The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009571	Sphingomonas taxi strain ATCC 55669 chromosome, complete genome	3859099	396817	404331	3859099		Pelagibacter_phage(16.67%)	10	NA	NA
WP_038658749.1|396817_397024_+	30S ribosomal protein S21	NA	M1HLV7	Pelagibacter_phage	47.6	8.5e-05
WP_038658752.1|397132_397717_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_038658754.1|397850_398075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038658756.1|398225_398996_-	serine/threonine protein phosphatase	NA	V9QL63	Rhizobium_phage	32.3	1.6e-16
WP_038658759.1|399076_400378_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	28.4	1.8e-23
WP_038658762.1|400361_401498_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	NA	NA	NA	NA
WP_038658765.1|401521_402283_-	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SAV8	Catovirus	26.5	8.3e-05
WP_038658768.1|402279_402675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038658771.1|402671_403118_-	dUTP diphosphatase	NA	K4JSC8	Caulobacter_phage	55.4	4.1e-36
WP_038658774.1|403149_404331_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.6	5.2e-38
>prophage 2
NZ_CP009571	Sphingomonas taxi strain ATCC 55669 chromosome, complete genome	3859099	3442177	3471510	3859099	portal,capsid,head,integrase,tail,protease	Rhodobacter_phage(15.38%)	33	3445716:3445736	3484933:3484953
WP_038665175.1|3442177_3443503_+	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.3	1.5e-65
WP_038665178.1|3443705_3444818_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	38.8	5.7e-47
WP_038665181.1|3444814_3445117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179944547.1|3445104_3445488_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	39.4	7.8e-12
WP_038665184.1|3445525_3446527_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	48.8	3.0e-79
3445716:3445736	attL	CGCCGATCCGCGCCATCGCCA	NA	NA	NA	NA
WP_052075711.1|3446550_3447024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038665187.1|3447020_3447404_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_038665190.1|3447416_3447824_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_038665193.1|3447820_3448135_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_038665196.1|3448131_3448332_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_038665199.1|3448324_3448927_+	hypothetical protein	NA	D6PEW0	uncultured_phage	30.2	3.8e-05
WP_038665201.1|3449103_3451371_+	DUF2460 domain-containing protein	NA	A0A023MH11	Escherichia_phage	29.1	4.8e-48
WP_038665202.1|3451367_3452165_+	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.0	1.5e-36
WP_038665205.1|3452151_3452553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038665209.1|3452552_3454718_+	hypothetical protein	NA	M4QNR6	Tetraselmis_viridis_virus	28.9	1.1e-38
WP_038665212.1|3454714_3455218_+	DUF2793 domain-containing protein	NA	A0A0K1LM54	Rhodobacter_phage	42.5	1.9e-18
WP_038665215.1|3455332_3456451_+	OmpA family protein	NA	NA	NA	NA	NA
WP_038665218.1|3456654_3457956_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	39.0	3.3e-78
WP_038665221.1|3457934_3458660_-	aminomethyltransferase	NA	NA	NA	NA	NA
WP_038665224.1|3458730_3459768_+	dihydroorotase	NA	NA	NA	NA	NA
WP_038665227.1|3459787_3460537_-	DUF1134 domain-containing protein	NA	NA	NA	NA	NA
WP_038665230.1|3461005_3461830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038665233.1|3461923_3462508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038665236.1|3462504_3463062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156143855.1|3463090_3463753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052075713.1|3463749_3466176_-	AAA family ATPase	NA	A0A1B1INT2	uncultured_Mediterranean_phage	33.9	3.4e-36
WP_169742555.1|3466172_3466475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156143856.1|3466519_3466858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156143857.1|3466968_3467154_-	helix-turn-helix domain-containing protein	NA	A0A2D1GF53	Mycobacterium_phage	45.6	1.2e-05
WP_156143858.1|3467601_3468306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052075714.1|3468446_3469055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156143859.1|3469213_3470236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038665246.1|3470292_3471510_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	41.1	1.6e-71
3484933:3484953	attR	CGCCGATCCGCGCCATCGCCA	NA	NA	NA	NA
