The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009553	Pandoraea pnomenusa strain DSM 16536 chromosome, complete genome	5389285	445467	494787	5389285	holin,tail,terminase,transposase,head,capsid,protease,portal,plate,integrase	Burkholderia_phage(35.71%)	57	446077:446122	480076:480121
WP_023593907.1|445467_445926_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	44.0	3.2e-20
446077:446122	attL	TTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCCGGCACCAA	NA	NA	NA	NA
WP_038619095.1|446196_447225_-|integrase	tyrosine-type recombinase/integrase	integrase	E5E3T0	Burkholderia_phage	64.3	3.1e-124
WP_081326792.1|447225_447480_-	DUF4224 domain-containing protein	NA	E5E3T1	Burkholderia_phage	52.8	2.1e-13
WP_038619092.1|447449_450161_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	55.8	8.2e-289
WP_038619089.1|450174_450423_-	hypothetical protein	NA	I6NMK4	Burkholderia_virus	43.5	9.5e-11
WP_048806471.1|450419_450884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038619086.1|450897_451158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038619083.1|451312_451528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081326793.1|451626_452007_-	ogr/Delta-like zinc finger family protein	NA	A0A077K829	Ralstonia_phage	51.3	1.8e-16
WP_038619076.1|452003_452300_-	hypothetical protein	NA	E5E3P2	Burkholderia_phage	58.1	8.4e-22
WP_155765745.1|452303_452486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038619074.1|452663_453083_+	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	54.0	2.0e-32
WP_038619071.1|453142_453880_+	hypothetical protein	NA	A4PE55	Ralstonia_virus	31.2	3.2e-14
WP_038619068.1|453920_454769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038619065.1|454765_455920_-	phage late control D family protein	NA	E5E3P7	Burkholderia_phage	58.0	1.6e-100
WP_038619062.1|455919_456429_-|tail	phage tail protein	tail	A0A1S5NTH4	Burkholderia_phage	62.2	5.7e-42
WP_038619059.1|456439_459100_-	hypothetical protein	NA	A4PE52	Ralstonia_virus	49.9	7.9e-212
WP_081326794.1|459096_459294_-|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	55.9	1.9e-09
WP_048806470.1|459197_459515_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	55.0	1.2e-21
WP_038619056.1|459577_460087_-|tail	phage major tail tube protein	tail	A0A1S5NNH7	Burkholderia_phage	58.0	2.1e-52
WP_038619053.1|460109_461288_-|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	70.8	2.9e-166
WP_038619050.1|461420_462140_-	site-specific DNA-methyltransferase	NA	A0A1S5NPU0	Burkholderia_phage	63.0	6.7e-89
WP_081326795.1|462097_462325_-	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	71.9	2.1e-17
WP_038619044.1|462698_463694_+|integrase	tyrosine-type recombinase/integrase	integrase	B5WZU7	Pseudomonas_phage	37.0	2.9e-34
WP_038619042.1|463697_464048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038619035.1|465974_466589_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	65.6	7.8e-62
WP_038619029.1|466585_467521_-|plate	baseplate J/gp47 family protein	plate	A0A077K9X9	Ralstonia_phage	54.2	5.8e-77
WP_038619027.1|467517_467889_-	GPW/gp25 family protein	NA	A4PE42	Ralstonia_virus	55.3	9.2e-26
WP_038619020.1|467885_468521_-|plate	phage baseplate assembly protein V	plate	A4PE41	Ralstonia_virus	45.9	2.3e-40
WP_038619018.1|468591_469044_-	phage virion morphogenesis protein	NA	A0A1S5NPT5	Burkholderia_phage	54.0	7.0e-36
WP_038619015.1|469046_469496_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	46.2	1.2e-27
WP_115344426.1|469492_470005_-	hypothetical protein	NA	A0A1S5NQ26	Burkholderia_phage	52.8	1.1e-29
WP_038619013.1|470001_470817_-	N-acetylmuramidase family protein	NA	A0A077K808	Ralstonia_phage	63.6	3.0e-85
WP_038619011.1|470800_471124_-|holin	phage holin family protein	holin	A0A077KER0	Ralstonia_phage	53.9	3.9e-20
WP_038619009.1|471120_471495_-|holin	phage holin family protein	holin	E5E3R9	Burkholderia_phage	59.7	2.6e-28
WP_038619007.1|471497_471701_-|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	63.6	3.5e-19
WP_038619005.1|471700_472183_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	47.3	1.8e-29
WP_038619003.1|472283_472967_-	hypothetical protein	NA	A0A077K804	Ralstonia_phage	49.6	3.4e-50
WP_038619000.1|472969_473980_-|capsid	phage major capsid protein, P2 family	capsid	E5FFI6	Burkholderia_phage	67.6	1.9e-134
WP_038618997.1|474031_474910_-|capsid	GPO family capsid scaffolding protein	capsid	E5E3S5	Burkholderia_phage	49.3	3.8e-62
WP_038621740.1|475052_476825_+|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	68.9	1.2e-235
WP_038618994.1|476821_477880_+|portal	phage portal protein	portal	A0A077K9Q8	Ralstonia_phage	69.5	6.7e-138
WP_147291585.1|477888_478134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038618988.1|479052_479646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147291584.1|479732_479942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038618982.1|480933_481896_-	DUF932 domain-containing protein	NA	A0A218M383	Acidovorax_phage	39.3	6.1e-53
480076:480121	attR	TTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCCGGCACCAA	NA	NA	NA	NA
WP_038621737.1|481987_482422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038618976.1|483402_483594_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_038618973.1|483597_484005_+	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	52.0	9.1e-35
WP_038618970.1|483997_485185_+	DNA cytosine methyltransferase	NA	A7XXH6	Thermus_virus	29.3	1.1e-27
WP_038618967.1|485206_487555_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_038618964.1|487556_489233_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	29.1	6.9e-28
WP_038618963.1|489229_489766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052408617.1|489931_491944_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_038618960.1|491983_492292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038618959.1|492988_493774_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	57.3	3.4e-78
WP_038618958.1|493770_494787_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	44.9	1.9e-73
>prophage 2
NZ_CP009553	Pandoraea pnomenusa strain DSM 16536 chromosome, complete genome	5389285	1802004	1845765	5389285	transposase,protease	Bacillus_phage(27.27%)	30	NA	NA
WP_038618142.1|1802004_1803879_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	42.4	4.6e-113
WP_024788457.1|1804204_1805095_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	33.0	3.0e-22
WP_023595188.1|1805268_1806612_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_023595189.1|1807187_1808222_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A222YW41	Synechococcus_phage	36.8	2.8e-48
WP_038618137.1|1808358_1809333_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_038618135.1|1809332_1810229_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_023595192.1|1810295_1811078_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	2.6e-14
WP_023595193.1|1811100_1811808_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_023595194.1|1811841_1812546_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	39.7	2.4e-35
WP_038618131.1|1812652_1813978_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.8	2.5e-33
WP_048806394.1|1814017_1816132_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_023871783.1|1816284_1817799_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_023595198.1|1817927_1818755_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023871781.1|1818964_1819441_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_023871780.1|1819871_1821641_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_048806393.1|1822034_1831154_+	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.1	8.6e-32
WP_081326841.1|1831153_1831462_+	DUF3630 family protein	NA	NA	NA	NA	NA
WP_115344378.1|1831626_1832864_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	98.2	3.9e-161
WP_052408610.1|1833526_1835167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023595207.1|1835895_1836063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069106822.1|1836098_1836425_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_038618124.1|1836393_1837179_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	57.6	3.1e-79
WP_169834586.1|1837557_1838756_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	64.5	1.1e-101
WP_144347290.1|1840028_1840358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023595209.1|1840511_1841267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038618117.1|1841317_1841527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048806392.1|1841617_1842436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115344375.1|1842631_1843721_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.8	8.1e-46
WP_147291574.1|1843807_1844269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115344373.1|1844662_1845765_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP009553	Pandoraea pnomenusa strain DSM 16536 chromosome, complete genome	5389285	3168199	3175399	5389285	holin,plate	Burkholderia_virus(33.33%)	12	NA	NA
WP_052408596.1|3168199_3168583_-	DUF1353 domain-containing protein	NA	A0A1L2CVI8	Pectobacterium_phage	45.0	3.6e-17
WP_155765753.1|3168579_3168972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147291555.1|3169037_3169250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038617151.1|3169329_3169527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147291554.1|3169600_3170260_-	hypothetical protein	NA	I6WLM5	Burkholderia_virus	44.9	1.2e-39
WP_038617145.1|3170312_3170822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038617144.1|3170826_3171123_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	53.9	1.8e-19
WP_038617141.1|3171137_3171668_-	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	55.7	1.8e-43
WP_038617139.1|3171694_3172201_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_147291553.1|3172211_3173588_-	hypothetical protein	NA	H8ZLV3	Pseudomonas_phage	39.2	2.0e-09
WP_038620882.1|3173603_3174278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038620879.1|3174274_3175399_-|plate	baseplate J/gp47 family protein	plate	B3GAJ9	uncultured_virus	44.8	9.2e-61
>prophage 4
NZ_CP009553	Pandoraea pnomenusa strain DSM 16536 chromosome, complete genome	5389285	3186427	3198007	5389285	coat,terminase	Pseudomonas_phage(22.22%)	15	NA	NA
WP_081327008.1|3186427_3187570_-|coat	P22 coat - protein 5 family protein	coat	W6EBZ8	Rhizobium_phage	53.9	3.1e-96
WP_038620845.1|3187783_3188557_-	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	53.1	2.7e-51
WP_038620842.1|3188692_3190081_-	DUF4055 domain-containing protein	NA	A0A0S2SYJ5	Pseudomonas_phage	45.2	4.3e-100
WP_115344660.1|3190094_3191348_-|terminase	terminase	terminase	A0A2R3UAD4	Siphoviridae_environmental_samples	69.4	1.0e-164
WP_115344510.1|3191361_3191844_-	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	43.6	2.1e-22
WP_038620835.1|3191977_3193351_-	chromosome partitioning protein ParB	NA	R4THK0	Halovirus	41.6	2.0e-86
WP_058371660.1|3193490_3193841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038620832.1|3194077_3194269_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	53.3	5.6e-11
WP_038620831.1|3194265_3194661_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_038620829.1|3194683_3194935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048806609.1|3195036_3195663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038622431.1|3195695_3196166_-	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	57.7	2.1e-43
WP_058371661.1|3196162_3196366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048806608.1|3196368_3197145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081326897.1|3197095_3198007_-	YdaU family protein	NA	A8HP60	Thalassomonas_phage	39.6	1.2e-13
>prophage 5
NZ_CP009553	Pandoraea pnomenusa strain DSM 16536 chromosome, complete genome	5389285	3204983	3213602	5389285		Pseudomonas_phage(57.14%)	8	NA	NA
WP_038620807.1|3204983_3205790_+	PD-(D/E)XK nuclease family protein	NA	J7HXJ4	Pseudomonas_phage	59.8	3.0e-90
WP_038620804.1|3205799_3206918_+	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	57.5	2.4e-69
WP_038620801.1|3207033_3207894_+	cell division protein FtsK	NA	J7I0T4	Pseudomonas_phage	37.3	1.6e-33
WP_038620798.1|3207898_3209638_+	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	39.0	3.4e-86
WP_038620796.1|3209634_3210549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052408641.1|3210548_3211370_+	hypothetical protein	NA	R9TN97	Rhizobium_phage	63.8	5.4e-18
WP_038620795.1|3211605_3212439_+	DNA adenine methylase	NA	A0A0K1LM14	Caulobacter_phage	52.1	7.0e-74
WP_038622417.1|3212444_3213602_+	DNA (cytosine-5-)-methyltransferase	NA	Q6V7R9	Burkholderia_virus	43.1	4.4e-66
>prophage 6
NZ_CP009553	Pandoraea pnomenusa strain DSM 16536 chromosome, complete genome	5389285	4351987	4454003	5389285	tail,terminase,transposase,head,capsid,protease,portal,plate,integrase	Burkholderia_phage(29.41%)	91	4416906:4416952	4454067:4454113
WP_038620084.1|4351987_4353238_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.7	1.5e-40
WP_147291601.1|4353318_4353639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081326944.1|4353642_4354029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038620081.1|4353962_4354997_-	DUF637 domain-containing protein	NA	NA	NA	NA	NA
WP_115344478.1|4355055_4356241_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	3.2e-48
WP_038620077.1|4356351_4356984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147291600.1|4357164_4357584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081214899.1|4358845_4359652_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	45.4	3.0e-37
WP_115344476.1|4360170_4361408_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	89.8	9.3e-147
WP_025249736.1|4361518_4361911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115344473.1|4362182_4363284_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_058371696.1|4363655_4375400_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	29.2	4.0e-21
WP_115344630.1|4375593_4376445_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_038620069.1|4376584_4378381_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_081326946.1|4378377_4380543_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	25.3	4.1e-17
WP_038620066.1|4381041_4381677_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_115344471.1|4381694_4382570_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048806837.1|4382637_4383564_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_081326947.1|4383919_4385194_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023873229.1|4385265_4386144_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_038620059.1|4386140_4388738_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	28.1	7.0e-11
WP_038620056.1|4388734_4390384_+	gamma-glutamyltransferase family protein	NA	NA	NA	NA	NA
WP_038620053.1|4390471_4391263_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_023873224.1|4391329_4392670_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.1	1.1e-15
WP_036642116.1|4392666_4393056_-	phosphonate transporter	NA	NA	NA	NA	NA
WP_038620049.1|4393401_4394205_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_038620046.1|4394494_4396363_+	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_038620044.1|4396366_4397326_+	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_038620041.1|4397341_4398127_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_038620038.1|4398235_4399513_+	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_023873211.1|4399623_4400502_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_038620036.1|4400479_4401844_-	MFS transporter	NA	NA	NA	NA	NA
WP_048806529.1|4401882_4402740_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_028731230.1|4404087_4404972_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048806528.1|4405037_4406429_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_038620032.1|4406540_4407461_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160117968.1|4407428_4408235_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_025249775.1|4408323_4409529_-	porin	NA	NA	NA	NA	NA
WP_028731227.1|4409625_4410951_-	MFS transporter	NA	NA	NA	NA	NA
WP_048806526.1|4410998_4411850_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_115344469.1|4412386_4413494_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_147291599.1|4413720_4414755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081256068.1|4415767_4416523_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	75.5	1.5e-102
4416906:4416952	attL	GGTGGCGGAGAGAGGGGGATTCGAACCCCCGATAGGCTATTAACCTA	NA	NA	NA	NA
WP_038620013.1|4417069_4417525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038620010.1|4417905_4418310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038620008.1|4418922_4419714_-	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	75.7	3.4e-118
WP_147291598.1|4419895_4420597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147291597.1|4420858_4421266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038620001.1|4421252_4421654_-	hypothetical protein	NA	R4JJW4	Burkholderia_phage	53.0	2.2e-25
WP_038619998.1|4421632_4422079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038619995.1|4422080_4422614_-	glycoside hydrolase family 19 protein	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	52.9	4.4e-37
WP_038619992.1|4422669_4422858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038619989.1|4422869_4423823_-	hypothetical protein	NA	Q6QI97	Burkholderia_phage	34.3	3.1e-25
WP_038619986.1|4423832_4424429_-	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	54.6	1.7e-53
WP_038619984.1|4424419_4425472_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	48.6	1.6e-83
WP_038619981.1|4425461_4425866_-	phage GP46 family protein	NA	B5TK74	Pseudomonas_phage	55.6	6.5e-33
WP_038619978.1|4425862_4426402_-|plate	phage baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	38.7	2.1e-18
WP_038619975.1|4426401_4427520_-|plate	baseplate protein	plate	B5TK72	Pseudomonas_phage	50.1	1.1e-95
WP_038619973.1|4427521_4428739_-	DNA circularization N-terminal domain-containing protein	NA	S5FUX4	Shigella_phage	32.7	7.9e-42
WP_038619970.1|4428753_4430589_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	52.0	2.1e-118
WP_048806524.1|4430718_4431249_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	36.8	6.8e-06
WP_038619967.1|4431239_4431587_-|tail	phage tail tube protein	tail	B5TK68	Pseudomonas_phage	63.2	1.1e-36
WP_038619964.1|4431650_4433144_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	57.4	1.8e-160
WP_038619960.1|4433140_4433335_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	59.5	2.5e-06
WP_038619957.1|4433334_4433925_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	37.9	2.5e-25
WP_038619953.1|4433933_4434371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038619950.1|4434360_4434717_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_052408627.1|4434713_4435298_-|head,tail	phage head-tail connector protein	head,tail	C7BGH1	Burkholderia_phage	46.4	2.5e-41
WP_038619947.1|4435358_4436612_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	61.8	2.2e-143
WP_038619944.1|4436681_4437476_-|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	64.9	6.5e-77
WP_038619941.1|4437441_4438743_-|portal	phage portal protein	portal	C7BGG8	Burkholderia_phage	54.0	2.4e-137
WP_174234925.1|4438739_4440593_-|terminase	terminase large subunit	terminase	C7BGG7	Burkholderia_phage	74.6	2.7e-251
WP_038619935.1|4441177_4441549_-	HNH endonuclease	NA	C7BGG5	Burkholderia_phage	65.6	3.5e-41
WP_147291596.1|4441819_4442248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069106845.1|4442244_4442694_-	hypothetical protein	NA	A0A077KB11	Edwardsiella_phage	47.9	3.8e-18
WP_058371699.1|4442768_4443287_-	helix-turn-helix domain-containing protein	NA	R9TP35	Vibrio_phage	31.0	1.7e-09
WP_038619931.1|4443298_4444672_-	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	49.9	1.0e-122
WP_038619929.1|4444698_4444923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058371700.1|4444952_4445483_-	phage regulatory CII family protein	NA	NA	NA	NA	NA
WP_058371701.1|4445970_4446657_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155765762.1|4447033_4447177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038619919.1|4447282_4447489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052408626.1|4448030_4448516_+	PRTRC system protein E	NA	NA	NA	NA	NA
WP_081326949.1|4448543_4448936_+	PRTRC system protein C	NA	NA	NA	NA	NA
WP_038619916.1|4449117_4450107_+	PRTRC system protein F	NA	NA	NA	NA	NA
WP_038619913.1|4450103_4450820_+	PRTRC system protein B	NA	NA	NA	NA	NA
WP_038619910.1|4450819_4451623_+	PRTRC system protein A	NA	NA	NA	NA	NA
WP_038619907.1|4451612_4451912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038619904.1|4451908_4452709_+	PRTRC system ThiF family protein	NA	NA	NA	NA	NA
WP_038619901.1|4452717_4452933_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_174234924.1|4452932_4454003_+|integrase	integrase	integrase	NA	NA	NA	NA
4454067:4454113	attR	GGTGGCGGAGAGAGGGGGATTCGAACCCCCGATAGGCTATTAACCTA	NA	NA	NA	NA
