The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009746	Bacillus mycoides strain WSBC10204 chromosome, complete genome	5608349	371654	468151	5608349	portal,head,capsid,tail,coat,integrase,terminase,plate,protease,tRNA	Bacillus_phage(37.25%)	105	375825:375842	447216:447233
WP_000472285.1|371654_372914_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.3	7.7e-149
WP_002034202.1|373020_374691_+|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.5	6.7e-15
WP_002034201.1|374876_377207_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.4	1.9e-177
375825:375842	attL	GAAGAAATTTTAAATAAA	NA	NA	NA	NA
WP_002088829.1|377203_377800_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002034200.1|377835_378252_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_002034199.1|378254_378707_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002034196.1|379124_380456_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002015354.1|380473_381307_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_002034194.1|381322_382252_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_002088828.1|382254_383007_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_002015358.1|383179_384169_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_002034163.1|384168_385458_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	35.2	1.3e-05
WP_002034164.1|385537_386545_+	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_002190786.1|386617_387643_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_002129263.1|388047_390693_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	43.0	2.8e-164
WP_002034167.1|390787_392089_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_033709450.1|392253_393216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012261761.1|393435_394011_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016102998.1|394061_394460_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_002034171.1|394463_395855_-	recombinase family protein	NA	A0A2H4JFH9	uncultured_Caudovirales_phage	79.3	2.4e-212
WP_033709452.1|395927_396614_-	LexA family transcriptional regulator	NA	A0A2H4JDE4	uncultured_Caudovirales_phage	72.4	6.8e-91
WP_033709453.1|396756_396984_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JEY2	uncultured_Caudovirales_phage	73.3	3.1e-24
WP_002034175.1|396989_397154_+	hypothetical protein	NA	A0A2H4J841	uncultured_Caudovirales_phage	72.2	6.3e-11
WP_002034177.1|397296_397452_+	hypothetical protein	NA	A0A0S2MVC5	Bacillus_phage	90.2	3.1e-20
WP_002034178.1|397490_398333_+	ORF6C domain-containing protein	NA	A0A0S2MV65	Bacillus_phage	76.8	2.7e-113
WP_002034180.1|398344_398536_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	52.5	1.1e-09
WP_033709454.1|398577_398772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002034183.1|398929_399106_+	hypothetical protein	NA	A0A1B1P7U0	Bacillus_phage	84.5	2.5e-21
WP_033709455.1|399110_399977_+	phage protein	NA	A0A0U3TZZ4	Bacillus_phage	85.5	2.0e-116
WP_033709456.1|399912_400782_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	72.1	9.8e-103
WP_033709458.1|400887_401247_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	51.7	3.2e-31
WP_002034191.1|401265_401430_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	67.9	1.3e-13
WP_016101432.1|403116_403419_+	hypothetical protein	NA	A0A0U3K3K8	Bacillus_phage	87.2	4.8e-33
WP_002035284.1|403493_403880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002035283.1|404023_404146_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_033709695.1|404260_404431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002035281.1|404457_404940_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	84.3	7.7e-73
WP_002035280.1|404939_405482_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	90.6	2.8e-87
WP_002035278.1|405742_405937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002035277.1|405940_406501_+	GNAT family N-acetyltransferase	NA	A0A0M3ULL7	Bacillus_phage	56.9	2.4e-49
WP_154214161.1|407046_407223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016103016.1|407446_407668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016103017.1|407664_407964_-	hypothetical protein	NA	H0USU6	Bacillus_phage	54.5	4.1e-24
WP_033709693.1|408392_408806_+	HNH endonuclease	NA	Q8SBK4	Clostridium_phage	40.1	1.5e-21
WP_033709692.1|408905_409400_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	59.1	3.5e-49
WP_002035269.1|409409_411125_+|terminase	terminase large subunit	terminase	A0A0A7RVS5	Clostridium_phage	61.4	8.7e-212
WP_002035268.1|411138_412380_+|portal	phage portal protein	portal	A6M949	Geobacillus_virus	52.2	1.2e-125
WP_033709889.1|412360_413053_+|protease	Clp protease ClpP	protease	A0A0A7RTN2	Clostridium_phage	57.3	1.6e-71
WP_002035265.1|413092_414250_+|capsid	phage major capsid protein	capsid	A0A2H4JHG1	uncultured_Caudovirales_phage	63.2	6.2e-129
WP_002035264.1|414290_414584_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0A7S0C9	Clostridium_phage	39.6	2.1e-12
WP_033709691.1|414580_414928_+|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	67.8	2.1e-40
WP_002035263.1|414915_415353_+	hypothetical protein	NA	A0A2H4JBV5	uncultured_Caudovirales_phage	78.6	6.5e-63
WP_033709689.1|415349_415712_+	DUF3168 domain-containing protein	NA	A0A2H4JBW1	uncultured_Caudovirales_phage	85.8	8.3e-56
WP_002035261.1|415727_416306_+|tail	tail protein	tail	A0A2H4JET9	uncultured_Caudovirales_phage	89.8	7.2e-94
WP_033709688.1|416377_416773_+	hypothetical protein	NA	A0A1B1P7S9	Bacillus_phage	82.2	2.7e-44
WP_033709888.1|416790_416931_+	hypothetical protein	NA	A0A1B1P7R9	Bacillus_phage	87.0	2.1e-15
WP_033709686.1|418553_422381_+|tail	phage tail tape measure protein	tail	A0A1B1P7S6	Bacillus_phage	79.1	0.0e+00
WP_033709685.1|422377_423250_+|tail	phage tail family protein	tail	A0A0K2CZA8	Paenibacillus_phage	31.4	2.8e-33
WP_033709683.1|423277_424129_+	hypothetical protein	NA	A0A0C5ABC3	Paenibacillus_phage	34.2	1.5e-18
WP_002035250.1|424143_425265_+	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K2CZQ1	Paenibacillus_phage	38.0	1.0e-59
WP_080683293.1|425306_428351_+|plate	BppU family phage baseplate upper protein	plate	B5LPS6	Bacillus_virus	47.7	1.2e-35
WP_033727250.1|428362_428632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033727249.1|428633_428825_+	XkdX family protein	NA	NA	NA	NA	NA
WP_033727248.1|428948_429158_+	hemolysin XhlA family protein	NA	A0A1B2APY8	Phage_Wrath	84.8	7.0e-23
WP_002035299.1|429161_429371_+	hypothetical protein	NA	A0A1B2APX7	Phage_Wrath	91.3	6.3e-32
WP_038625534.1|429367_430423_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6C8	Bacillus_phage	80.9	2.9e-165
WP_165570774.1|430538_430706_+	hypothetical protein	NA	A0A2H4J852	uncultured_Caudovirales_phage	69.1	9.2e-10
WP_002033635.1|430957_431197_+	helix-turn-helix domain-containing protein	NA	A0A2H4JBQ8	uncultured_Caudovirales_phage	91.1	2.1e-31
WP_002034142.1|431901_432810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002034143.1|433063_433897_-	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	82.5	1.2e-121
WP_002015369.1|434565_435585_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_002129256.1|435626_436478_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002015371.1|436492_437038_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002034146.1|437073_437760_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000503308.1|437762_438560_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002034147.1|438693_439440_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002088816.1|439432_440293_+	M50 family metallopeptidase	NA	NA	NA	NA	NA
WP_002034148.1|440335_441745_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000270907.1|441915_442224_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_033709443.1|442235_442580_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000944957.1|442583_442874_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002015377.1|442937_443486_+	sporulation initiation phosphotransferase B	NA	NA	NA	NA	NA
WP_002015378.1|443485_444769_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_002034150.1|444940_445648_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	1.3e-23
WP_033707976.1|445637_446720_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000114530.1|446813_447590_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.6e-19
447216:447233	attR	GAAGAAATTTTAAATAAA	NA	NA	NA	NA
WP_033709445.1|447564_449487_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_033709446.1|449536_451450_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002034155.1|451547_452399_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_002034156.1|452501_453149_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_002034157.1|453233_453776_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002034158.1|453775_454918_-	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	30.4	1.7e-33
WP_002067402.1|455071_456601_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_002034160.1|456620_457454_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_002034162.1|457484_458591_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_038625549.1|458815_460564_+|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_002034140.1|460744_461392_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_002129237.1|461424_461859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002034126.1|462446_462962_+	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002034128.1|462972_463917_-	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002088786.1|464105_464723_+	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_000344470.1|464728_465730_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	4.0e-07
WP_000138162.1|465726_465927_+	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_002129232.1|465946_466999_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002015319.1|467011_468151_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	41.8	3.3e-82
>prophage 2
NZ_CP009746	Bacillus mycoides strain WSBC10204 chromosome, complete genome	5608349	2870406	2879233	5608349		Bacillus_phage(71.43%)	8	NA	NA
WP_002031365.1|2870406_2871285_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.4	1.1e-64
WP_016103188.1|2871418_2872090_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	92.0	6.3e-65
WP_002012353.1|2872239_2872959_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_033709002.1|2873127_2874201_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	86.3	1.1e-167
WP_002031358.1|2874197_2874875_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	91.1	1.6e-116
WP_002031356.1|2874961_2876722_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	94.5	1.8e-265
WP_002135756.1|2876997_2877762_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002031352.1|2877928_2879233_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	27.6	1.5e-09
>prophage 3
NZ_CP009746	Bacillus mycoides strain WSBC10204 chromosome, complete genome	5608349	5051592	5226854	5608349	protease,transposase,integrase	Bacillus_phage(24.24%)	104	5051527:5051546	5164065:5164083
5051527:5051546	attL	AAGGGTTCTGGTGCAAAGAT	NA	NA	NA	NA
WP_033727759.1|5051592_5052300_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	9.3e-51
5051527:5051546	attL	AAGGGTTCTGGTGCAAAGAT	NA	NA	NA	NA
WP_157632125.1|5052572_5052698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002035043.1|5052720_5053983_+	MFS transporter	NA	NA	NA	NA	NA
WP_033709618.1|5053997_5058554_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.0	1.1e-91
WP_002035041.1|5058556_5065027_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.8	3.2e-190
WP_033709617.1|5065023_5079930_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	28.3	2.0e-174
WP_174411859.1|5080430_5081027_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_002035038.1|5081043_5081766_+	thioesterase	NA	NA	NA	NA	NA
WP_002035037.1|5082299_5082491_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002035452.1|5083543_5083912_+	DUF898 family protein	NA	S5MNN8	Brevibacillus_phage	72.9	1.2e-14
WP_016097046.1|5084529_5084721_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	63.6	6.0e-13
WP_002035450.1|5085267_5085618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002035449.1|5085857_5086355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002035448.1|5086507_5087581_+	tyrosine recombinase XerS	NA	A0A0K2CP59	Brevibacillus_phage	25.2	5.1e-08
WP_002035446.1|5089018_5089624_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033709742.1|5089969_5091202_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_002035444.1|5091330_5092476_-	DUF3965 domain-containing protein	NA	NA	NA	NA	NA
WP_002035442.1|5093506_5094685_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_033709741.1|5095459_5095915_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_033709739.1|5096432_5097875_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016102407.1|5099174_5099570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002035434.1|5100743_5101211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080683324.1|5101977_5102736_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_002035342.1|5103866_5104676_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_033709716.1|5105914_5108809_-	collagenase ColA	NA	NA	NA	NA	NA
WP_033709898.1|5109109_5110507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033709717.1|5114715_5115201_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_106389204.1|5115557_5115680_-	DUF4030 domain-containing protein	NA	NA	NA	NA	NA
WP_002035348.1|5115686_5115824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002035306.1|5117245_5118418_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.8	1.8e-06
WP_002035305.1|5118822_5119827_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002035304.1|5120629_5120998_-	response regulator	NA	W8CYM9	Bacillus_phage	36.3	1.7e-11
WP_002035212.1|5122355_5123084_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	28.3	7.9e-05
WP_016102423.1|5123090_5123453_+	DUF2304 domain-containing protein	NA	NA	NA	NA	NA
WP_033727764.1|5124980_5127227_-	cell wall-binding protein	NA	NA	NA	NA	NA
WP_179945401.1|5128022_5128256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002035060.1|5128732_5129275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002035062.1|5130574_5130967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165570776.1|5131129_5131303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033709621.1|5132932_5133538_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
5131822:5131841	attR	ATCTTTGCACCAGAACCCTT	NA	NA	NA	NA
WP_033709622.1|5133976_5134405_-	DUF5412 domain-containing protein	NA	NA	NA	NA	NA
5131822:5131841	attR	ATCTTTGCACCAGAACCCTT	NA	NA	NA	NA
WP_033709624.1|5134600_5134870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033709864.1|5135267_5135975_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	40.1	1.3e-39
WP_002035070.1|5136110_5137268_-	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_002035071.1|5137542_5138700_-	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_002035072.1|5138740_5139910_-	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_002035073.1|5141044_5141272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033709625.1|5141807_5142494_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	61.8	7.1e-72
WP_002035076.1|5142679_5143942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106389203.1|5144318_5144690_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	26.6	1.8e-05
WP_080751841.1|5145566_5146997_+|transposase	IS4-like element ISBce2 family transposase	transposase	NA	NA	NA	NA
WP_033727853.1|5147644_5148772_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	77.3	1.8e-165
WP_033727848.1|5148742_5149012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002035124.1|5150568_5151561_+	zinc dependent phospholipase C family protein	NA	NA	NA	NA	NA
WP_125930132.1|5151573_5151909_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N9SIX5	Staphylococcus_phage	48.6	1.1e-09
WP_002035126.1|5152330_5153197_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	28.3	8.5e-22
WP_002035128.1|5153664_5154777_-	helix-turn-helix domain-containing protein	NA	A0A286QQB7	Streptococcus_phage	45.2	5.1e-80
WP_016102597.1|5154788_5155187_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	65.9	9.8e-50
WP_106389214.1|5158990_5159881_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_106389213.1|5159899_5160301_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_080683338.1|5160396_5160579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002035230.1|5161536_5162064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080751842.1|5164278_5165823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157632123.1|5166211_5166355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080751843.1|5166424_5167696_-	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	40.2	8.9e-44
WP_038626779.1|5168003_5170721_-	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	33.3	1.3e-76
WP_033709664.1|5171766_5172135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002035196.1|5172140_5172593_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002035199.1|5175772_5176303_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	32.9	1.3e-12
WP_002035200.1|5177026_5177452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033709666.1|5177955_5179014_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	9.7e-28
WP_002035388.1|5181074_5182040_-	sporulation protein	NA	NA	NA	NA	NA
WP_174411860.1|5185692_5186664_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_002035398.1|5187844_5188336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002035399.1|5188440_5188605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033709725.1|5188680_5188947_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002035401.1|5189219_5189426_+|transposase	transposase	transposase	A0A0N9RU54	Staphylococcus_phage	59.2	3.3e-09
WP_033709726.1|5189583_5190147_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_002035405.1|5190784_5192509_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.5	2.3e-175
WP_002035406.1|5192569_5193388_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002035412.1|5194423_5196466_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_002035413.1|5196507_5197893_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	28.4	2.9e-40
WP_002035414.1|5197941_5199264_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	44.0	5.2e-95
WP_033709729.1|5199293_5200541_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_033709730.1|5200537_5201107_-	colanic acid biosynthesis acetyltransferase WcaF	NA	NA	NA	NA	NA
WP_002035417.1|5201099_5201738_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	39.3	1.6e-14
WP_033709731.1|5201739_5202666_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_033709733.1|5202768_5203662_-	hypothetical protein	NA	A0A167RG70	Powai_lake_megavirus	29.9	9.6e-29
WP_002035421.1|5203658_5205074_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_002035422.1|5205202_5206570_-	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_002035424.1|5206877_5207954_-	GDP-mannose 4,6-dehydratase	NA	A0A0E3I398	Synechococcus_phage	65.3	4.2e-127
WP_002035425.1|5207989_5208934_-	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	56.2	2.6e-101
WP_002035426.1|5208952_5209633_-	sugar transferase	NA	NA	NA	NA	NA
WP_002035427.1|5209650_5210532_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	53.8	4.8e-81
WP_002035428.1|5210773_5211541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033709734.1|5211647_5212355_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_033709735.1|5212344_5213085_-	capsular biosynthesis protein	NA	A0A1X9I5E1	Streptococcus_phage	34.4	7.5e-19
WP_016105611.1|5214156_5214774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002035131.1|5215817_5216510_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_002035132.1|5216696_5218016_-	DUF1727 domain-containing protein	NA	NA	NA	NA	NA
WP_002035136.1|5219474_5221199_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033709644.1|5222299_5224000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002035138.1|5224993_5225503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033709868.1|5225726_5226854_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.3	7.6e-172
>prophage 4
NZ_CP009746	Bacillus mycoides strain WSBC10204 chromosome, complete genome	5608349	5542606	5554748	5608349		uncultured_virus(25.0%)	9	NA	NA
WP_002009985.1|5542606_5542891_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	4.4e-20
WP_002029451.1|5542928_5544563_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	2.2e-156
WP_165570779.1|5544966_5546508_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	4.4e-21
WP_002029453.1|5546893_5548219_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.4	5.8e-46
WP_002029454.1|5548364_5549066_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_002140173.1|5549049_5550555_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	1.6e-31
WP_002009610.1|5550743_5551745_-	YaaC family protein	NA	NA	NA	NA	NA
WP_002107266.1|5551860_5553324_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.5	7.4e-95
WP_125930156.1|5553437_5554748_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.4	3.5e-19
