	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	25.8	9.4e-29
>prophage 5
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	49087	49879	2500626		Halovirus(100.0%)	1	NA	NA
WP_001831311.1|49087_49879_-	MoxR family ATPase	NA	R4TG24	Halovirus	28.9	4.0e-10
>prophage 6
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	55372	60356	2500626	integrase	Streptococcus_phage(50.0%)	8	53220:53258	60607:60645
53220:53258	attL	AAAAACAACGACGATTTACGTCGTTGTTTTTATGTATGT	NA	NA	NA	NA
WP_038398362.1|55372_56224_-	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	59.9	4.8e-94
WP_038398364.1|56429_57161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080290039.1|57737_58184_-|integrase	tyrosine-type recombinase/integrase	integrase	J7KBT5	Streptococcus_phage	33.3	3.2e-09
WP_144242847.1|58328_58658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038398365.1|59084_59270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038398366.1|59273_59660_+	hypothetical protein	NA	A7TWE6	Staphylococcus_phage	33.1	6.0e-12
WP_158484353.1|59702_59849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080290040.1|59954_60356_+|integrase	tyrosine-type recombinase/integrase	integrase	B7T0F2	Staphylococcus_virus	36.5	7.9e-15
60607:60645	attR	ACATACATAAAAACAACGACGTAAATCGTCGTTGTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	66531	67191	2500626		Bacillus_phage(100.0%)	1	NA	NA
WP_001830971.1|66531_67191_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.0	8.7e-35
>prophage 8
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	74268	88380	2500626		Staphylococcus_phage(42.86%)	18	NA	NA
WP_002456515.1|74268_75360_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.6	2.6e-20
WP_001831017.1|75710_76325_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_001831309.1|76337_77411_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_038398375.1|77428_77932_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001831212.1|78267_79743_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.3	2.4e-24
WP_001831241.1|80087_80312_-	YozE family protein	NA	NA	NA	NA	NA
WP_001831133.1|80311_80812_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002439748.1|80824_81253_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002467693.1|81245_81773_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_038398379.1|81875_82724_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	99.2	7.9e-65
WP_001830952.1|82733_83219_-	trimethoprim-resistant dihydrofolate reductase DfrC	NA	A0A0N9S8H6	Staphylococcus_phage	98.1	9.1e-90
WP_000282655.1|83260_84217_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	100.0	1.1e-190
WP_002439753.1|84530_85193_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	1.6e-28
WP_038398383.1|85208_86258_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002457670.1|86469_86907_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_001831110.1|86958_87219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001831026.1|87230_87425_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_001831106.1|87675_88380_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	26.0	8.4e-12
>prophage 9
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	127712	129593	2500626		Bacillus_phage(100.0%)	3	NA	NA
WP_002456190.1|127712_128279_-	DUF1273 domain-containing protein	NA	U5J9F7	Bacillus_phage	22.5	1.6e-05
WP_002467704.1|128290_128623_-	YppE family protein	NA	NA	NA	NA	NA
WP_002495428.1|128966_129593_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	34.3	5.0e-24
>prophage 10
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	132999	140085	2500626	tRNA	Temperate_phage(25.0%)	5	NA	NA
WP_001831014.1|132999_133686_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	36.5	1.5e-08
WP_002439780.1|133778_135071_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	3.5e-56
WP_001831318.1|135191_137900_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	31.5	1.1e-43
WP_001831050.1|137924_138896_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_001831104.1|138882_140085_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	40.3	2.1e-34
>prophage 11
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	148956	152545	2500626		Anguillid_herpesvirus(33.33%)	5	NA	NA
WP_001831235.1|148956_149406_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.8	1.3e-29
WP_161375000.1|149545_150490_-	heptaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.5	3.0e-12
WP_001831089.1|150506_151232_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_002468414.1|151224_151803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043863.1|152272_152545_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
>prophage 12
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	161510	174029	2500626		Bacillus_phage(42.86%)	14	NA	NA
WP_001831100.1|161510_162890_-	ATP-dependent DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	33.5	1.3e-56
WP_002456188.1|162876_163839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001831262.1|163947_164196_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	52.0	6.8e-17
WP_001830988.1|164600_165140_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_001831150.1|165731_167498_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	33.7	1.2e-33
WP_038398402.1|167481_168207_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.6	2.9e-47
WP_001830978.1|168340_169078_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_001830975.1|169070_169613_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.5	2.3e-09
WP_001831064.1|169605_170337_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_038398404.1|170434_170959_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_001831286.1|171011_171899_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.8	1.3e-38
WP_001831103.1|171941_172391_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_001831173.1|172495_173038_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_038398406.1|173120_174029_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	33.9	2.6e-05
>prophage 13
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	177379	178864	2500626		Cyanophage(100.0%)	1	NA	NA
WP_001831167.1|177379_178864_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.4	6.9e-80
>prophage 14
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	182033	183440	2500626		Synechococcus_phage(100.0%)	1	NA	NA
WP_002440000.1|182033_183440_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	29.8	2.2e-27
>prophage 15
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	189974	200601	2500626		Klosneuvirus(50.0%)	11	NA	NA
WP_002440012.1|189974_191396_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.4	6.0e-41
WP_002468404.1|191655_193332_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002456185.1|193347_193800_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002456496.1|194114_194996_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	27.6	1.5e-10
WP_001830935.1|194973_195204_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_002468438.1|195196_196534_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	36.0	2.7e-43
WP_001831090.1|196548_196938_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002440021.1|197013_197376_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002440022.1|197387_198746_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_001831211.1|198745_199213_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002440024.1|199470_200601_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.3	7.4e-26
>prophage 16
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	208602	211450	2500626		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_002468434.1|208602_210111_-	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	42.0	4.8e-81
WP_002456181.1|210103_211450_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	37.8	5.3e-63
>prophage 17
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	216982	217606	2500626		Streptococcus_phage(100.0%)	1	NA	NA
WP_001831016.1|216982_217606_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	39.3	7.7e-33
>prophage 18
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	224041	238100	2500626	tRNA	Bacillus_thuringiensis_phage(14.29%)	13	NA	NA
WP_001831217.1|224041_224641_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	55.2	2.4e-60
WP_001831164.1|225053_225473_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_001831102.1|225475_226324_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001832763.1|226357_227140_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	7.7e-22
WP_002456488.1|227357_228248_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.2	2.3e-22
WP_038398414.1|228257_229604_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	33.7	2.9e-53
WP_038398415.1|229638_230739_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_038398417.1|230728_231418_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002440071.1|231572_232679_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	37.6	1.1e-37
WP_001831005.1|232949_234746_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.8	3.9e-53
WP_001831146.1|234919_235738_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_010959185.1|235749_236373_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002440079.1|236708_238100_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	29.0	2.5e-47
>prophage 19
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	241145	242093	2500626		Erwinia_phage(100.0%)	1	NA	NA
WP_001831049.1|241145_242093_-	PhoH family protein	NA	W8D063	Erwinia_phage	49.0	8.9e-49
>prophage 20
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	248987	252083	2500626		Catovirus(50.0%)	2	NA	NA
WP_038398428.1|248987_250109_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.5	3.8e-30
WP_001831007.1|250253_252083_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.7	3.6e-139
>prophage 21
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	255119	261305	2500626		Streptococcus_phage(33.33%)	5	NA	NA
WP_001831284.1|255119_256943_-	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	23.5	2.6e-20
WP_001831221.1|257235_257487_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001831125.1|257604_258579_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_002470090.1|258623_260840_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	30.4	9.1e-28
WP_002440103.1|260843_261305_-	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.2	2.3e-34
>prophage 22
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	275024	312014	2500626	transposase,tRNA	uncultured_Mediterranean_phage(23.53%)	30	NA	NA
WP_002458050.1|275024_275507_-|transposase	IS200/IS605-like element ISSep3 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
WP_001830881.1|275803_276280_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002446596.1|276310_276934_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.5	8.2e-35
WP_001830748.1|276933_278202_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.9	5.2e-36
WP_002456168.1|278219_279143_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_001830827.1|279145_279781_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	29.3	7.4e-07
WP_038398436.1|280209_280518_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_001830837.1|280532_280961_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001830883.1|280962_281223_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_038398438.1|281286_283917_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	2.3e-62
WP_038398439.1|284245_286678_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	26.6	8.7e-48
WP_001832695.1|286679_287348_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002494288.1|287510_288629_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_002468512.1|288628_289771_-	cysteine desulfurase	NA	A0A141ZJV0	Faustovirus	28.0	2.0e-26
WP_001830781.1|290013_291009_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001830806.1|291537_291960_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_038398441.1|292045_293317_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	51.2	1.1e-105
WP_038398442.1|293510_294287_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_002485701.1|294900_296667_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	22.4	3.4e-17
WP_038398444.1|296669_297944_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002468514.1|298315_299191_-	SH3 domain-containing protein	NA	A0A0N9SGH1	Paenibacillus_phage	32.4	6.2e-12
WP_001830766.1|299187_299640_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001832683.1|299653_301843_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	38.0	4.1e-12
WP_001832698.1|302361_302880_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	2.1e-28
WP_002440152.1|302898_305172_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.6	3.9e-66
WP_001830863.1|305916_308208_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	36.6	7.0e-31
WP_001830800.1|308546_308807_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	44.3	5.7e-06
WP_038398447.1|308822_309962_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.7e-83
WP_001830755.1|309982_311008_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001830787.1|311009_312014_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 23
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	321329	323960	2500626	tRNA	Catovirus(100.0%)	1	NA	NA
WP_001830862.1|321329_323960_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.9	7.5e-154
>prophage 24
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	333518	345010	2500626	protease,tRNA	Bacillus_virus(20.0%)	10	NA	NA
WP_001830765.1|333518_334781_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.7	7.7e-141
WP_001830810.1|335067_336369_-	trigger factor	NA	NA	NA	NA	NA
WP_001830807.1|336529_337453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001830874.1|337469_338081_-	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	34.4	8.1e-19
WP_001830839.1|338498_338855_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001830767.1|338906_339107_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001830789.1|339134_339662_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.8	1.4e-11
WP_001830900.1|339869_341372_-	amino acid permease	NA	NA	NA	NA	NA
WP_002485650.1|341800_343738_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.7	1.7e-115
WP_038398451.1|344089_345010_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	30.9	7.6e-29
>prophage 25
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	349869	357688	2500626		Bacillus_virus(20.0%)	5	NA	NA
WP_002502345.1|349869_350742_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.3	9.4e-45
WP_038398455.1|350757_353388_-	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.4	1.0e-46
WP_002502343.1|353696_355394_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	37.1	9.4e-33
WP_001830897.1|355393_356104_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.4e-06
WP_001830826.1|356419_357688_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	55.6	9.2e-09
>prophage 26
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	361000	362758	2500626		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001830831.1|361000_362758_-	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	84.4	2.7e-35
>prophage 27
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	367360	370558	2500626		Streptomyces_phage(100.0%)	1	NA	NA
WP_038398461.1|367360_370558_-	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	29.9	1.8e-130
>prophage 28
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	377801	377957	2500626		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001830033.1|377801_377957_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	77.6	2.6e-14
>prophage 29
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	388195	392335	2500626		Only_Syngen_Nebraska_virus(50.0%)	4	NA	NA
WP_002503621.1|388195_388942_-	glycerophosphodiester phosphodiesterase	NA	A0A1J0F961	Only_Syngen_Nebraska_virus	31.6	2.6e-19
WP_001830816.1|389019_389460_+	SACOL1771 family peroxiredoxin	NA	NA	NA	NA	NA
WP_038398467.1|389586_390750_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_038398468.1|390739_392335_+	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	63.6	1.1e-72
>prophage 30
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	396219	398914	2500626	protease,tRNA	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001830793.1|396219_397458_+|protease	serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	27.9	1.8e-09
WP_001830858.1|397648_398914_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.9	9.6e-83
>prophage 31
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	408371	413375	2500626		Mycobacterium_phage(50.0%)	3	NA	NA
WP_038398473.1|408371_411881_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	46.4	1.0e-81
WP_001830779.1|411901_412498_-	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_001832670.1|412520_413375_-	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	85.4	2.8e-62
>prophage 32
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	422952	472156	2500626	transposase,tRNA	Staphylococcus_phage(87.88%)	39	NA	NA
WP_038398485.1|422952_424215_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	76.0	1.8e-41
WP_038398487.1|424586_435665_-	YSIRK signal domain/LPXTG anchor domain surface protein	NA	A0A2H4PQU6	Staphylococcus_phage	25.7	9.2e-28
WP_001830891.1|436069_436381_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	71.8	4.1e-35
WP_038398488.1|436406_438821_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	87.4	0.0e+00
WP_001830884.1|439112_440327_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	83.7	4.6e-183
WP_001830802.1|440433_441387_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	84.7	3.3e-67
WP_001830894.1|441383_441947_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	66.5	1.9e-67
WP_144242848.1|442118_443297_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.7	6.7e-62
WP_001830809.1|443742_444144_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001830886.1|444633_445461_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002456447.1|445704_446706_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	70.0	1.5e-131
WP_107519593.1|446978_448157_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.7	3.9e-62
WP_002456446.1|448522_448984_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	84.2	1.2e-59
WP_002456445.1|448996_450178_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	76.1	2.5e-178
WP_038398493.1|450190_450823_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	77.1	3.2e-87
WP_002469499.1|450829_451873_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	66.8	8.9e-135
WP_002484471.1|452309_453794_-	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	65.6	2.5e-13
WP_001830727.1|454141_454993_-	autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	35.6	1.0e-32
WP_001830737.1|455370_455586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001830724.1|455793_456273_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	42.3	2.7e-25
WP_001830734.1|456278_456722_+	competence protein ComK	NA	NA	NA	NA	NA
WP_001830728.1|456708_457152_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	42.9	3.1e-20
WP_001830731.1|457290_458004_-	transaldolase	NA	M1PR54	Cyanophage	37.4	4.1e-22
WP_002446728.1|458280_458589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001830726.1|458627_458993_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	57.0	4.1e-34
WP_001830729.1|458989_459343_+	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	32.5	8.5e-05
WP_107519593.1|459819_460998_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.7	3.9e-62
WP_002469577.1|461227_461383_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	79.6	5.2e-15
WP_002456435.1|461667_462504_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	68.6	6.1e-110
WP_002456434.1|462683_463592_-	hypothetical protein	NA	A0A2H4PQQ8	Staphylococcus_phage	80.6	1.8e-102
WP_001829830.1|463694_464894_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	85.4	4.1e-192
WP_002468492.1|465263_466856_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	83.2	4.7e-268
WP_002489377.1|467086_467872_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	71.3	2.7e-99
WP_002468491.1|467858_468326_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	58.1	2.5e-44
WP_002457867.1|468396_468645_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	83.1	6.5e-36
WP_038398495.1|468641_469643_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	50.2	9.0e-92
WP_038398497.1|469632_471057_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	64.1	1.5e-172
WP_001829835.1|471714_471966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001829852.1|471934_472156_+	hypothetical protein	NA	A0A1W6JQ94	Staphylococcus_phage	70.3	3.2e-18
>prophage 33
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	482047	482788	2500626		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001829855.1|482047_482788_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.0e-25
>prophage 34
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	491455	494543	2500626		Streptococcus_phage(50.0%)	4	NA	NA
WP_001829805.1|491455_491800_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	30.6	5.8e-06
WP_002485606.1|491872_493003_-	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_001829807.1|493184_493649_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001829810.1|493919_494543_-	response regulator transcription factor	NA	A0A1V0SGR9	Hokovirus	28.2	5.2e-05
>prophage 35
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	501910	507106	2500626	protease	Staphylococcus_phage(66.67%)	5	NA	NA
WP_001829854.1|501910_502066_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	75.0	2.2e-13
WP_002470779.1|502562_503291_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.5	2.8e-34
WP_002440300.1|503277_504735_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_002456347.1|504973_506032_-	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_001829860.1|506257_507106_-|protease	serine protease	protease	A0A2H4PQN3	Staphylococcus_phage	31.9	3.5e-20
>prophage 36
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	520499	524170	2500626		Bacillus_phage(50.0%)	3	NA	NA
WP_001830383.1|520499_522236_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	7.3e-49
WP_001830384.1|522477_523020_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_001830413.1|523126_524170_-	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	28.9	2.1e-22
>prophage 37
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	537482	538112	2500626		Bacillus_phage(100.0%)	1	NA	NA
WP_001830439.1|537482_538112_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	27.4	1.1e-05
>prophage 38
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	546399	551451	2500626		Staphylococcus_phage(33.33%)	5	NA	NA
WP_002470326.1|546399_546954_+	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	42.0	2.3e-33
WP_001830390.1|546984_548055_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002470336.1|548364_548907_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_038398518.1|549050_550421_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	41.6	1.3e-101
WP_038398519.1|550500_551451_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	26.8	4.0e-17
>prophage 39
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	558340	568830	2500626		Bacillus_virus(40.0%)	9	NA	NA
WP_002440422.1|558340_560338_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	37.3	1.2e-111
WP_001830418.1|560341_562531_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.1	1.0e-132
WP_001830396.1|562527_563220_-	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_001830443.1|563543_563846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002440416.1|563970_565266_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	2.1e-16
WP_001830380.1|565677_565857_-	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_001830398.1|565840_566467_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_001832476.1|566540_567368_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	51.2	1.2e-62
WP_001830368.1|567360_568830_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.2	4.1e-109
>prophage 40
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	578805	579204	2500626		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001830427.1|578805_579204_+	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	47.6	2.1e-20
>prophage 41
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	584585	587033	2500626		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001830444.1|584585_585458_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	34.3	1.7e-25
WP_038398532.1|585478_586138_-	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_001830432.1|586118_587033_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.7	2.1e-18
>prophage 42
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	597615	598900	2500626		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_052074369.1|597615_597969_-	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	67.0	1.8e-31
WP_038398541.1|598126_598900_-	hypothetical protein	NA	A0A1W6JPD5	Staphylococcus_phage	97.7	1.5e-134
>prophage 43
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	602153	604113	2500626		uncultured_virus(100.0%)	2	NA	NA
WP_002447508.1|602153_603773_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.2	1.5e-157
WP_038398547.1|603828_604113_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	43.0	2.6e-12
>prophage 44
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	610416	616239	2500626		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_001829999.1|610416_611133_+	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	33.9	1.1e-27
WP_002468351.1|611200_612160_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_002470315.1|612166_613639_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.9	4.6e-20
WP_002470302.1|613899_614853_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_002495546.1|614988_616239_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.9	1.1e-35
>prophage 45
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	619476	624474	2500626	tRNA	Bodo_saltans_virus(33.33%)	3	NA	NA
WP_038398563.1|619476_621411_+	ABC-F type ribosomal protection protein	NA	A0A2H4UUX5	Bodo_saltans_virus	27.0	8.2e-49
WP_038398564.1|621752_623369_+	AAA family ATPase	NA	A0A1B1IS82	uncultured_Mediterranean_phage	26.5	2.5e-19
WP_001830015.1|623451_624474_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.9	4.4e-62
>prophage 46
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	628192	632847	2500626		Yellowstone_lake_phycodnavirus(50.0%)	4	NA	NA
WP_002470298.1|628192_629935_+	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	31.1	2.5e-65
WP_001830009.1|629934_630168_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_038398567.1|630284_631289_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_001830007.1|631311_632847_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	29.5	4.4e-13
>prophage 47
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	646326	649687	2500626		Bacillus_phage(50.0%)	5	NA	NA
WP_002440602.1|646326_647097_-	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.7	4.1e-20
WP_038398573.1|647071_647551_-	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001829952.1|647552_647879_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001829902.1|647978_648980_-	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001829891.1|649324_649687_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	33.6	6.5e-08
>prophage 48
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	654279	655809	2500626		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_002457112.1|654279_655809_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	9.9e-58
>prophage 49
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	662878	663532	2500626		Moumouvirus(100.0%)	1	NA	NA
WP_001829983.1|662878_663532_+	HD domain-containing protein	NA	H2ED17	Moumouvirus	30.6	1.0e-11
>prophage 50
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	668858	669254	2500626		Listeria_phage(100.0%)	1	NA	NA
WP_002457121.1|668858_669254_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	35.0	1.4e-16
>prophage 51
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	679437	687283	2500626		Catovirus(25.0%)	9	NA	NA
WP_001829933.1|679437_680583_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.7	4.4e-26
WP_001829916.1|680607_681237_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_038398581.1|681265_682504_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.0	5.3e-102
WP_001829927.1|682528_683053_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_002457126.1|683162_683582_-	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_001829923.1|683578_684622_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	37.9	7.3e-44
WP_002440566.1|684784_685621_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001829940.1|685607_686684_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_001829979.1|686683_687283_-	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.4	4.3e-33
>prophage 52
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	696423	698031	2500626		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001829895.1|696423_698031_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	4.4e-149
>prophage 53
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	706810	710295	2500626		Geobacillus_virus(50.0%)	4	NA	NA
WP_002489243.1|706810_708112_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.3	6.1e-133
WP_002458726.1|708144_708807_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001829961.1|709014_709725_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001829900.1|709848_710295_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	44.5	1.1e-28
>prophage 54
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	715672	716626	2500626		Indivirus(100.0%)	1	NA	NA
WP_001829912.1|715672_716626_+	CDF family zinc efflux transporter CzrB	NA	A0A1V0SED0	Indivirus	27.3	3.4e-24
>prophage 55
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	720558	722364	2500626		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_001829889.1|720558_722364_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	40.3	1.7e-101
>prophage 56
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	742529	743495	2500626		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001829779.1|742529_743495_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	29.3	2.9e-15
>prophage 57
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	766319	771702	2500626	tRNA	Orpheovirus(33.33%)	7	NA	NA
WP_038398613.1|766319_767060_+	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	30.8	5.4e-17
WP_095694446.1|767322_767721_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002469355.1|767734_768172_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002477630.1|768432_769236_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_032603376.1|769239_770046_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_002456988.1|770035_770896_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	22.1	4.3e-10
WP_002469356.1|770892_771702_-	energy-coupling factor transporter ATPase	NA	G3M9Y6	Bacillus_virus	27.0	4.2e-15
>prophage 58
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	786762	788097	2500626		Moraxella_phage(100.0%)	1	NA	NA
WP_001829757.1|786762_788097_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.2	8.7e-50
>prophage 59
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	794392	797548	2500626		Leptospira_phage(100.0%)	1	NA	NA
WP_038398635.1|794392_797548_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	1.9e-66
>prophage 60
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	809719	810340	2500626		Bacillus_virus(100.0%)	1	NA	NA
WP_002467767.1|809719_810340_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.6	1.8e-21
>prophage 61
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	835070	838448	2500626		Catovirus(50.0%)	3	NA	NA
WP_001832639.1|835070_836024_+	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	31.0	1.2e-32
WP_038398656.1|836164_837289_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_038398658.1|837671_838448_-	autolysin	NA	H9A0W8	Staphylococcus_phage	39.4	1.1e-36
>prophage 62
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	858771	858927	2500626		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001830033.1|858771_858927_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	77.6	2.6e-14
>prophage 63
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	864547	865429	2500626		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_002456633.1|864547_865429_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.2	4.4e-58
>prophage 64
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	888818	890030	2500626		Salmonella_phage(100.0%)	1	NA	NA
WP_038398694.1|888818_890030_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.3	4.6e-34
>prophage 65
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	893574	896101	2500626		Planktothrix_phage(50.0%)	3	NA	NA
WP_002468227.1|893574_894243_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	2.5e-37
WP_038398702.1|894242_895295_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001831555.1|895426_896101_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	47.9	2.2e-54
>prophage 66
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	905293	907459	2500626		Catovirus(100.0%)	1	NA	NA
WP_002485939.1|905293_907459_-	bifunctional glycosyltransferase family 2 protein/CDP-glycerol:glycerophosphate glycerophosphotransferase	NA	A0A1V0SAH6	Catovirus	38.7	4.3e-06
>prophage 67
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	929483	931037	2500626		Escherichia_phage(100.0%)	1	NA	NA
WP_002438317.1|929483_931037_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 68
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	947763	948785	2500626		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001831527.1|947763_947910_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	71.4	8.6e-12
WP_001831593.1|948053_948785_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	5.0e-23
>prophage 69
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	955072	956224	2500626		Streptococcus_phage(100.0%)	1	NA	NA
WP_038398736.1|955072_956224_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.5	2.2e-49
>prophage 70
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	964163	965681	2500626		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001831582.1|964163_965681_+	serine hydrolase FLP	NA	A0A2P1K0A5	Mycobacterium_phage	23.0	6.1e-07
>prophage 71
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	969980	971756	2500626		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038398741.1|969980_971756_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.9	2.0e-65
>prophage 72
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	976268	979067	2500626		Mycoplasma_phage(50.0%)	2	NA	NA
WP_001831407.1|976268_977525_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	53.8	2.7e-21
WP_001831524.1|978014_979067_+	2,3-butanediol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	20.9	4.5e-09
>prophage 73
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	985184	985847	2500626		Bacillus_phage(100.0%)	1	NA	NA
WP_001831406.1|985184_985847_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	36.0	2.0e-18
>prophage 74
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	991105	991924	2500626		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_038398743.1|991105_991924_-	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	26.7	3.7e-11
>prophage 75
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	997508	998201	2500626		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002438215.1|997508_998201_-	SDR family oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	27.1	4.6e-10
>prophage 76
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1004567	1007292	2500626		Streptococcus_phage(50.0%)	2	NA	NA
WP_038398750.1|1004567_1006208_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	38.5	1.2e-98
WP_038398751.1|1006425_1007292_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.9	9.9e-79
>prophage 77
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1039750	1040734	2500626		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_038398771.1|1039750_1040734_+	D-lactate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	31.4	1.1e-38
>prophage 78
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1048297	1051719	2500626	transposase	Staphylococcus_phage(50.0%)	5	NA	NA
WP_002468259.1|1048297_1048453_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	77.6	5.2e-15
WP_002438139.1|1048778_1048955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002495508.1|1049018_1049513_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001831599.1|1049688_1050300_+	class A sortase SrtA	NA	NA	NA	NA	NA
WP_144242852.1|1050540_1051719_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.2	7.4e-61
>prophage 79
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1059840	1066857	2500626	protease	Acanthamoeba_polyphaga_mimivirus(33.33%)	7	NA	NA
WP_038398777.1|1059840_1060821_-	alpha/beta hydrolase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	23.7	2.4e-12
WP_001832362.1|1060903_1061752_-	YitT family protein	NA	NA	NA	NA	NA
WP_001832372.1|1061934_1062261_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_038398779.1|1062483_1063536_+	zinc-dependent alcohol dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	26.1	5.5e-15
WP_080290066.1|1063600_1064368_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002467723.1|1064429_1064810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038398781.1|1064829_1066857_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	43.3	2.1e-07
>prophage 80
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1075270	1075789	2500626		Streptococcus_phage(100.0%)	1	NA	NA
WP_002456694.1|1075270_1075789_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	39.8	1.0e-22
>prophage 81
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1081511	1092693	2500626		Trichoplusia_ni_ascovirus(20.0%)	9	NA	NA
WP_038398795.1|1081511_1082381_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	41.8	3.9e-51
WP_002467715.1|1082583_1082790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038398797.1|1083026_1085411_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.5	9.5e-124
WP_001832344.1|1085542_1085749_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_038398798.1|1085802_1086801_-	D-lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	32.1	3.7e-37
WP_001832328.1|1086813_1087974_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002503216.1|1088300_1089074_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_002467975.1|1089672_1091481_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	30.1	1.1e-34
WP_002438072.1|1091985_1092693_-	transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	41.1	2.1e-31
>prophage 82
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1107447	1108266	2500626		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001830671.1|1107447_1108266_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	M4QNT1	Ostreococcus_lucimarinus_virus	36.0	2.1e-38
>prophage 83
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1116939	1118277	2500626		Klosneuvirus(100.0%)	1	NA	NA
WP_001830675.1|1116939_1118277_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.1	2.5e-20
>prophage 84
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1123327	1124218	2500626		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001830665.1|1123327_1124218_+	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	7.2e-08
>prophage 85
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1128196	1149017	2500626	holin	Vibrio_phage(25.0%)	15	NA	NA
WP_001830624.1|1128196_1130824_-	pyruvate, phosphate dikinase	NA	A0A2I7RQW7	Vibrio_phage	40.5	4.6e-87
WP_001830656.1|1131171_1132767_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.2	1.4e-75
WP_001830617.1|1133103_1133550_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001830634.1|1133577_1133796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038398811.1|1134242_1135418_-	amidohydrolase	NA	NA	NA	NA	NA
WP_001830593.1|1135739_1137458_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	33.1	4.5e-59
WP_038398813.1|1137617_1139108_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017465191.1|1139579_1140143_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001830660.1|1140188_1141811_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	22.6	4.6e-21
WP_038398816.1|1142231_1143530_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_002438021.1|1143893_1144430_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	47.4	3.7e-36
WP_038398818.1|1144426_1146277_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	65.4	5.1e-242
WP_018113827.1|1146595_1146901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018113828.1|1147223_1147823_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	45.2	4.6e-27
WP_002438012.1|1147838_1149017_-	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	31.9	3.2e-48
>prophage 86
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1155327	1156059	2500626		Bacillus_phage(100.0%)	1	NA	NA
WP_001830661.1|1155327_1156059_-	phosphoadenylyl-sulfate reductase	NA	M4W6M9	Bacillus_phage	23.5	1.1e-09
>prophage 87
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1163524	1165117	2500626		Aeromonas_phage(100.0%)	1	NA	NA
WP_038398826.1|1163524_1165117_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	28.6	2.2e-44
>prophage 88
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1168346	1169096	2500626		Planktothrix_phage(100.0%)	1	NA	NA
WP_001830627.1|1168346_1169096_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	4.3e-30
>prophage 89
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1177645	1178983	2500626		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038398834.1|1177645_1178983_-	hypothetical protein	NA	A0A0D3MVF0	Staphylococcus_phage	46.1	2.0e-46
>prophage 90
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1183676	1188158	2500626	transposase	Lactococcus_phage(50.0%)	4	NA	NA
WP_001832700.1|1183676_1184159_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	6.4e-19
WP_001831825.1|1184377_1184824_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038398838.1|1184995_1186645_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_038398840.1|1186991_1188158_-	CapA family protein	NA	A0A2H4JG01	uncultured_Caudovirales_phage	49.9	3.0e-107
>prophage 91
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1212339	1214307	2500626		Clostridium_phage(100.0%)	1	NA	NA
WP_038398853.1|1212339_1214307_+	amidase domain-containing protein	NA	A0A0A7RUS8	Clostridium_phage	36.3	4.0e-11
>prophage 92
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1218222	1219787	2500626	transposase	Streptococcus_phage(50.0%)	2	NA	NA
WP_144242854.1|1218222_1219401_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.5	8.7e-62
WP_002503190.1|1219631_1219787_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	77.1	5.7e-14
>prophage 93
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1243372	1244146	2500626		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001832011.1|1243372_1244146_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	1.9e-12
>prophage 94
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1250871	1252050	2500626	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_144242855.1|1250871_1252050_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.5	3.3e-61
>prophage 95
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1255787	1256423	2500626		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_038398874.1|1255787_1256423_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	27.9	3.3e-15
>prophage 96
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1271895	1279613	2500626		Vibrio_phage(25.0%)	7	NA	NA
WP_038398890.1|1271895_1273506_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	22.6	2.3e-20
WP_002458078.1|1273669_1274182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001830507.1|1274456_1274612_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	81.6	4.7e-16
WP_038398892.1|1274863_1276141_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_001830482.1|1276154_1277195_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_038398894.1|1277265_1278219_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	E3SJ83	Synechococcus_phage	28.7	2.1e-13
WP_038398896.1|1278260_1279613_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	8.8e-34
>prophage 97
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1290976	1298140	2500626		Tupanvirus(100.0%)	1	NA	NA
WP_038398902.1|1290976_1298140_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.8	5.5e-151
>prophage 98
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1309778	1310207	2500626		Bacillus_phage(100.0%)	1	NA	NA
WP_038398907.1|1309778_1310207_-	FosB family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	56.0	2.2e-31
>prophage 99
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1317429	1319249	2500626	holin	Bacillus_virus(50.0%)	2	NA	NA
WP_001830452.1|1317429_1318065_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	25.6	1.9e-07
WP_001830513.1|1318061_1319249_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	32.9	1.4e-19
>prophage 100
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1326713	1332465	2500626		Tetraselmis_virus(33.33%)	4	NA	NA
WP_038398916.1|1326713_1328960_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	44.2	1.1e-182
WP_038398918.1|1329705_1330896_-	MFS transporter	NA	NA	NA	NA	NA
WP_002499122.1|1330907_1331657_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	26.9	2.3e-07
WP_038398920.1|1331649_1332465_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.2e-09
>prophage 101
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1339508	1345690	2500626		Staphylococcus_phage(50.0%)	4	NA	NA
WP_002485971.1|1339508_1340198_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.6	1.0e-25
WP_038398928.1|1340325_1341099_-	acetoin reductase	NA	NA	NA	NA	NA
WP_038398930.1|1341267_1342644_-	MFS transporter	NA	NA	NA	NA	NA
WP_038398931.1|1342672_1345690_-	NADH-dependent flavin oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	57.4	1.0e-199
>prophage 102
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1365646	1366780	2500626		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_020360179.1|1365646_1366780_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	25.3	9.4e-21
>prophage 103
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1373725	1374466	2500626		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_002486709.1|1373725_1374466_-	HAD family hydrolase	NA	A0A2H4UUK2	Bodo_saltans_virus	28.3	2.8e-13
>prophage 104
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1405244	1407265	2500626		Staphylococcus_phage(100.0%)	3	NA	NA
WP_001830569.1|1405244_1405559_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	60.6	6.2e-31
WP_001830578.1|1405558_1406851_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	80.7	1.4e-185
WP_002456800.1|1406869_1407265_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	84.0	3.2e-61
>prophage 105
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1413315	1417060	2500626	transposase	uncultured_virus(50.0%)	2	NA	NA
WP_038398980.1|1413315_1415379_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.4	5.8e-69
WP_144242857.1|1415881_1417060_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.5	1.1e-61
>prophage 106
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1421755	1425786	2500626		Bacillus_phage(33.33%)	5	NA	NA
WP_001830535.1|1421755_1422421_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	6.3e-25
WP_002470724.1|1422501_1423113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002485674.1|1423078_1424200_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002489406.1|1424174_1425080_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.4	4.7e-23
WP_002437584.1|1425390_1425786_+	radical SAM protein	NA	R9TGT5	Vibrio_phage	28.2	3.3e-05
>prophage 107
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1446646	1448459	2500626		Sulfolobus_virus(50.0%)	2	NA	NA
WP_038399002.1|1446646_1447687_-	hypothetical protein	NA	K9ME42	Sulfolobus_virus	22.7	1.4e-10
WP_052074373.1|1447679_1448459_-	site-specific DNA-methyltransferase	NA	A0A0C5AE50	Cyanophage	38.8	2.3e-10
>prophage 108
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1451876	1461982	2500626		Bacillus_phage(40.0%)	7	NA	NA
WP_002447628.1|1451876_1452677_-	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	36.4	2.9e-40
WP_002467996.1|1453298_1454090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038399008.1|1454090_1455428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002437327.1|1455420_1457253_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.4	1.6e-30
WP_038399011.1|1457265_1457967_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.8	7.8e-42
WP_021298879.1|1459019_1460303_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.8	1.4e-68
WP_001831779.1|1460581_1461982_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.9	2.2e-112
>prophage 109
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1468406	1477927	2500626	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_010959371.1|1468406_1469411_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	52.6	2.5e-81
WP_038399015.1|1469938_1471225_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.2	2.4e-89
WP_001831762.1|1472069_1472885_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_001831812.1|1473277_1475959_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.4	3.8e-121
WP_001831817.1|1475995_1477927_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.0	3.2e-146
>prophage 110
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1488147	1488987	2500626		Gordonia_phage(100.0%)	1	NA	NA
WP_001831794.1|1488147_1488987_+	nucleoid occlusion protein	NA	A0A1C9EHY8	Gordonia_phage	33.1	4.7e-09
>prophage 111
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1492439	1495865	2500626		Bacillus_virus(100.0%)	4	NA	NA
WP_002468942.1|1492439_1493009_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	31.8	5.6e-06
WP_002456813.1|1493196_1493826_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_001831820.1|1494063_1495182_+	RND transporter	NA	NA	NA	NA	NA
WP_001831756.1|1495178_1495865_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	1.4e-22
>prophage 112
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1502279	1503038	2500626		Planktothrix_phage(100.0%)	1	NA	NA
WP_038399025.1|1502279_1503038_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	4.5e-35
>prophage 113
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1519272	1520115	2500626		Tupanvirus(100.0%)	1	NA	NA
WP_038399030.1|1519272_1520115_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	25.5	3.1e-05
>prophage 114
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1528612	1537348	2500626		Pandoravirus(40.0%)	10	NA	NA
WP_038399033.1|1528612_1529788_-	PLP-dependent transferase	NA	A0A0B5JD48	Pandoravirus	25.9	3.0e-14
WP_038399034.1|1529784_1530888_-	hypothetical protein	NA	A0A0B5JD48	Pandoravirus	25.8	1.0e-11
WP_002486174.1|1531616_1532459_+	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	25.2	1.6e-09
WP_002468622.1|1532619_1533495_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_038399035.1|1533515_1533719_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_001831336.1|1533730_1534828_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001831355.1|1535060_1535252_-	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	83.3	4.4e-24
WP_002503286.1|1535325_1536135_-	lysozyme	NA	NA	NA	NA	NA
WP_001831345.1|1536519_1536816_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001831333.1|1536838_1537348_+	single-stranded DNA-binding protein	NA	A0A2H4JCF2	uncultured_Caudovirales_phage	90.5	4.8e-65
>prophage 115
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1542396	1543920	2500626		Enterococcus_phage(100.0%)	1	NA	NA
WP_002497459.1|1542396_1543920_-	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.1	1.6e-39
>prophage 116
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1553146	1563459	2500626	integrase,terminase	uncultured_Caudovirales_phage(37.5%)	13	1546837:1546851	1563035:1563049
1546837:1546851	attL	AGTCATTAACGTTAA	NA	NA	NA	NA
WP_001829407.1|1553146_1554613_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.8	3.7e-94
WP_002468031.1|1554779_1556321_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	3.6e-23
WP_038399038.1|1556414_1557551_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	37.2	3.1e-56
WP_052074374.1|1557670_1558276_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038399039.1|1558400_1558604_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038399040.1|1558635_1558902_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038399041.1|1559079_1559397_+	DUF1474 family protein	NA	A0A2H4JB50	uncultured_Caudovirales_phage	51.5	6.7e-25
WP_038399042.1|1559436_1559661_+	hypothetical protein	NA	A0A0D4DCE1	Staphylococcus_phage	41.8	9.8e-07
WP_038399043.1|1559697_1560531_+	DnaD domain protein	NA	A0A2H4JAS0	uncultured_Caudovirales_phage	73.5	8.9e-77
WP_038399044.1|1560542_1561328_+	ATP-binding protein	NA	A0A2H4JCH7	uncultured_Caudovirales_phage	51.3	1.2e-72
WP_038399045.1|1562212_1562440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038399046.1|1562450_1562972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038399047.1|1563030_1563459_+|terminase	terminase small subunit	terminase	H9A0M8	Staphylococcus_phage	67.6	3.5e-45
1563035:1563049	attR	AGTCATTAACGTTAA	NA	NA	NA	NA
>prophage 117
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1567245	1569922	2500626		Staphylococcus_phage(50.0%)	3	NA	NA
WP_038399049.1|1567245_1567818_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	45.8	3.1e-28
WP_052074376.1|1567810_1569148_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_002503293.1|1569718_1569922_+	hypothetical protein	NA	A0A2H4JBF3	uncultured_Caudovirales_phage	56.5	2.1e-16
>prophage 118
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1574738	1575086	2500626		Streptococcus_phage(100.0%)	1	NA	NA
WP_002447711.1|1574738_1575086_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	36.8	1.1e-12
>prophage 119
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1578235	1578790	2500626		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002503296.1|1578235_1578790_-	hypothetical protein	NA	A0A1J0MFV9	Staphylococcus_phage	53.6	3.8e-07
>prophage 120
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1585881	1586145	2500626		Staphylococcus_virus(100.0%)	1	NA	NA
WP_001832458.1|1585881_1586145_-	hypothetical protein	NA	Q4ZCB7	Staphylococcus_virus	46.2	1.3e-10
>prophage 121
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1598874	1602950	2500626		Planktothrix_phage(50.0%)	4	NA	NA
WP_038399058.1|1598874_1599900_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.4e-31
WP_001829353.1|1599902_1600562_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001829383.1|1600605_1601451_+	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_001829380.1|1601975_1602950_+	autolysin/adhesin Aae	NA	Q6A204	Oenococcus_phage	41.8	6.2e-21
>prophage 122
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1619321	1621028	2500626		Streptococcus_virus(100.0%)	1	NA	NA
WP_001829412.1|1619321_1621028_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.2	1.1e-54
>prophage 123
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1630175	1637634	2500626	tRNA	Streptococcus_phage(50.0%)	9	NA	NA
WP_001832211.1|1630175_1630787_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	4.1e-47
WP_001832200.1|1630820_1631150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038399062.1|1631455_1632382_+	DNA polymerase III delta' subunit	NA	A0A292GC45	Xanthomonas_phage	31.9	1.8e-06
WP_038399064.1|1632383_1633187_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_001832238.1|1633203_1633551_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_002457100.1|1633646_1634372_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_001832208.1|1634364_1634613_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_002468614.1|1634614_1635454_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.8	4.6e-57
WP_038399065.1|1635663_1637634_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.0	5.9e-95
>prophage 124
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1643891	1646356	2500626		Tupanvirus(50.0%)	2	NA	NA
WP_038399070.1|1643891_1645247_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	31.4	4.4e-25
WP_001832233.1|1645390_1646356_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	36.7	2.6e-48
>prophage 125
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1656989	1666055	2500626	tRNA	uncultured_virus(20.0%)	8	NA	NA
WP_001832216.1|1656989_1657529_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	1.0e-12
WP_038399076.1|1657803_1659906_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	H8ZJI5	Ostreococcus_tauri_virus	48.8	6.5e-108
WP_001832190.1|1660160_1661042_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001832242.1|1661377_1662310_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	63.9	3.2e-107
WP_038399077.1|1662605_1663409_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	31.0	9.3e-23
WP_038399079.1|1663386_1663752_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_038399081.1|1663752_1664232_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_002477712.1|1664567_1666055_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.8	1.3e-94
>prophage 126
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1677799	1682317	2500626	transposase	Streptococcus_phage(100.0%)	4	NA	NA
WP_038399082.1|1677799_1679164_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.7	1.7e-16
WP_038399084.1|1679260_1680148_+	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_011082818.1|1680150_1680708_+	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_104992782.1|1681138_1682317_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.2	9.7e-61
>prophage 127
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1686026	1688480	2500626	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_001832300.1|1686026_1688480_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	41.2	1.6e-134
>prophage 128
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1694317	1699106	2500626	tRNA	Catovirus(50.0%)	8	NA	NA
WP_038399097.1|1694317_1695718_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.6	1.2e-57
WP_001833082.1|1695722_1696109_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_038399387.1|1696116_1696866_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_001832317.1|1696862_1697390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038399098.1|1697459_1698035_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_001832285.1|1698158_1698302_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002438679.1|1698364_1698547_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001832303.1|1698557_1699106_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	32.9	6.6e-12
>prophage 129
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1702964	1714105	2500626		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_001833083.1|1702964_1706516_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.2	8.0e-50
WP_002445736.1|1706674_1710271_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.7	8.0e-66
WP_038399103.1|1710598_1710859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001833079.1|1710949_1711363_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001137495.1|1711433_1711904_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001832287.1|1712023_1714105_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.6	3.8e-68
>prophage 130
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1718137	1719088	2500626		Klosneuvirus(100.0%)	1	NA	NA
WP_002438698.1|1718137_1719088_+	ornithine cyclodeaminase family protein	NA	A0A1V0SL93	Klosneuvirus	29.4	3.1e-17
>prophage 131
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1729480	1730143	2500626		Enterococcus_phage(100.0%)	1	NA	NA
WP_001832291.1|1729480_1730143_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	33.9	2.3e-19
>prophage 132
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1739001	1739202	2500626		Staphylococcus_phage(100.0%)	1	NA	NA
WP_080051823.1|1739001_1739202_-	protein-tyrosine-phosphatase	NA	A0A2H4PQT9	Staphylococcus_phage	70.8	1.8e-20
>prophage 133
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1751963	1755291	2500626		Harp_seal_herpesvirus(50.0%)	5	NA	NA
WP_001832132.1|1751963_1752614_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	45.0	2.1e-41
WP_001832078.1|1752623_1752983_+	DUF5327 family protein	NA	NA	NA	NA	NA
WP_002494334.1|1753007_1753376_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_001832531.1|1753491_1754982_+	APC family permease	NA	NA	NA	NA	NA
WP_002470762.1|1755135_1755291_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	83.7	3.6e-16
>prophage 134
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1766274	1771610	2500626		Erysipelothrix_phage(50.0%)	5	NA	NA
WP_002484563.1|1766274_1767606_-	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.0e-106
WP_002468721.1|1767610_1768033_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_002469173.1|1768188_1769127_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002438748.1|1769743_1770220_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002438750.1|1770311_1771610_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	30.9	5.5e-25
>prophage 135
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1776639	1777662	2500626		Tupanvirus(100.0%)	1	NA	NA
WP_002438761.1|1776639_1777662_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	28.9	5.5e-36
>prophage 136
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1788404	1789181	2500626		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001832174.1|1788404_1789181_+	alpha/beta hydrolase	NA	A0A1D8EVD1	Mycobacterium_phage	28.2	8.4e-05
>prophage 137
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1804655	1805402	2500626		Indivirus(100.0%)	1	NA	NA
WP_001832084.1|1804655_1805402_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.7	4.4e-11
>prophage 138
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1812638	1823229	2500626		Streptomyces_phage(20.0%)	8	NA	NA
WP_001833002.1|1812638_1813037_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	2.9e-17
WP_038399137.1|1814020_1815748_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	40.4	9.7e-102
WP_002493541.1|1816033_1817263_+	nucleoside permease	NA	NA	NA	NA	NA
WP_001832123.1|1817799_1818633_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	37.3	1.3e-43
WP_001832050.1|1818991_1819789_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	31.2	9.2e-15
WP_001832127.1|1820108_1820609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001832177.1|1820833_1821901_+	membrane protein	NA	NA	NA	NA	NA
WP_002438830.1|1822179_1823229_+	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	23.3	4.9e-16
>prophage 139
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1827199	1827961	2500626		Cedratvirus(100.0%)	1	NA	NA
WP_001833013.1|1827199_1827961_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.7	1.2e-19
>prophage 140
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1837948	1838425	2500626		Pandoravirus(100.0%)	1	NA	NA
WP_001832058.1|1837948_1838425_+	cupin domain-containing protein	NA	A0A291ATU0	Pandoravirus	37.5	1.7e-16
>prophage 141
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1847680	1848247	2500626		Enterococcus_phage(100.0%)	1	NA	NA
WP_038399152.1|1847680_1848247_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.8	4.7e-21
>prophage 142
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1851415	1854741	2500626		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_038399155.1|1851415_1853050_+	ABC transporter ATP-binding protein/permease	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.7	2.4e-17
WP_038399156.1|1853046_1854741_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.4	1.5e-14
>prophage 143
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1859844	1861218	2500626		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_038399160.1|1859844_1861218_+	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	37.3	1.1e-47
>prophage 144
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1872310	1882859	2500626		Staphylococcus_phage(22.22%)	13	NA	NA
WP_038399164.1|1872310_1873150_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.0	1.2e-60
WP_001830351.1|1873352_1874459_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	43.2	6.3e-62
WP_038399166.1|1874528_1875581_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.6	2.0e-17
WP_001830352.1|1875583_1876273_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	3.4e-34
WP_001830332.1|1876247_1876721_-	DoxX family protein	NA	NA	NA	NA	NA
WP_001830329.1|1876771_1877209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038399168.1|1877804_1877960_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	77.6	2.0e-14
WP_080290106.1|1878323_1878923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001830330.1|1879024_1879738_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	44.8	1.6e-55
WP_001830341.1|1879738_1880158_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_038399171.1|1880162_1880834_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	56.1	1.4e-64
WP_001830349.1|1881130_1881718_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
WP_038399173.1|1881707_1882859_+	anthranilate synthase component I family protein	NA	A0A0B5J984	Pandoravirus	39.6	4.4e-26
>prophage 145
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1886017	1899626	2500626	transposase	Streptococcus_phage(28.57%)	9	NA	NA
WP_038399176.1|1886017_1887958_+	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	38.5	1.0e-107
WP_144242859.1|1888629_1889808_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.5	8.7e-62
WP_038399178.1|1890406_1891222_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_038399179.1|1891349_1893233_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	1.5e-55
WP_038399180.1|1893246_1895025_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	37.3	1.0e-77
WP_038399181.1|1895224_1896199_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.4	7.8e-24
WP_038399182.1|1896191_1897706_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_002468685.1|1897908_1898964_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	2.7e-22
WP_001832599.1|1899086_1899626_+	5'-3'-deoxyribonucleotidase	NA	A0A0A0PKY7	Bacillus_phage	40.7	1.1e-30
>prophage 146
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1904278	1914708	2500626		uncultured_Caudovirales_phage(62.5%)	9	NA	NA
WP_038399189.1|1904278_1905784_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.8	3.6e-60
WP_002468857.1|1906067_1906568_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	70.1	1.1e-50
WP_002468673.1|1906581_1907451_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001829589.1|1908212_1908611_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	100.0	2.0e-71
WP_002502495.1|1908573_1910679_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	99.9	0.0e+00
WP_001829597.1|1910797_1911766_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	100.0	3.9e-185
WP_002487913.1|1912014_1912989_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	100.0	4.1e-166
WP_038399192.1|1912972_1913932_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	100.0	4.1e-17
WP_038399194.1|1913928_1914708_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.6	5.1e-18
>prophage 147
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1926141	1929200	2500626		Streptococcus_phage(100.0%)	3	NA	NA
WP_002473950.1|1926141_1926783_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	4.8e-38
WP_001829661.1|1926927_1927794_+	DegV family protein	NA	NA	NA	NA	NA
WP_138109967.1|1927910_1929200_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	35.4	8.4e-50
>prophage 148
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1935348	1936149	2500626		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038399206.1|1935348_1936149_+	CHAP domain-containing protein	NA	A0A173GBC8	Staphylococcus_phage	44.6	5.6e-12
>prophage 149
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1939887	1942722	2500626		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_038399208.1|1939887_1942722_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	58.2	0.0e+00
>prophage 150
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1946857	1951854	2500626		Streptococcus_phage(40.0%)	5	NA	NA
WP_002502488.1|1946857_1947790_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.9	3.2e-83
WP_001829594.1|1947965_1948874_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	33.6	3.6e-07
WP_001829626.1|1948873_1949869_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	39.8	2.6e-51
WP_002438915.1|1949997_1950942_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	2.4e-54
WP_001829659.1|1951269_1951854_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.7	3.1e-52
>prophage 151
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1961522	1967702	2500626		Streptococcus_phage(33.33%)	6	NA	NA
WP_001829595.1|1961522_1962827_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.3	4.3e-195
WP_038399221.1|1962992_1963451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001829669.1|1963519_1963753_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_001829672.1|1964053_1964794_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_001829677.1|1964828_1967207_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.6	8.1e-91
WP_001829588.1|1967231_1967702_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	88.5	1.4e-71
>prophage 152
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1971118	1971352	2500626		Staphylococcus_virus(100.0%)	1	NA	NA
WP_001829658.1|1971118_1971352_-	hypothetical protein	NA	Q4ZCB8	Staphylococcus_virus	64.9	1.0e-22
>prophage 153
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1976766	1981274	2500626		Indivirus(33.33%)	6	NA	NA
WP_001829688.1|1976766_1977708_+	cation transporter	NA	A0A1V0SED0	Indivirus	33.6	1.1e-11
WP_095658922.1|1978105_1978180_-	epsilon family phenol-soluble modulin	NA	NA	NA	NA	NA
WP_001829681.1|1979073_1979274_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.2	2.0e-19
WP_001829613.1|1979895_1980120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001829635.1|1980144_1980429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002495246.1|1980527_1981274_-	poly-gamma-glutamate hydrolase family protein	NA	A0A2H4IZ42	uncultured_Caudovirales_phage	42.2	8.6e-39
>prophage 154
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1986983	1992149	2500626		Streptococcus_phage(66.67%)	8	NA	NA
WP_038399227.1|1986983_1987700_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.7	2.2e-15
WP_002468868.1|1987780_1988323_+	nitroreductase	NA	NA	NA	NA	NA
WP_038399228.1|1988498_1988822_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001831965.1|1988964_1989318_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	45.9	1.6e-19
WP_002438979.1|1989491_1989872_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_001831968.1|1990194_1990581_+	topiosmerase	NA	NA	NA	NA	NA
WP_001831936.1|1990573_1990870_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001831992.1|1991123_1992149_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	1.8e-26
>prophage 155
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	1995711	1999184	2500626		Brazilian_cedratvirus(50.0%)	3	NA	NA
WP_001831944.1|1995711_1996473_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	8.5e-10
WP_001831898.1|1996567_1997875_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002468879.1|1997942_1999184_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.0	3.1e-110
>prophage 156
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2003955	2004804	2500626		Golden_Marseillevirus(100.0%)	1	NA	NA
WP_001831962.1|2003955_2004804_+	DUF72 domain-containing protein	NA	A0A1D6Y809	Golden_Marseillevirus	25.9	5.4e-13
>prophage 157
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2011864	2014533	2500626		Tupanvirus(50.0%)	2	NA	NA
WP_038399237.1|2011864_2013322_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	27.7	7.3e-42
WP_002439035.1|2013318_2014533_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	28.0	4.5e-21
>prophage 158
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2018794	2022433	2500626		Lake_Baikal_phage(50.0%)	3	NA	NA
WP_001832002.1|2018794_2019154_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	1.2e-14
WP_001831966.1|2019423_2020632_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038399240.1|2020951_2022433_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.1	3.3e-50
>prophage 159
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2032253	2032847	2500626		Aureococcus_anophage(100.0%)	1	NA	NA
WP_001831922.1|2032253_2032847_+	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	6.6e-26
>prophage 160
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2037738	2041523	2500626		Klosneuvirus(50.0%)	3	NA	NA
WP_038399243.1|2037738_2038929_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.4	1.5e-32
WP_001831995.1|2039037_2040282_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_038399244.1|2040473_2041523_-	glycerophosphodiester phosphodiesterase	NA	A0A173GBD0	Staphylococcus_phage	39.6	1.9e-36
>prophage 161
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2051534	2055191	2500626		Bacillus_phage(100.0%)	1	NA	NA
WP_038399247.1|2051534_2055191_+	helicase-exonuclease AddAB subunit AddA	NA	S5M596	Bacillus_phage	22.1	2.0e-19
>prophage 162
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2058949	2059105	2500626		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038399249.1|2058949_2059105_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	81.6	1.0e-15
>prophage 163
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2062346	2069088	2500626	transposase	Pseudomonas_phage(33.33%)	3	NA	NA
WP_038399253.1|2062346_2064170_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	30.7	1.6e-30
WP_038399254.1|2064378_2066988_+	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.0	7.0e-120
WP_107519593.1|2067909_2069088_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.7	3.9e-62
>prophage 164
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2074841	2075921	2500626		Planktothrix_phage(100.0%)	1	NA	NA
WP_001829326.1|2074841_2075921_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	2.4e-18
>prophage 165
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2082458	2084267	2500626		Streptococcus_phage(100.0%)	1	NA	NA
WP_038399258.1|2082458_2084267_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	26.7	8.2e-51
>prophage 166
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2095457	2167917	2500626	portal,transposase,protease,integrase,head,capsid,terminase,holin,tail	Bacillus_phage(28.57%)	76	2102534:2102550	2161541:2161557
WP_097667989.1|2095457_2096636_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.5	2.5e-61
WP_077431490.1|2096939_2097089_+	hypothetical protein	NA	M4SJ15	Cyanophage	51.0	3.5e-08
WP_002469315.1|2097421_2097799_+	glucose-6-phosphate 1-dehydrogenase	NA	NA	NA	NA	NA
WP_002503124.1|2097917_2100176_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.0	4.8e-117
WP_002494358.1|2101505_2101721_+	recombinase family protein	NA	NA	NA	NA	NA
WP_002439142.1|2102388_2103159_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
2102534:2102550	attL	AGAAATTATTAGAACAA	NA	NA	NA	NA
WP_002456101.1|2103555_2104641_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_001832657.1|2104865_2105621_+	esterase family protein	NA	NA	NA	NA	NA
WP_002468295.1|2105774_2106284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001829331.1|2106547_2107759_-	MFS transporter	NA	NA	NA	NA	NA
WP_001829298.1|2107718_2108894_-	diglucosyl diacylglycerol synthase	NA	NA	NA	NA	NA
WP_038399259.1|2109414_2110899_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_002439147.1|2110888_2111134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002446117.1|2111137_2112700_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	26.9	1.7e-36
WP_002439148.1|2113008_2113815_+	TerC family protein	NA	S5MAL1	Bacillus_phage	37.7	3.9e-29
WP_038399260.1|2114025_2115858_+	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	24.3	4.7e-06
WP_001829321.1|2115875_2117234_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_001829277.1|2117372_2118878_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_001829312.1|2118980_2119583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001829339.1|2119588_2119774_-	DUF2187 family protein	NA	NA	NA	NA	NA
WP_038399261.1|2119978_2120965_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_038399262.1|2121042_2121261_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_001829272.1|2121474_2122050_+	competence protein ComK	NA	NA	NA	NA	NA
WP_038399263.1|2122571_2123627_-|integrase	site-specific integrase	integrase	A0A2H4JGN1	uncultured_Caudovirales_phage	63.9	1.5e-126
WP_038399264.1|2123700_2124375_-	hypothetical protein	NA	A0A2H4J5B8	uncultured_Caudovirales_phage	38.8	1.3e-06
WP_002486483.1|2124387_2124762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038399265.1|2124917_2125301_-	helix-turn-helix domain-containing protein	NA	A0A2I6PE55	Staphylococcus_phage	53.6	2.2e-30
WP_002491648.1|2125471_2125690_+	DUF739 family protein	NA	A0A2I6PE94	Staphylococcus_phage	66.7	5.8e-20
WP_038399266.1|2125722_2126031_+	DUF771 domain-containing protein	NA	Q4ZC28	Staphylococcus_virus	36.4	2.9e-09
WP_002491662.1|2126124_2126421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038399267.1|2126526_2126721_+	DUF1270 family protein	NA	NA	NA	NA	NA
WP_038399268.1|2126868_2128110_+	DEAD/DEAH box helicase family protein	NA	A0A1B1P7L4	Bacillus_phage	58.2	3.3e-136
WP_002484586.1|2128112_2128430_+	hypothetical protein	NA	A0A2P0ZLA7	Lactobacillus_phage	46.5	3.7e-23
WP_002484599.1|2128422_2128719_+	hypothetical protein	NA	A0A1B1P7M6	Bacillus_phage	58.2	3.6e-25
WP_038399269.1|2128718_2130530_+	AAA family ATPase	NA	A0A1B1P7N0	Bacillus_phage	57.4	5.0e-165
WP_002501708.1|2130548_2130755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038399270.1|2130806_2131289_+	DUF669 domain-containing protein	NA	A0A2H4J1S8	uncultured_Caudovirales_phage	37.7	2.6e-20
WP_038399271.1|2131338_2133057_+	DNA polymerase	NA	A0A1B1P7M5	Bacillus_phage	63.3	7.7e-208
WP_002486494.1|2133140_2133305_+	DUF3310 domain-containing protein	NA	A0A2I6PF10	Staphylococcus_phage	58.8	1.1e-07
WP_038399272.1|2133312_2133702_+	hypothetical protein	NA	U3PG42	Staphylococcus_phage	56.0	1.2e-07
WP_002501712.1|2133709_2134405_-	hypothetical protein	NA	U3PE05	Staphylococcus_phage	54.7	8.8e-70
WP_038399273.1|2134470_2134821_+	hypothetical protein	NA	U3PBR4	Staphylococcus_phage	69.0	3.0e-34
WP_038399274.1|2134848_2135316_-	hypothetical protein	NA	A0A1W6JPR4	Staphylococcus_phage	40.8	7.8e-22
WP_038399275.1|2135383_2135629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002501715.1|2135707_2135902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038399276.1|2135931_2137806_+	DNA primase	NA	A0A1B1P7L5	Bacillus_phage	58.3	2.5e-212
WP_038399277.1|2138129_2138621_+	DNA-directed RNA polymerase sigma-70 factor	NA	S5MAA9	Brevibacillus_phage	28.0	2.6e-07
WP_038399278.1|2138824_2139445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002446790.1|2139709_2140000_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	42.2	3.2e-18
WP_038399279.1|2140321_2140660_+|terminase	terminase	terminase	D2XR14	Bacillus_phage	39.4	1.5e-11
WP_038399280.1|2140643_2142278_+|terminase	terminase large subunit	terminase	A0A0U4B089	Bacillus_phage	56.6	1.8e-182
WP_038399281.1|2142293_2143430_+|portal	phage portal protein	portal	A0A0U4IIQ9	Bacillus_phage	43.5	6.8e-88
WP_038399282.1|2143429_2144176_+|protease	Clp protease ClpP	protease	A0A2H4J8Y7	uncultured_Caudovirales_phage	47.4	2.9e-42
WP_002484575.1|2144200_2145358_+|capsid	phage major capsid protein	capsid	A0A0U4JIF4	Bacillus_phage	51.7	2.2e-97
WP_038399283.1|2145384_2145693_+	hypothetical protein	NA	A0A2H4JF26	uncultured_Caudovirales_phage	38.0	5.9e-10
WP_002446783.1|2145664_2145994_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002501726.1|2145993_2146332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038399284.1|2146331_2146769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002484613.1|2146774_2147479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002501729.1|2147502_2147847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032604414.1|2147900_2148113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038399285.1|2148176_2152358_+|tail	phage tail tape measure protein	tail	A0A2P0ZLF1	Lactobacillus_phage	42.6	4.3e-63
WP_038399286.1|2152360_2153131_+|tail	tail protein	tail	NA	NA	NA	NA
WP_038399287.1|2153127_2156583_+	hypothetical protein	NA	C5J973	Streptococcus_phage	32.5	1.3e-17
WP_038399288.1|2156603_2157014_+	hypothetical protein	NA	A0A1I9KKA6	Lactobacillus_phage	31.3	1.6e-07
WP_038399289.1|2157050_2157332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002446772.1|2157333_2157720_+|holin	phage holin family protein	holin	D7RWK5	Brochothrix_phage	33.9	2.1e-12
WP_038399290.1|2157773_2158694_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JNM6	Staphylococcus_phage	62.9	8.3e-68
WP_038399291.1|2158769_2159516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052074378.1|2159892_2160957_-|integrase	site-specific integrase	integrase	B7T092	Staphylococcus_virus	77.6	5.7e-161
WP_038399293.1|2162397_2162730_-	helix-turn-helix transcriptional regulator	NA	A1BTY6	Staphylococcus_virus	96.4	8.7e-52
2161541:2161557	attR	TTGTTCTAATAATTTCT	NA	NA	NA	NA
WP_038399294.1|2162902_2163163_+	hypothetical protein	NA	A1BTY7	Staphylococcus_virus	88.9	1.8e-28
WP_038399295.1|2163291_2163507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038399296.1|2164791_2165256_-	hypothetical protein	NA	H9A0R0	Staphylococcus_phage	81.2	1.1e-65
WP_038399297.1|2166630_2167161_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	60.5	1.4e-54
WP_001831694.1|2167701_2167917_-	NINE protein	NA	A0A060AN66	Enterococcus_phage	40.4	1.6e-06
>prophage 167
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2178345	2182353	2500626		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038399302.1|2178345_2182353_-	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A1J0MFI1	Staphylococcus_phage	49.2	2.0e-57
>prophage 168
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2186151	2187354	2500626		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001833073.1|2186151_2187354_+	serine hydrolase	NA	G8IDB2	Mycobacterium_phage	22.8	8.2e-07
>prophage 169
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2193830	2208462	2500626		Synechococcus_phage(22.22%)	14	NA	NA
WP_038399306.1|2193830_2194691_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.2	1.1e-37
WP_002457464.1|2194895_2195378_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.7	2.0e-20
WP_002457463.1|2195364_2196492_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002491656.1|2196492_2197197_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	H8ZMN3	Synechococcus_phage	42.5	2.1e-47
WP_001831728.1|2197196_2197457_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001831727.1|2197458_2198130_+	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
WP_002467589.1|2198122_2200312_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.4	1.1e-139
WP_038399307.1|2200290_2201775_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	1.2e-44
WP_038399308.1|2201767_2202799_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.1	6.3e-64
WP_001831672.1|2202798_2203365_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.0	6.1e-29
WP_038399309.1|2203381_2204860_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.1	4.9e-78
WP_001831701.1|2204885_2206127_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_001831682.1|2206259_2207066_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_038399310.1|2207058_2208462_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	8.1e-14
>prophage 170
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2213643	2218305	2500626	transposase	Streptococcus_phage(50.0%)	5	NA	NA
WP_001831690.1|2213643_2214816_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.5	2.9e-73
WP_001831644.1|2214875_2215415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001831726.1|2215570_2215837_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_001831740.1|2215839_2217558_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_038399311.1|2217792_2218305_+|transposase	IS200/IS605-like element ISSep3 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	5.2e-19
>prophage 171
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2225409	2225961	2500626		Synechococcus_phage(100.0%)	1	NA	NA
WP_038399313.1|2225409_2225961_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.8	2.9e-15
>prophage 172
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2230470	2234241	2500626		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_001831650.1|2230470_2231877_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.3	3.8e-48
WP_002490051.1|2232178_2232457_+	UPF0223 family protein	NA	NA	NA	NA	NA
WP_038399314.1|2232595_2233135_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038399315.1|2233146_2234241_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	43.0	2.4e-37
>prophage 173
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2243127	2244975	2500626		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001831737.1|2243127_2244975_+	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	42.2	3.4e-20
>prophage 174
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2257701	2260595	2500626		Enterococcus_phage(50.0%)	5	NA	NA
WP_038399322.1|2257701_2258628_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	42.2	1.8e-09
WP_002439362.1|2258848_2259100_+	DUF2129 domain-containing protein	NA	NA	NA	NA	NA
WP_001830114.1|2259109_2259499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002470236.1|2259565_2260108_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_001830072.1|2260109_2260595_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.5	1.1e-26
>prophage 175
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2267398	2268457	2500626	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_001830082.1|2267398_2268457_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	3.6e-30
>prophage 176
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2272953	2277594	2500626		Bodo_saltans_virus(33.33%)	3	NA	NA
WP_001830120.1|2272953_2274663_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	23.0	4.0e-15
WP_038399324.1|2274672_2277021_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	38.9	5.1e-13
WP_001830148.1|2277279_2277594_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	47.6	2.3e-25
>prophage 177
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2284198	2284786	2500626		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_001830169.1|2284198_2284786_+	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	26.9	1.6e-08
>prophage 178
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2305199	2307950	2500626	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_002469567.1|2305199_2307950_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.5	2.7e-90
>prophage 179
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2312540	2317151	2500626		Enterobacteria_phage(33.33%)	4	NA	NA
WP_001830174.1|2312540_2313848_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.9	5.2e-55
WP_001830068.1|2313873_2314755_+	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	31.3	2.3e-30
WP_001830129.1|2314772_2316050_+	dihydroorotase	NA	NA	NA	NA	NA
WP_002470226.1|2316050_2317151_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.0	5.1e-64
>prophage 180
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2321044	2321656	2500626		Pandoravirus(100.0%)	1	NA	NA
WP_001830179.1|2321044_2321656_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	32.8	6.8e-26
>prophage 181
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2324861	2331788	2500626	tRNA	Abalone_herpesvirus(25.0%)	7	NA	NA
WP_001830096.1|2324861_2325485_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	35.3	4.2e-23
WP_001830123.1|2325484_2325697_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_038399337.1|2326234_2327434_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.7	6.2e-39
WP_038399338.1|2327433_2329842_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_001830141.1|2329949_2330153_-	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	44.4	1.2e-08
WP_001830064.1|2330374_2330863_+	peptide deformylase	NA	NA	NA	NA	NA
WP_002439455.1|2330855_2331788_+|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	30.3	4.3e-11
>prophage 182
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2334935	2336939	2500626		Moumouvirus(100.0%)	1	NA	NA
WP_038399340.1|2334935_2336939_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	M1PCM5	Moumouvirus	35.7	6.1e-23
>prophage 183
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2346954	2349065	2500626		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_001830161.1|2346954_2347689_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.7	2.2e-18
WP_001830184.1|2347979_2348213_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_002456575.1|2348327_2349065_+	ribonuclease III	NA	G8DDA3	Micromonas_pusilla_virus	31.8	4.5e-24
>prophage 184
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2364981	2365752	2500626		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_001829514.1|2364981_2365752_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	41.2	3.3e-25
>prophage 185
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2369817	2446017	2500626	portal,integrase,protease,capsid,tRNA	Streptococcus_phage(10.53%)	65	2423044:2423061	2443804:2443821
WP_001829508.1|2369817_2371887_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.3	1.5e-104
WP_001832560.1|2371911_2373219_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_038399346.1|2373443_2374334_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.3	3.2e-24
WP_001829498.1|2374337_2374880_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001829474.1|2374948_2376352_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.3	2.9e-27
WP_002439506.1|2376375_2377146_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_038399347.1|2377508_2378297_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002439509.1|2378448_2379327_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_002439511.1|2379467_2380190_+	UMP kinase	NA	NA	NA	NA	NA
WP_001829472.1|2380206_2380761_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_001832561.1|2380981_2381752_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.0	6.6e-26
WP_001829499.1|2381755_2382538_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_038399348.1|2382771_2384058_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_001829513.1|2384076_2385780_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_144242864.1|2386029_2390340_+	PolC-type DNA polymerase III	NA	A0A1X9I5C8	Streptococcus_phage	40.1	5.0e-22
WP_038399350.1|2390518_2390986_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001829457.1|2391006_2392230_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001829465.1|2392247_2392532_+	YlxR family protein	NA	NA	NA	NA	NA
WP_002439520.1|2392531_2392849_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_038399351.1|2392853_2395016_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.3	3.5e-24
WP_002457359.1|2395318_2395669_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002439525.1|2395806_2396724_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_001832563.1|2396739_2397711_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	32.1	6.0e-08
WP_002439528.1|2397830_2398100_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_002494421.1|2398231_2400337_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002457357.1|2400704_2402378_+	ribonuclease J	NA	NA	NA	NA	NA
WP_161375002.1|2402760_2405037_+	DUF87 domain-containing protein	NA	S5VNE3	Mycobacterium_phage	48.7	4.1e-84
WP_002439536.1|2405039_2405753_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002439538.1|2405783_2407055_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	29.1	1.4e-41
WP_038399352.1|2407054_2408344_+	insulinase family protein	NA	M1NN74	Moumouvirus	24.0	1.0e-15
WP_038399353.1|2408340_2409045_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002456562.1|2409197_2410025_+	YmfK family protein	NA	NA	NA	NA	NA
WP_001832565.1|2410043_2410436_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001829485.1|2410464_2411046_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002502429.1|2411493_2412639_+	CinA family nicotinamide mononucleotide deamidase-related protein	NA	NA	NA	NA	NA
WP_002439552.1|2412809_2413859_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	68.8	3.2e-124
WP_001829512.1|2414084_2415644_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_002439555.1|2415732_2415948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001832548.1|2416111_2416906_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_002469373.1|2417018_2418779_+	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_002439562.1|2418779_2419646_+	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_001832558.1|2420231_2420849_+	poly-gamma-glutamate hydrolase family protein	NA	A0A2H4J3M4	uncultured_Caudovirales_phage	44.6	1.9e-39
WP_001829496.1|2420905_2421196_+	thiamine-binding protein	NA	NA	NA	NA	NA
WP_002439565.1|2421538_2423083_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
2423044:2423061	attL	ATTTATACAAGAACATCA	NA	NA	NA	NA
WP_002439569.1|2423084_2423450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001829480.1|2423473_2423968_+	energy coupling factor transporter S component ThiW	NA	NA	NA	NA	NA
WP_001832553.1|2424165_2426787_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.3	3.8e-41
WP_038399354.1|2426801_2428739_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.7	1.3e-62
WP_001829471.1|2428752_2429286_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_002470246.1|2429659_2430484_+	aquaporin family protein	NA	NA	NA	NA	NA
WP_002439580.1|2430637_2432137_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001832566.1|2432313_2433987_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_038399355.1|2434211_2435138_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002439583.1|2435149_2436148_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001829517.1|2436101_2436341_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_002470261.1|2436562_2437039_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	43.0	1.2e-25
WP_080290119.1|2437139_2438390_+	GTPase HflX	NA	NA	NA	NA	NA
WP_002456554.1|2438405_2439644_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_001829488.1|2440124_2440490_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038399357.1|2440508_2441849_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_161375308.1|2441993_2442443_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P8I7	Bacillus_phage	56.2	4.1e-12
WP_141754918.1|2442399_2442741_+|portal	phage portal protein	portal	Q4ZE36	Staphylococcus_virus	68.1	1.9e-30
WP_162472552.1|2443270_2444263_+|capsid	minor capsid protein	capsid	Q4ZE35	Staphylococcus_virus	71.1	4.5e-51
2443804:2443821	attR	ATTTATACAAGAACATCA	NA	NA	NA	NA
WP_002503677.1|2444534_2445083_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_002456548.1|2445333_2446017_-	hypothetical protein	NA	A0A2H4J5B8	uncultured_Caudovirales_phage	50.0	2.4e-11
>prophage 186
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2449330	2453685	2500626		Anomala_cuprea_entomopoxvirus(50.0%)	6	NA	NA
WP_002468002.1|2449330_2450206_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	6.3e-25
WP_038399361.1|2450202_2450934_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002456544.1|2450933_2452028_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_038399362.1|2452024_2452627_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001829458.1|2452795_2452984_-	membrane protein	NA	NA	NA	NA	NA
WP_002468003.1|2453148_2453685_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	47.7	2.8e-23
>prophage 187
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2464632	2469965	2500626		Tupanvirus(25.0%)	6	NA	NA
WP_001831169.1|2464632_2466147_+	catalase	NA	A0A2K9L0T1	Tupanvirus	42.8	7.5e-90
WP_001831295.1|2466236_2466386_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001831302.1|2466552_2466822_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001832645.1|2466975_2467953_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	89.2	5.2e-169
WP_038399364.1|2468050_2468992_+	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	35.9	1.8e-17
WP_001831182.1|2469344_2469965_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	7.7e-17
>prophage 188
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2474199	2475324	2500626		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038399365.1|2474199_2475324_+	exonuclease SbcCD subunit D	NA	Q4Z9B9	Staphylococcus_phage	25.0	1.3e-11
>prophage 189
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2479036	2480677	2500626		Vibrio_phage(100.0%)	1	NA	NA
WP_001831122.1|2479036_2480677_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.2	1.6e-21
>prophage 190
NZ_CP009046	Staphylococcus epidermidis strain SEI chromosome, complete genome	2500626	2485801	2490195	2500626		Bacillus_virus(100.0%)	2	NA	NA
WP_162472553.1|2485801_2487796_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.4	3.5e-119
WP_002439655.1|2487792_2490195_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.8	1.3e-104
