The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008929	Klebsiella pneumoniae strain PMK1 chromosome, complete genome	5317001	3508298	3517761	5317001	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|3508298_3509414_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|3509410_3511351_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|3511427_3511649_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|3511974_3512292_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|3512322_3514602_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|3514721_3514940_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|3515293_3515995_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_020323882.1|3516039_3517761_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	2.0e-14
>prophage 2
NZ_CP008929	Klebsiella pneumoniae strain PMK1 chromosome, complete genome	5317001	3773455	3842603	5317001	plate,terminase,head,capsid,portal,tRNA,integrase,tail	Enterobacteria_phage(50.0%)	81	3800648:3800669	3837359:3837380
WP_004150803.1|3773455_3774562_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|3774618_3775077_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|3775093_3775744_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|3775984_3777235_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_020324087.1|3777507_3778221_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150798.1|3778217_3778610_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150797.1|3778602_3778926_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_020805510.1|3779045_3779222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140530.1|3779375_3779603_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_020324096.1|3779715_3780909_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_022631258.1|3780976_3781312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150795.1|3781531_3781717_+	general stress protein	NA	NA	NA	NA	NA
WP_004148027.1|3781807_3782302_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|3782328_3782835_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004179357.1|3782851_3783739_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140511.1|3783794_3785201_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140509.1|3785197_3786208_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_020324075.1|3786320_3786518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3787084_3787717_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_020324078.1|3787756_3787936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|3788333_3789020_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_009486509.1|3789132_3789297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140497.1|3789330_3790839_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150788.1|3790959_3791850_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020324097.1|3791856_3793641_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004140494.1|3793714_3794923_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150784.1|3795225_3796269_+	type II asparaginase	NA	NA	NA	NA	NA
WP_008807690.1|3796930_3797845_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
WP_020324076.1|3797934_3798573_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004190891.1|3798703_3798967_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|3799026_3799152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213093.1|3799269_3799344_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|3799343_3799445_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004176549.1|3799502_3800516_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
3800648:3800669	attL	AAAAAAAGCCCCGTCGGGGGCG	NA	NA	NA	NA
WP_004216842.1|3800780_3801764_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
WP_004213095.1|3801879_3802179_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_020806130.1|3802299_3802578_+	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004216643.1|3802598_3802817_+	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020324119.1|3802832_3803210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324111.1|3803225_3803489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324115.1|3803566_3803791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408797.1|3803787_3804354_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	9.5e-14
WP_020324116.1|3804586_3805522_+	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
WP_020324090.1|3805559_3807707_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	63.6	2.4e-243
WP_020324106.1|3807964_3809911_+	DUF3696 domain-containing protein	NA	Q2P9X8	Enterobacteria_phage	39.6	3.4e-18
WP_020324074.1|3809903_3810911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324107.1|3811833_3812586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044816202.1|3813062_3814124_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	1.0e-141
WP_020324092.1|3814117_3815845_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.1	6.9e-233
WP_020324109.1|3816001_3816841_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	1.6e-94
WP_020324085.1|3816851_3817886_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
WP_020324091.1|3817935_3818802_+|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	57.3	8.4e-70
WP_020324071.1|3818906_3819422_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	3.1e-40
WP_004131559.1|3819421_3819622_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_020324103.1|3819612_3819897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324098.1|3819893_3820439_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	9.7e-32
WP_048293815.1|3820685_3820961_+	hypothetical protein	NA	B6SD31	Bacteriophage	34.5	3.9e-05
WP_020324102.1|3820961_3821429_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_020324118.1|3821425_3822061_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_009486481.1|3822057_3822645_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_020324083.1|3822641_3822992_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	54.8	9.3e-28
WP_020324110.1|3822993_3823917_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.6	6.9e-54
WP_020806131.1|3823906_3826933_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_020324108.1|3826929_3827142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324070.1|3827141_3828239_+|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_020324073.1|3828392_3829751_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	28.7	7.5e-49
WP_032408799.1|3829995_3830487_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	2.1e-54
WP_053086776.1|3833465_3833603_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	5.8e-10
WP_004131585.1|3833623_3833941_-	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_004216461.1|3833986_3834502_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_020324084.1|3834501_3835674_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
WP_020324077.1|3835828_3836968_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
WP_004213128.1|3837011_3837263_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_004179368.1|3837527_3837767_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3837359:3837380	attR	AAAAAAAGCCCCGTCGGGGGCG	NA	NA	NA	NA
WP_014343000.1|3837756_3838095_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_004150778.1|3838099_3838609_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004179371.1|3838754_3839447_+	CTP synthase	NA	NA	NA	NA	NA
WP_020324105.1|3839478_3840654_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140469.1|3840761_3841556_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|3841539_3841986_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004179374.1|3842102_3842603_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP008929	Klebsiella pneumoniae strain PMK1 chromosome, complete genome	5317001	4243049	4253936	5317001		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|4243049_4243670_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004179748.1|4243662_4244928_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_002903955.1|4244939_4245842_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|4246102_4246864_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004179754.1|4246884_4247745_-	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_004176262.1|4248042_4248303_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179755.1|4248389_4249478_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
WP_004176258.1|4249508_4250774_-	MFS transporter	NA	NA	NA	NA	NA
WP_004179756.1|4250828_4253936_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 4
NZ_CP008929	Klebsiella pneumoniae strain PMK1 chromosome, complete genome	5317001	4943848	5006855	5317001	protease,plate,tRNA,transposase	Salmonella_phage(20.0%)	55	NA	NA
WP_002910404.1|4943848_4945105_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|4945375_4945987_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004898981.1|4945986_4946835_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|4947018_4947966_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_020324125.1|4948090_4949770_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_004175547.1|4949770_4950817_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|4951038_4951314_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004180389.1|4951586_4952171_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|4952288_4953380_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_020323957.1|4953460_4953790_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|4953873_4954788_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|4954919_4956335_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004175538.1|4956354_4956798_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_020806091.1|4956800_4957337_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_020806092.1|4957317_4958334_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_020323961.1|4958363_4960127_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_020323959.1|4960260_4963671_-	intracellular multiplication/macrophage-killing	NA	NA	NA	NA	NA
WP_004180396.1|4964816_4965083_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004180397.1|4965312_4965639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020323962.1|4965827_4966067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217423.1|4966348_4966465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324953.1|4967516_4969973_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004180406.1|4970434_4972132_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004180407.1|4972135_4972789_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_015874925.1|4972785_4974126_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002910650.1|4974693_4975023_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910652.1|4975137_4975677_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_020324968.1|4975702_4976401_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	6.9e-06
WP_001393253.1|4978654_4978987_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|4979033_4979909_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|4980164_4981427_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_004152315.1|4981992_4982892_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004145468.1|4982866_4983676_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152313.1|4983687_4984983_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_002910715.1|4985286_4986213_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910717.1|4986313_4986790_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004180410.1|4986839_4988483_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910720.1|4988766_4989660_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175491.1|4989665_4990385_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_004148803.1|4990381_4991257_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_004148804.1|4991253_4992540_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004175489.1|4992549_4993464_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004189329.1|4993573_4994632_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004225356.1|4994921_4995068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004180412.1|4995118_4997413_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	1.4e-159
WP_004175486.1|4997441_4998650_-	propionate kinase	NA	NA	NA	NA	NA
WP_004145486.1|4998677_5000009_-	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_004180413.1|5000034_5001024_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_020324950.1|5001117_5002059_-	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_004219597.1|5002235_5002379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004145488.1|5002676_5002799_+	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_004180414.1|5002836_5003637_-	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_020324956.1|5003629_5004616_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004180416.1|5004771_5005629_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_004175481.1|5006108_5006855_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP008930	Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence	187571	13598	72028	187571	bacteriocin,transposase,integrase	Escherichia_phage(28.57%)	46	26619:26648	50775:50804
WP_004178051.1|13598_15920_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004152296.1|15921_16200_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_009485932.1|16540_17020_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004199332.1|17340_17619_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|17835_17913_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|17905_18763_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000093087.1|20209_22405_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004152291.1|22401_23718_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004152290.1|23721_26031_-	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
26619:26648	attL	CGGCTTTGTTGAATAAATCAGATTTCGGGT	NA	NA	NA	NA
WP_003846917.1|27736_28990_-	lactose permease	NA	NA	NA	NA	NA
WP_004152287.1|29041_32116_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_004152286.1|32237_33320_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152285.1|33542_33758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152284.1|33780_34791_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000427619.1|35194_36199_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_044117068.1|36490_37159_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_000842134.1|37648_38758_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_001039466.1|38852_40037_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000113282.1|40132_40789_+	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001143760.1|41380_44386_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001235713.1|44549_45107_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067855.1|45171_45876_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004118227.1|46225_47146_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152279.1|47145_47994_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|47990_48584_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|48580_49708_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|49992_50160_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_161989521.1|50088_50301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118235.1|51262_51784_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
50775:50804	attR	ACCCGAAATCTGATTTATTCAACAAAGCCG	NA	NA	NA	NA
WP_004118237.1|51780_52734_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004152280.1|52819_55144_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118241.1|55188_56091_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|56087_57086_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004152281.1|57082_58039_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|58039_58807_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|58905_59199_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_071527925.1|59529_59772_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427619.1|60069_61074_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004217321.1|62408_63113_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_004153729.1|63968_64796_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|64792_65656_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|65664_66492_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|66500_67511_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|67504_68374_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|69582_70563_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|71764_72028_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP008930	Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence	187571	77515	134553	187571	transposase,holin,protease,integrase	uncultured_Caudovirales_phage(31.25%)	52	104514:104528	141176:141190
WP_004152113.1|77515_78478_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_077256225.1|80320_81667_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_003026803.1|81878_82361_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|82348_82615_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004152108.1|82790_83045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152107.1|83120_83378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|83426_83630_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152105.1|83663_84032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|84075_84570_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152103.1|84600_85176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152102.1|85163_85433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152101.1|85790_86141_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152100.1|86190_86553_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152099.1|86570_88322_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152098.1|88369_89659_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152097.1|89671_90097_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152096.1|90129_90666_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152095.1|92562_92925_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004182005.1|93000_93546_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152093.1|93554_94268_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004152092.1|94264_94591_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152091.1|94922_95420_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_031944101.1|95469_95979_-	aquaporin	NA	NA	NA	NA	NA
WP_004152086.1|97721_97901_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004152085.1|98132_98567_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152084.1|98783_100184_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|100180_100861_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004118344.1|100915_101845_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|101849_102230_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001378118.1|102269_103160_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|103165_104983_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
104514:104528	attL	ATGGCACCGTATACC	NA	NA	NA	NA
WP_001023257.1|105216_105666_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|105954_106692_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|106725_106923_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|106963_109411_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|109537_109978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|110064_113211_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004152079.1|113221_114514_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|114627_114981_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475512.1|115009_116395_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001572351.1|116584_117265_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_003032875.1|117257_118733_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004178091.1|118983_119415_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_085955172.1|120843_122050_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178088.1|123089_125087_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_004152070.1|125149_126427_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_080895248.1|127409_128846_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004197688.1|129465_129723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977741.1|130395_131364_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
WP_071527918.1|131383_131695_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_040120240.1|131721_132669_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_001515717.1|133812_134553_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
141176:141190	attR	ATGGCACCGTATACC	NA	NA	NA	NA
>prophage 1
NZ_CP008931	Klebsiella pneumoniae strain PMK1 plasmid pPMK1-B, complete sequence	111693	3703	64405	111693	terminase,tail,integrase,portal	Salmonella_phage(86.54%)	59	53539:53554	67752:67767
WP_019704577.1|3703_3922_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
WP_040120244.1|3934_4147_+	hypothetical protein	NA	J9Q804	Salmonella_phage	74.3	9.9e-25
WP_074171164.1|4295_4595_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	69.7	1.4e-29
WP_004109918.1|4714_5122_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	45.0	2.8e-23
WP_021313142.1|5249_5624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040120246.1|5626_5908_+	ABC transporter	NA	J9Q753	Salmonella_phage	82.8	2.9e-40
WP_040120247.1|6113_6596_+	hypothetical protein	NA	J9Q805	Salmonella_phage	77.5	2.7e-70
WP_004109892.1|7441_8092_-	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_014342147.1|8725_9256_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
WP_019704582.1|9411_9849_+	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
WP_014342145.1|9899_10175_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	4.0e-26
WP_040120248.1|10177_11737_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.7	1.3e-278
WP_044816141.1|11796_12501_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	89.7	4.8e-108
WP_040120250.1|12500_13169_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	93.5	1.9e-106
WP_019704585.1|13797_14052_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	2.0e-40
WP_004109872.1|14057_14948_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
WP_004109869.1|14957_15224_+	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_040120251.1|15399_16041_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	87.7	1.5e-95
WP_004109863.1|16043_17300_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_040120252.1|17332_18907_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.4	8.7e-275
WP_014342135.1|18929_19829_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
WP_004109857.1|19855_20734_+	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_040120253.1|20812_21241_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	69.7	2.3e-28
WP_032423015.1|21288_21723_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
WP_032440486.1|21722_22556_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.8	3.7e-131
WP_004109848.1|22653_22998_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_021313126.1|22988_23462_+	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_021313125.1|23463_23856_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	67.5	1.0e-46
WP_040120254.1|23922_24669_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.4	1.6e-106
WP_004109835.1|24730_25048_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_014342129.1|25173_25398_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.2	2.0e-31
WP_040120255.1|25405_29935_+	tape measure protein	NA	J9Q712	Salmonella_phage	68.9	0.0e+00
WP_032423010.1|29978_30314_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
WP_004109820.1|30400_31099_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_004109817.1|31091_31889_+	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_019704527.1|31876_32488_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
WP_040120256.1|32504_44675_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	59.8	2.8e-30
WP_032422978.1|44727_46173_+|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	37.5	4.4e-39
WP_004109805.1|46268_46592_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_040120257.1|46605_47298_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	88.7	2.7e-119
WP_040120258.1|47300_47552_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	71.1	2.9e-23
WP_052115713.1|48025_48367_+	hypothetical protein	NA	A0A222YY00	Escherichia_phage	41.8	2.6e-14
WP_021313116.1|48367_49156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440479.1|49312_49978_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_014342115.1|49983_50340_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_021313114.1|50385_51144_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	98.0	1.6e-146
WP_040120259.1|51337_52063_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	3.3e-128
WP_004110189.1|52127_53468_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	95.7	1.6e-240
53539:53554	attL	AAGGAAAAACACATGA	NA	NA	NA	NA
WP_074171158.1|53615_54740_+	DNA primase	NA	J9Q720	Salmonella_phage	91.6	1.4e-202
WP_040120261.1|54774_55941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120262.1|56228_57017_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	50.4	9.0e-71
WP_052115711.1|57096_57564_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	64.6	6.8e-50
WP_040120264.1|59263_60136_+	bacteriophage abortive infection AbiH family protein	NA	NA	NA	NA	NA
WP_040120265.1|60247_61024_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	66.5	1.0e-90
WP_026005930.1|61154_61400_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	5.3e-14
WP_040120266.1|61494_62112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279483.1|62121_62532_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_021313793.1|62596_62956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120267.1|63304_64405_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.6e-17
67752:67767	attR	AAGGAAAAACACATGA	NA	NA	NA	NA
>prophage 2
NZ_CP008931	Klebsiella pneumoniae strain PMK1 plasmid pPMK1-B, complete sequence	111693	67763	111452	111693		Salmonella_phage(79.49%)	41	NA	NA
WP_032439780.1|67763_68996_+	AAA family ATPase	NA	J9Q733	Salmonella_phage	86.4	2.2e-212
WP_071889212.1|71542_72238_+	HNH endonuclease	NA	S5YLC4	Mycobacterium_phage	37.1	4.9e-20
WP_072196429.1|72259_73429_+	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	92.8	5.2e-208
WP_021313789.1|73443_73869_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.7	1.9e-59
WP_021313788.1|74069_74489_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	62.6	6.3e-47
WP_040120270.1|74499_74799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440517.1|74954_75386_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.1e-65
WP_032440516.1|75505_76513_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	88.3	2.1e-144
WP_021313784.1|76573_77518_+	exonuclease	NA	J9Q7S6	Salmonella_phage	93.6	2.8e-172
WP_040120271.1|77517_77784_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	83.0	1.1e-33
WP_039817762.1|79033_79210_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	66.7	1.4e-11
WP_040120273.1|79572_79908_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.1e-37
WP_014342074.1|79907_80120_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_014342073.1|80571_81789_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.3e-73
WP_040120274.1|81989_82634_+	hypothetical protein	NA	J9Q739	Salmonella_phage	80.2	2.4e-98
WP_019704555.1|82947_84507_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	52.3	6.6e-57
WP_040120275.1|85159_86245_+	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	84.5	7.0e-183
WP_014342187.1|86244_86478_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	3.4e-18
WP_032443572.1|86474_88391_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.6	2.8e-299
WP_074171162.1|88416_89127_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	59.7	3.9e-73
WP_021313773.1|89136_89706_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.1e-94
WP_040120277.1|89781_92085_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.7	0.0e+00
WP_014342181.1|92215_93358_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_040120278.1|93435_94311_+	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	84.4	1.7e-139
WP_032423044.1|94504_95608_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	80.1	6.7e-181
WP_072196421.1|95627_96023_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	75.6	6.7e-51
WP_040120279.1|96019_96496_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	98.7	7.5e-89
WP_040120280.1|96495_97140_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	99.5	2.0e-116
WP_040120281.1|97203_97623_+	hypothetical protein	NA	J9Q743	Salmonella_phage	96.4	1.3e-65
WP_021313768.1|97632_98175_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	96.6	8.6e-97
WP_044816135.1|98213_99320_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_040120283.1|99540_100383_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	88.6	3.0e-104
WP_019704564.1|101359_101593_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	2.7e-31
WP_019704565.1|102165_102753_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.2	3.4e-91
WP_023343110.1|102910_103450_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	46.0	6.4e-28
WP_032439715.1|103750_104176_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	80.9	7.5e-56
WP_040120284.1|104175_104331_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	59.2	3.7e-05
WP_040120285.1|104458_105037_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	56.5	8.6e-55
WP_040120287.1|105442_108559_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.7	2.3e-24
WP_040120288.1|108675_109899_-	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	23.2	5.4e-14
WP_040120289.1|109895_111452_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	1.9e-104
>prophage 1
NZ_CP008932	Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence	69947	6936	68222	69947	transposase,integrase	Escherichia_phage(18.18%)	56	13565:13582	39299:39316
WP_019705993.1|6936_8205_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.4	1.1e-59
WP_019705992.1|8209_11467_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_032436768.1|11467_12742_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_019706038.1|12738_14766_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
13565:13582	attL	CGGAAGAACAGATCCGTT	NA	NA	NA	NA
WP_004197635.1|14919_15714_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_006788217.1|16153_16333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197649.1|16452_17079_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_004197644.1|17695_18571_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.8	1.1e-82
WP_004197646.1|18982_20254_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
WP_001568036.1|20253_20685_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_001568038.1|20918_21890_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_015345000.1|21892_22564_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001568040.1|22626_22857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|23293_23995_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_001568042.1|23994_24216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|24225_24645_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568044.1|24698_25466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568045.1|26146_26575_+	antirestriction protein	NA	NA	NA	NA	NA
WP_001568046.1|26617_27124_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.4	4.1e-08
WP_001568047.1|27166_27358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024191981.1|27545_27800_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	6.1e-13
WP_032436760.1|27834_28155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568050.1|28862_29090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568051.1|29181_29412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040120295.1|29463_30819_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_013609525.1|30866_31430_+	methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
WP_004152717.1|32232_32589_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
WP_004152718.1|32649_32862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152719.1|32872_33097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|33177_33498_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152721.1|33487_33766_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_023280875.1|33766_34180_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_011977736.1|36370_36700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568108.1|36732_37218_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_087759866.1|37678_38799_-|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
WP_044816589.1|38876_39263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632528.1|39255_40269_+	replication initiation protein	NA	NA	NA	NA	NA
39299:39316	attR	CGGAAGAACAGATCCGTT	NA	NA	NA	NA
WP_071885288.1|41349_41778_-	GFA family protein	NA	NA	NA	NA	NA
WP_077256228.1|42032_43001_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.2	5.3e-182
WP_000820818.1|44777_45479_+	type 3 fimbria chaperone MrkB	NA	NA	NA	NA	NA
WP_000813718.1|45490_47977_+	type 3 fimbria usher protein MrkC	NA	NA	NA	NA	NA
WP_040120297.1|47967_48963_+	type 3 fimbria adhesin subunit MrkD	NA	NA	NA	NA	NA
WP_000677445.1|48976_49612_+	type 3 fimbria minor subunit MrkF	NA	NA	NA	NA	NA
WP_025714822.1|49646_50363_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_017899891.1|51481_51805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000480968.1|54905_55742_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|55741_56545_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000904906.1|56610_57225_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_001138082.1|57350_60236_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_000509966.1|60704_61310_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004194048.1|61969_63151_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000091613.1|63577_63892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|64146_64503_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|64492_64894_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|64890_65181_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003100881.1|65255_68222_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
>prophage 1
NZ_CP008933	Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence	304526	2084	56106	304526	transposase	Salmonella_phage(24.0%)	53	NA	NA
WP_014386573.1|2084_3197_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_085949440.1|3215_4585_-|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
WP_004026352.1|5284_5545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026354.1|5654_6125_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_004181895.1|6121_6565_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_004181894.1|6665_7937_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.3	3.9e-140
WP_004181893.1|7936_8359_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.3	6.3e-31
WP_004178082.1|8444_9932_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_170919122.1|11208_12240_-	CRISPR-associated protein Csf2	NA	NA	NA	NA	NA
WP_071889217.1|12244_12922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000608644.1|13135_14398_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_014386576.1|14677_15316_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_040120304.1|15405_15783_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_014386577.1|16032_17907_-	DEAD/DEAH box helicase	NA	A0A127AW80	Bacillus_phage	27.1	5.2e-08
WP_040120305.1|17909_18476_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_040120306.1|18478_19270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120307.1|19332_19746_-	NB-ARC domain protein	NA	NA	NA	NA	NA
WP_040120308.1|19830_20319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120309.1|20370_20781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016947073.1|20810_21218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016947072.1|21227_21623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197197.1|22070_23312_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
WP_004026392.1|23970_24135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386579.1|24195_24651_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_004026394.1|24938_25547_-	hypothetical protein	NA	K4JV11	Caulobacter_phage	42.2	1.5e-25
WP_004026395.1|25616_26066_-	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	45.2	2.9e-18
WP_162140056.1|26610_26778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120310.1|26834_27107_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
WP_016947069.1|27376_27562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099743439.1|27561_28164_-	DUF551 domain-containing protein	NA	A0A1V0E5M5	Salmonella_phage	31.1	2.1e-19
WP_016947068.1|28247_28730_-	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	58.3	4.4e-12
WP_004026408.1|29066_29282_-	hypothetical protein	NA	J9Q804	Salmonella_phage	51.4	6.1e-14
WP_004197228.1|29980_30367_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
WP_004883219.1|30783_31428_-	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
WP_062826758.1|32129_32318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386581.1|32314_32812_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	57.0	1.5e-23
WP_000608644.1|33132_34395_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|34650_35526_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|35572_35905_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|38226_38931_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|39562_40393_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|40523_41078_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|41221_41926_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014386219.1|42527_42833_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	42.9	1.3e-06
WP_001067855.1|42917_43622_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004199413.1|44500_47518_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_004201164.1|47946_48759_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|48762_49128_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|49132_49771_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|49781_50813_-	protein-disulfide reductase DsbD N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004201171.1|50817_51147_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|51340_51631_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_032492045.1|53088_56106_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.6	6.1e-51
>prophage 2
NZ_CP008933	Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence	304526	61676	124140	304526	transposase	Escherichia_phage(19.05%)	53	NA	NA
WP_004199413.1|61676_64694_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_004201164.1|65122_65935_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|65938_66304_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|66308_66947_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|66957_67989_-	protein-disulfide reductase DsbD N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004201171.1|67993_68323_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|68516_68807_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_032492045.1|70264_73282_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.6	6.1e-51
WP_014386481.1|73852_74497_+	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_086893244.1|75369_76053_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	97.3	5.9e-127
WP_004197205.1|76359_76611_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
WP_004026416.1|76731_77046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026417.1|77126_77447_-	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
WP_014386484.1|77500_78370_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_014386485.1|78759_79341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181845.1|79379_79673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181844.1|79689_80271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181843.1|80749_81229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120311.1|81312_81519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181842.1|81596_82127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181841.1|84152_85241_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.4	4.4e-60
WP_014386487.1|86212_87004_-	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	32.5	1.4e-10
WP_004181839.1|87324_87678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120312.1|87687_91068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120313.1|91136_92381_-	site-specific DNA-methyltransferase	NA	A0A1U9WRT4	Mycobacterium_phage	25.6	2.2e-07
WP_040120341.1|92727_93234_-	hypothetical protein	NA	K7PM35	Enterobacteria_phage	34.7	6.3e-09
WP_016947060.1|93610_94000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026449.1|94029_94347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181835.1|94358_94670_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_074167815.1|94971_95220_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	46.4	5.6e-11
WP_004196689.1|95255_95474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386491.1|96113_97094_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_087759866.1|97338_98458_+|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
WP_014386493.1|98873_100076_+	type II restriction enzyme	NA	E5E3X4	Burkholderia_phage	38.1	1.1e-35
WP_075043065.1|100165_101551_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	3.1e-106
WP_004026464.1|101707_102451_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.8e-60
WP_004026465.1|102447_102882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026466.1|102914_103175_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
WP_004026468.1|103428_103872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181826.1|104102_104462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032451555.1|104646_105057_-	hypothetical protein	NA	Q71TH9	Escherichia_phage	60.0	3.9e-41
WP_040120314.1|105181_105496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196710.1|105486_106065_-	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
WP_044816269.1|106164_106629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181820.1|107725_108145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181819.1|108275_108953_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_040120315.1|109099_111505_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_014386497.1|111640_114046_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_014386498.1|114184_116590_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_014386499.1|117311_118322_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_014386500.1|118321_119569_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	23.0	1.4e-12
WP_065310894.1|121750_121981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087759866.1|123019_124140_-|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
>prophage 3
NZ_CP008933	Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence	304526	157888	191937	304526	integrase,transposase	Salmonella_phage(27.27%)	34	178806:178819	192041:192054
WP_040120325.1|157888_159076_-|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.3	1.3e-142
WP_077256229.1|159111_159540_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	53.1	2.4e-33
WP_040120327.1|160114_161341_-|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.7	1.2e-154
WP_038991638.1|161494_161779_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.1	3.6e-22
WP_004181777.1|161768_162017_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_038991636.1|162307_164107_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	23.3	8.2e-27
WP_040120328.1|164440_165427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181774.1|165571_165925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181772.1|165986_166808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181771.1|166835_167888_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_004026538.1|167983_169060_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_014386525.1|170383_171160_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004181768.1|171231_171462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181767.1|171572_172817_+	toprim domain-containing protein	NA	A0A0H5AWB1	Pseudomonas_phage	25.5	1.8e-09
WP_004181766.1|172885_173425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181765.1|173569_173788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386527.1|173780_174389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181763.1|174375_174618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181762.1|174665_175130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409750.1|175139_175547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386528.1|175589_176549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181760.1|176545_177304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016946351.1|177300_177630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026552.1|177774_178092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386529.1|178157_179294_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
178806:178819	attL	GTTACGCAGCAGGG	NA	NA	NA	NA
WP_004178082.1|179379_180867_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_016946352.1|181379_181634_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014386530.1|181719_182787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136537796.1|183005_183290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186900.1|184186_185071_-	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
WP_040120329.1|185986_186991_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|187069_190042_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|190044_190602_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845039.1|190923_191937_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
192041:192054	attR	GTTACGCAGCAGGG	NA	NA	NA	NA
>prophage 4
NZ_CP008933	Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence	304526	195526	242469	304526	transposase,protease	Stx2-converting_phage(25.0%)	45	NA	NA
WP_000050481.1|195526_197068_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000359986.1|198466_199240_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_077252464.1|199220_199502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002026779.1|199721_199907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002001451.1|199955_201140_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_000052512.1|201538_203014_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|203069_203954_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_004896925.1|204312_204855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|205739_206444_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000429836.1|208898_209333_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427623.1|209411_210416_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000412211.1|211742_212402_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|212602_212980_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000427623.1|213290_214295_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_040120330.1|214373_217298_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.7	0.0e+00
WP_000147567.1|217300_217861_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000993245.1|217986_218199_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001087807.1|218264_218501_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|218497_218863_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|218880_220566_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|220604_221030_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|221057_221333_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294654.1|221348_221729_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|221800_222256_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_014386535.1|222908_223367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004902257.1|224196_224538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004902255.1|224645_224858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004902250.1|224976_225255_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_014386536.1|225245_225728_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004902239.1|226762_227302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032442757.1|227406_227799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004902235.1|227899_228655_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_014386537.1|228681_229329_+	EcsC family protein	NA	NA	NA	NA	NA
WP_014386538.1|229768_231307_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	92.4	2.5e-274
WP_001567372.1|231356_231704_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	5.7e-62
WP_001567371.1|231700_232105_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	95.5	2.0e-66
WP_014386540.1|233450_235184_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_040120347.1|235183_236224_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_032430777.1|236316_236955_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|236955_237597_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_014386542.1|237621_238260_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026591.1|238738_239197_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_014386543.1|239199_240423_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_014386544.1|240433_241390_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_014386545.1|241389_242469_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.5	3.3e-39
