The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	0	13434	5064681		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_032948438.1|44_4973_+	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	21.3	1.8e-28
WP_032948439.1|4972_11314_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.9	5.8e-59
WP_032728811.1|11310_13434_+	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	24.8	2.4e-09
>prophage 2
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	20377	21546	5064681	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_100216202.1|20377_21546_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
>prophage 3
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	36296	43134	5064681		Ostreococcus_tauri_virus(33.33%)	7	NA	NA
WP_032948455.1|36296_37772_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.6	4.5e-47
WP_032948456.1|37904_38678_+	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_008322159.1|39326_39530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322158.1|39722_40730_+	porin	NA	Q1MVN1	Enterobacteria_phage	49.7	8.2e-85
WP_032948457.1|40792_41194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032948458.1|41384_42572_-	MFS transporter	NA	NA	NA	NA	NA
WP_003837181.1|42669_43134_-	GNAT family N-acetyltransferase	NA	A0A1E1GE54	Vibrio_phage	35.1	1.4e-15
>prophage 4
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	51495	52458	5064681	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_032948463.1|51495_52458_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.2	3.5e-69
>prophage 5
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	60832	62494	5064681		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003019155.1|60832_62494_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 6
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	65772	68254	5064681		Tupanvirus(50.0%)	2	NA	NA
WP_032948468.1|65772_66795_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.0	3.9e-10
WP_032948469.1|66808_68254_+	tagaturonate reductase	NA	G8DCZ3	Micromonas_pusilla_virus	26.2	1.1e-18
>prophage 7
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	71382	72662	5064681		Shigella_phage(50.0%)	2	NA	NA
WP_003019133.1|71382_72120_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	2.9e-63
WP_003019130.1|72122_72662_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	61.7	4.9e-28
>prophage 8
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	79004	80081	5064681		Bacillus_phage(100.0%)	1	NA	NA
WP_047388994.1|79004_80081_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.2	1.5e-20
>prophage 9
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	83904	86709	5064681		Streptococcus_phage(50.0%)	3	NA	NA
WP_003019086.1|83904_85494_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.8	2.7e-29
WP_003019084.1|85802_86420_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_003019081.1|86547_86709_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	2.8e-11
>prophage 10
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	92252	93575	5064681		Geobacillus_virus(100.0%)	1	NA	NA
WP_003019040.1|92252_93575_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.3	4.4e-78
>prophage 11
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	100094	105361	5064681		Enterococcus_phage(33.33%)	3	NA	NA
WP_003019021.1|100094_101324_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	4.5e-85
WP_003019019.1|101424_103092_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	1.9e-41
WP_003019016.1|103423_105361_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.2	1.6e-12
>prophage 12
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	109300	110725	5064681		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_032948477.1|109300_110725_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.8	1.8e-08
>prophage 13
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	121923	122877	5064681		Synechococcus_phage(100.0%)	1	NA	NA
WP_003018974.1|121923_122877_+	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	34.4	1.3e-10
>prophage 14
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	127291	131806	5064681		Chrysochromulina_ericina_virus(33.33%)	3	NA	NA
WP_003018959.1|127291_129214_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.3	1.4e-146
WP_003837322.1|129299_130433_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	2.5e-29
WP_003018952.1|130639_131806_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.5	2.6e-90
>prophage 15
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	138272	141089	5064681	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_016149528.1|138272_141089_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.5	3.0e-76
>prophage 16
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	145537	146686	5064681		Halovirus(100.0%)	1	NA	NA
WP_003018918.1|145537_146686_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.4	2.2e-49
>prophage 17
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	152118	157751	5064681		Tupanvirus(50.0%)	4	NA	NA
WP_032948492.1|152118_153672_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2K9KZV5	Tupanvirus	21.8	1.2e-18
WP_003018901.1|153733_154951_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_032948493.1|155056_156199_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003018896.1|156233_157751_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	22.1	2.5e-08
>prophage 18
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	166081	167506	5064681		Bacillus_phage(50.0%)	2	NA	NA
WP_003018873.1|166081_166561_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	3.0e-29
WP_016149534.1|166657_167506_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	45.3	6.4e-06
>prophage 19
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	175234	180624	5064681		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_003837386.1|175234_178141_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	1.7e-21
WP_032948504.1|178272_180624_-	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.1	3.2e-15
>prophage 20
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	186900	187599	5064681		Bacillus_virus(100.0%)	1	NA	NA
WP_032948513.1|186900_187599_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	38.7	2.3e-22
>prophage 21
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	204058	205783	5064681		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_071993028.1|204058_205783_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.3	1.0e-34
>prophage 22
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	231802	232846	5064681		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_032948527.1|231802_232846_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.0	4.5e-102
>prophage 23
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	237148	237712	5064681		Thiobacimonas_phage(100.0%)	1	NA	NA
WP_047388998.1|237148_237712_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	32.5	6.1e-13
>prophage 24
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	248778	250203	5064681		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003018686.1|248778_250203_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 25
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	257719	263751	5064681		Mamastrovirus(25.0%)	5	NA	NA
WP_032948537.1|257719_259330_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.3	4.3e-19
WP_032948538.1|259514_261170_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.6	3.3e-14
WP_003018658.1|261421_261958_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	3.9e-17
WP_032948539.1|262027_262717_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_016149566.1|262824_263751_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	4.1e-22
>prophage 26
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	269199	276022	5064681	tRNA	Bacillus_virus(50.0%)	6	NA	NA
WP_071524282.1|269199_270618_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	35.9	5.5e-26
WP_016149569.1|270668_271565_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_003018625.1|271635_272091_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_003018622.1|272268_272973_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_003018620.1|272988_273519_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_032948544.1|273592_276022_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	29.7	1.3e-38
>prophage 27
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	286571	287369	5064681		Planktothrix_phage(100.0%)	1	NA	NA
WP_003845793.1|286571_287369_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	3.5e-14
>prophage 28
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	293263	293608	5064681		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_003018581.1|293263_293608_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	5.9e-27
>prophage 29
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	297610	299044	5064681	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003018567.1|297610_299044_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	2.1e-25
>prophage 30
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	310469	311228	5064681		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003018543.1|310469_311228_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	41.5	7.2e-25
>prophage 31
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	320041	324145	5064681		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_003845817.1|320041_320638_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	3.9e-26
WP_003018516.1|320662_324145_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	5.9e-207
>prophage 32
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	336165	337197	5064681		Planktothrix_phage(100.0%)	1	NA	NA
WP_003018468.1|336165_337197_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 33
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	343650	344454	5064681		Indivirus(100.0%)	1	NA	NA
WP_032948566.1|343650_344454_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.0	8.7e-37
>prophage 34
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	348498	352697	5064681		Lactobacillus_phage(33.33%)	5	NA	NA
WP_003031421.1|348498_349857_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	28.6	8.9e-10
WP_032948571.1|349928_350684_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003031413.1|350717_351440_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003031412.1|351436_351904_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	60.1	6.5e-53
WP_003031410.1|351968_352697_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.7	3.1e-41
>prophage 35
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	368289	371571	5064681		Caulobacter_phage(50.0%)	4	NA	NA
WP_003031390.1|368289_368871_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	5.7e-14
WP_003031388.1|368982_369750_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003843847.1|369720_370461_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_032948591.1|370809_371571_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.3e-18
>prophage 36
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	380110	383825	5064681		Streptococcus_phage(66.67%)	3	NA	NA
WP_003031375.1|380110_381166_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.5	2.5e-116
WP_003031373.1|381456_382560_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.6	2.6e-60
WP_003031370.1|382571_383825_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.9e-99
>prophage 37
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	397411	400579	5064681	holin	Pseudomonas_phage(50.0%)	2	NA	NA
WP_003031344.1|397411_397873_-	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	32.3	3.7e-08
WP_032939120.1|398581_400579_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	2.6e-21
>prophage 38
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	405279	411175	5064681	transposase	Yersinia_phage(33.33%)	4	NA	NA
WP_003847794.1|405279_406101_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	3.6e-46
WP_003847792.1|406193_407057_-	GTPase family protein	NA	NA	NA	NA	NA
WP_085954046.1|407753_408901_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	4.3e-146
WP_003847784.1|410023_411175_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
>prophage 39
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	414355	414796	5064681		Streptomyces_phage(100.0%)	1	NA	NA
WP_000786814.1|414355_414796_-	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	5.8e-11
>prophage 40
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	419184	424091	5064681		Ostreococcus_tauri_virus(50.0%)	3	NA	NA
WP_003847766.1|419184_420990_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	39.8	3.9e-93
WP_001446316.1|421050_421242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003847763.1|421241_424091_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	6.9e-129
>prophage 41
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	428024	429425	5064681		Bacillus_phage(100.0%)	1	NA	NA
WP_003029589.1|428024_429425_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.1	2.0e-20
>prophage 42
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	434784	439575	5064681	integrase	Stx2-converting_phage(50.0%)	6	434822:434835	444736:444749
WP_003029581.1|434784_435441_+	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	82.1	6.2e-09
434822:434835	attL	ATTATCCCGTTGAG	NA	NA	NA	NA
WP_003029579.1|435496_436117_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_003029576.1|436578_437343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072021787.1|437477_437699_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032296090.1|437695_438145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003029573.1|438267_439575_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	29.1	3.1e-07
444736:444749	attR	CTCAACGGGATAAT	NA	NA	NA	NA
>prophage 43
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	444609	445614	5064681		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032948601.1|444609_445614_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.0	1.4e-23
>prophage 44
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	467908	469021	5064681		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_032948622.1|467908_469021_-	agmatine deiminase family protein	NA	M1H3B1	Paramecium_bursaria_Chlorella_virus	35.4	9.8e-55
>prophage 45
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	477116	478022	5064681		Burkholderia_virus(100.0%)	1	NA	NA
WP_032948627.1|477116_478022_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.3	1.0e-14
>prophage 46
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	484755	485583	5064681		Planktothrix_phage(100.0%)	1	NA	NA
WP_003021286.1|484755_485583_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	2.7e-17
>prophage 47
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	499096	507306	5064681		Staphylococcus_phage(33.33%)	5	NA	NA
WP_032948641.1|499096_500983_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	4.1e-53
WP_032948642.1|501073_501685_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_003021333.1|501713_502967_-	MFS transporter	NA	NA	NA	NA	NA
WP_032948643.1|503018_506102_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	81.5	0.0e+00
WP_032948644.1|506223_507306_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	82.3	4.9e-160
>prophage 48
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	519210	521171	5064681		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_003838629.1|519210_520161_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	6.2e-34
WP_003021379.1|520157_521171_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	3.2e-44
>prophage 49
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	525158	526205	5064681		Bacillus_virus(100.0%)	1	NA	NA
WP_003021390.1|525158_526205_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	4.0e-34
>prophage 50
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	534265	535033	5064681		Planktothrix_phage(100.0%)	1	NA	NA
WP_032948663.1|534265_535033_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	3.3e-25
>prophage 51
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	551695	552811	5064681		Bacillus_phage(100.0%)	1	NA	NA
WP_100280288.1|551695_552811_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.6	5.3e-16
>prophage 52
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	556562	566415	5064681		Bacillus_phage(60.0%)	7	NA	NA
WP_003021479.1|556562_557474_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.3	2.7e-103
WP_032948674.1|557565_558474_+	fructokinase	NA	NA	NA	NA	NA
WP_032950792.1|558481_559654_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_032948677.1|559846_562990_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.4	1.7e-11
WP_032948679.1|562986_564189_-	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	25.3	2.5e-08
WP_003021496.1|564379_565069_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.9	2.0e-37
WP_003021498.1|565119_566415_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.3	2.4e-28
>prophage 53
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	578661	588270	5064681	tRNA	uncultured_Mediterranean_phage(50.0%)	11	NA	NA
WP_003021535.1|578661_579789_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	1.6e-89
WP_003021544.1|579811_580144_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_003021547.1|580171_582019_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003021550.1|582029_583001_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	1.4e-44
WP_003021554.1|583170_583536_+	VOC family protein	NA	NA	NA	NA	NA
WP_003021558.1|583559_584252_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	30.1	4.5e-18
WP_003021561.1|584297_585161_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_032950795.1|585459_585999_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_003021571.1|586152_586602_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_003021573.1|586605_587709_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	3.4e-52
WP_003021575.1|587799_588270_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	7.8e-30
>prophage 54
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	612202	617247	5064681	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_003021624.1|612202_612826_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_003831013.1|612952_614227_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
WP_003021627.1|614411_616766_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.6	5.5e-225
WP_003021629.1|616974_617247_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.5e-20
>prophage 55
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	620528	621224	5064681		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003021638.1|620528_621224_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	4.2e-88
>prophage 56
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	625760	629304	5064681		Bacillus_phage(100.0%)	2	NA	NA
WP_032948702.1|625760_627533_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	3.1e-47
WP_003021654.1|627525_629304_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	2.6e-41
>prophage 57
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	641501	644651	5064681		Leptospira_phage(100.0%)	1	NA	NA
WP_003021736.1|641501_644651_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.7	9.5e-55
>prophage 58
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	651570	660108	5064681		Klosneuvirus(25.0%)	8	NA	NA
WP_003021759.1|651570_652122_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.6	7.0e-30
WP_032948710.1|652240_654172_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	41.5	1.3e-43
WP_003021764.1|654229_654559_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003021767.1|654558_655164_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_032948711.1|655274_657149_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.4	2.0e-113
WP_003021773.1|657381_658026_+	adenylate kinase	NA	NA	NA	NA	NA
WP_003021775.1|658189_659152_+	ferrochelatase	NA	NA	NA	NA	NA
WP_032936962.1|659148_660108_-	acetyl esterase	NA	A0A167RJ59	Powai_lake_megavirus	28.5	4.2e-14
>prophage 59
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	668294	671715	5064681		uncultured_virus(50.0%)	2	NA	NA
WP_032948714.1|668294_670796_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	3.4e-116
WP_032948715.1|670944_671715_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.9	4.0e-15
>prophage 60
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	683266	683944	5064681		Bacillus_virus(100.0%)	1	NA	NA
WP_032948727.1|683266_683944_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	36.2	3.6e-28
>prophage 61
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	687094	687781	5064681		Planktothrix_phage(100.0%)	1	NA	NA
WP_003021853.1|687094_687781_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	7.9e-31
>prophage 62
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	692683	693700	5064681		Planktothrix_phage(100.0%)	1	NA	NA
WP_003835783.1|692683_693700_+	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	38.6	1.5e-33
>prophage 63
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	698739	701947	5064681	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_003831109.1|698739_700125_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	1.6e-46
WP_003021883.1|700216_700741_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003021885.1|700866_701079_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_003021887.1|701080_701947_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	1.2e-28
>prophage 64
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	711926	721829	5064681		Hokovirus(25.0%)	7	NA	NA
WP_071993029.1|711926_714692_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.6	2.4e-33
WP_032948738.1|714774_715806_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_032948739.1|715778_716471_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.4	1.4e-19
WP_003021915.1|716602_717781_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_032948740.1|717770_720311_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.5	1.3e-73
WP_032948741.1|720307_720922_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_003021923.1|721400_721829_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.0	3.3e-27
>prophage 65
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	728206	730331	5064681		Hokovirus(50.0%)	2	NA	NA
WP_032948747.1|728206_729658_-	Cu(+)/Ag(+) sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.8	3.0e-11
WP_003021940.1|729647_730331_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.6	6.0e-31
>prophage 66
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	733668	739280	5064681		Leptospira_phage(50.0%)	3	NA	NA
WP_032948752.1|733668_736812_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.0	2.7e-57
WP_003847476.1|736863_737718_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032948753.1|737954_739280_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.3	1.3e-106
>prophage 67
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	743149	752488	5064681		Escherichia_phage(100.0%)	1	NA	NA
WP_032948758.1|743149_752488_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	24.7	6.0e-12
>prophage 68
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	769713	777803	5064681		Tupanvirus(33.33%)	5	NA	NA
WP_032948770.1|769713_773604_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.8	1.1e-63
WP_032936904.1|773832_774966_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_003022023.1|775012_775810_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.0	6.4e-08
WP_003022026.1|775806_776799_-	iron-enterobactin ABC transporter permease	NA	NA	NA	NA	NA
WP_003835646.1|776795_777803_-	Fe(3+)-siderophore ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.0	2.2e-13
>prophage 69
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	795134	796960	5064681		uncultured_marine_virus(50.0%)	2	NA	NA
WP_003022071.1|795134_795752_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.3	6.0e-54
WP_032948783.1|795736_796960_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.8	1.2e-61
>prophage 70
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	800066	808902	5064681		Escherichia_phage(40.0%)	8	NA	NA
WP_032948785.1|800066_801632_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	3.2e-43
WP_032948786.1|801855_802410_+	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_032948787.1|802406_804683_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	25.0	7.6e-46
WP_032948789.1|804679_805237_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.7	6.2e-26
WP_032948791.1|805236_806004_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_003022101.1|806073_806502_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	1.1e-17
WP_003022104.1|806685_807096_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_003022107.1|808071_808902_+	alpha/beta hydrolase	NA	W8EHU1	Mycobacterium_phage	31.2	3.5e-17
>prophage 71
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	822073	824579	5064681	transposase	Escherichia_phage(33.33%)	4	NA	NA
WP_000019445.1|822073_823054_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_003835590.1|823181_823745_+	lipid IV(A) palmitoyltransferase PagP	NA	NA	NA	NA	NA
WP_000034825.1|823934_824144_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_003022693.1|824195_824579_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.6	7.5e-23
>prophage 72
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	828186	830650	5064681		Stx2-converting_phage(50.0%)	2	NA	NA
WP_003022711.1|828186_829398_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.9	9.8e-101
WP_003022715.1|829540_830650_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	54.8	6.2e-09
>prophage 73
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	838815	843990	5064681	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_100280293.1|838815_841398_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	2.5e-186
WP_003022748.1|841633_842116_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_032948812.1|842212_843148_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_003022754.1|843264_843990_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.1	1.1e-30
>prophage 74
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	849951	850998	5064681		Pseudomonas_phage(100.0%)	1	NA	NA
WP_032948815.1|849951_850998_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.2e-47
>prophage 75
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	855008	856673	5064681		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_003022785.1|855008_856673_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	3.6e-85
>prophage 76
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	861473	870804	5064681	tRNA	Vibrio_phage(25.0%)	7	NA	NA
WP_032948817.1|861473_863423_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	1.4e-08
WP_003022809.1|863609_865277_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	94.2	0.0e+00
WP_003022813.1|865712_867119_+	chitoporin	NA	NA	NA	NA	NA
WP_003022817.1|867168_867501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080685885.1|867552_868221_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	44.2	8.5e-38
WP_032948818.1|868274_869414_-	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_032948820.1|869400_870804_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.9	1.0e-08
>prophage 77
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	877069	877747	5064681		Bacillus_phage(100.0%)	1	NA	NA
WP_003022856.1|877069_877747_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	32.0	2.6e-26
>prophage 78
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	881013	883062	5064681		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003022864.1|881013_883062_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.7	3.7e-31
>prophage 79
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	886429	890467	5064681	transposase	Hokovirus(33.33%)	3	NA	NA
WP_032948837.1|886429_887848_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	34.0	2.7e-65
WP_032948838.1|888008_888935_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.8	5.4e-67
WP_032948839.1|888985_890467_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	27.3	2.3e-43
>prophage 80
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	896258	897050	5064681		Kaumoebavirus(100.0%)	1	NA	NA
WP_032948845.1|896258_897050_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.1	1.3e-08
>prophage 81
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	936837	940353	5064681		Vibrio_phage(33.33%)	4	NA	NA
WP_003022990.1|936837_937557_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.6	5.8e-24
WP_047389039.1|937553_938495_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.2	4.9e-23
WP_003837110.1|938608_938983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003022997.1|939300_940353_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	S4VUY9	Pandoravirus	47.3	1.7e-80
>prophage 82
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	948473	955039	5064681		Tupanvirus(33.33%)	7	NA	NA
WP_003023012.1|948473_949490_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.1	4.9e-77
WP_003023015.1|949707_951180_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.0	1.1e-10
WP_003023018.1|951247_952036_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003023026.1|952166_952316_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_032948872.1|952515_953289_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003023032.1|953288_953978_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003837092.1|953980_955039_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.8	2.6e-20
>prophage 83
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	969577	973017	5064681		Catovirus(50.0%)	3	NA	NA
WP_032948880.1|969577_971098_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.9	1.1e-80
WP_003845384.1|971193_971670_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_032948882.1|971727_973017_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.2	2.8e-21
>prophage 84
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	976683	981227	5064681		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003035181.1|976683_977406_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	1.4e-09
WP_003035183.1|978174_980196_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_003035185.1|980318_981227_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	6.0e-26
>prophage 85
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	990945	1002090	5064681		Anomala_cuprea_entomopoxvirus(20.0%)	10	NA	NA
WP_003845404.1|990945_992682_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	1.1e-17
WP_032948893.1|992674_993670_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_003035216.1|993666_994344_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_003035219.1|994569_995916_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.0	5.0e-53
WP_003035224.1|996012_998163_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.5	2.2e-42
WP_003035227.1|998192_999161_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_032948897.1|999323_1000409_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_003035231.1|1000506_1000767_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_003035233.1|1001070_1001337_-	DksA/TraR family C4-type zinc finger protein	NA	A0A2C9CZU7	Yersinia_phage	51.1	3.6e-16
WP_032948899.1|1001412_1002090_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.6	3.4e-18
>prophage 86
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1008461	1013651	5064681		Planktothrix_phage(33.33%)	6	NA	NA
WP_003035246.1|1008461_1009184_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.1	2.8e-34
WP_003035248.1|1009180_1009840_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_003035251.1|1009977_1010724_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_032948902.1|1011089_1011593_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	28.9	1.4e-05
WP_003035255.1|1011894_1012782_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_003035257.1|1013135_1013651_+	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	33.7	1.9e-16
>prophage 87
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1018720	1033686	5064681	transposase	Tupanvirus(16.67%)	12	NA	NA
WP_003035269.1|1018720_1020316_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	8.5e-60
WP_032948904.1|1020459_1021722_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_032948905.1|1021875_1022691_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032948907.1|1022858_1025291_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	50.9	2.3e-08
WP_032936389.1|1025296_1026196_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_032948908.1|1026328_1026991_+	fructose-6-phosphate aldolase	NA	A0A1D8KKK9	Synechococcus_phage	31.3	2.2e-22
WP_032948910.1|1027170_1028100_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.8	2.4e-67
WP_032948911.1|1028148_1028898_-	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SCZ9	Indivirus	29.3	1.8e-12
WP_032948912.1|1028897_1030133_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_032948914.1|1030308_1030671_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_003836974.1|1030862_1031828_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_047389048.1|1031814_1033686_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	27.2	4.8e-14
>prophage 88
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1041290	1043297	5064681		Stx2-converting_phage(50.0%)	2	NA	NA
WP_003035316.1|1041290_1042493_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.9e-97
WP_003836960.1|1042538_1043297_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	28.8	3.9e-15
>prophage 89
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1051487	1064879	5064681		Salmonella_phage(20.0%)	15	NA	NA
WP_032936370.1|1051487_1052699_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	89.4	2.1e-188
WP_161799272.1|1053090_1053192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003035354.1|1053207_1054893_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_003035356.1|1055162_1055543_+	membrane protein	NA	NA	NA	NA	NA
WP_003035358.1|1055577_1055841_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	67.9	3.8e-26
WP_032948923.1|1056013_1056304_+	YbjC family protein	NA	NA	NA	NA	NA
WP_003836934.1|1056287_1057010_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_003836932.1|1057069_1057972_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.0	2.0e-37
WP_003035368.1|1058062_1058539_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_032948924.1|1058972_1060085_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_003845528.1|1060223_1061357_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	1.1e-29
WP_003831667.1|1061366_1062320_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_003035376.1|1062316_1063162_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_003035378.1|1063221_1063710_+	YbjO family protein	NA	NA	NA	NA	NA
WP_032948926.1|1063751_1064879_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.4	1.6e-28
>prophage 90
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1069526	1086032	5064681	tRNA	Bacillus_phage(25.0%)	10	NA	NA
WP_032948929.1|1069526_1071248_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.4	3.4e-14
WP_032948930.1|1071248_1073015_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	26.2	1.1e-23
WP_003035727.1|1073129_1074098_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.9e-62
WP_002439523.1|1074645_1075140_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_047389646.1|1075274_1079261_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.8e-88
WP_003831898.1|1079372_1079984_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_003836910.1|1079994_1081338_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	4.3e-81
WP_003836908.1|1081430_1082723_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.1	2.5e-94
WP_032948932.1|1082959_1085404_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.7	3.5e-222
WP_003035741.1|1085414_1086032_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	2.8e-75
>prophage 91
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1090845	1094054	5064681		Tetraselmis_virus(100.0%)	2	NA	NA
WP_003035751.1|1090845_1091586_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.0e-20
WP_003035753.1|1091771_1094054_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	3.8e-162
>prophage 92
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1098177	1099266	5064681		Streptococcus_phage(100.0%)	1	NA	NA
WP_016149863.1|1098177_1099266_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	45.3	2.3e-80
>prophage 93
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1103418	1107959	5064681		Bacillus_phage(100.0%)	3	NA	NA
WP_003035780.1|1103418_1103703_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	9.2e-10
WP_032948935.1|1103909_1106174_+	ComEC family protein	NA	NA	NA	NA	NA
WP_003035784.1|1106210_1107959_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	2.4e-60
>prophage 94
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1122582	1133412	5064681	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_003035820.1|1122582_1123131_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	3.5e-05
WP_003035823.1|1123159_1123807_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003035825.1|1123860_1125051_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_003035828.1|1125234_1126323_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.4	4.8e-99
WP_003035832.1|1126923_1128324_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	5.0e-80
WP_003836860.1|1128491_1129694_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003035838.1|1129960_1132573_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.4	1.6e-18
WP_032936311.1|1132644_1133412_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.1	1.7e-29
>prophage 95
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1142303	1144211	5064681		Tupanvirus(100.0%)	1	NA	NA
WP_003836846.1|1142303_1144211_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.4	2.1e-49
>prophage 96
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1156767	1158822	5064681		Bacillus_phage(100.0%)	1	NA	NA
WP_032948946.1|1156767_1158822_+	DNA helicase IV	NA	A0A1P8CWU5	Bacillus_phage	23.7	3.6e-10
>prophage 97
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1163072	1163732	5064681	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003035917.1|1163072_1163732_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	8.9e-48
>prophage 98
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1169012	1169828	5064681		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_032948950.1|1169012_1169828_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.9	2.0e-12
>prophage 99
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1177501	1178422	5064681		Klosneuvirus(100.0%)	1	NA	NA
WP_003035957.1|1177501_1178422_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	39.0	3.6e-10
>prophage 100
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1191236	1191932	5064681		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_032948960.1|1191236_1191932_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.7	1.1e-16
>prophage 101
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1197135	1197309	5064681		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003036022.1|1197135_1197309_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 102
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1209470	1210259	5064681		Cronobacter_phage(100.0%)	1	NA	NA
WP_003036052.1|1209470_1210259_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.1	6.0e-91
>prophage 103
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1215099	1218904	5064681		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_032948969.1|1215099_1216038_+	glyoxylate/hydroxypyruvate reductase GhrA	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	28.5	3.2e-06
WP_003836800.1|1216124_1216862_+	phosphatase	NA	NA	NA	NA	NA
WP_032948970.1|1216885_1217440_+	molecular chaperone	NA	NA	NA	NA	NA
WP_008320293.1|1217541_1218024_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_003036082.1|1218070_1218904_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.7	3.0e-40
>prophage 104
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1223093	1223636	5064681		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_032948976.1|1223093_1223636_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.3	5.5e-27
>prophage 105
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1231851	1235633	5064681		Bacillus_phage(50.0%)	3	NA	NA
WP_032948981.1|1231851_1233273_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.1	3.2e-18
WP_032948983.1|1233336_1234557_-	multidrug efflux MFS transporter MdtG	NA	NA	NA	NA	NA
WP_003036136.1|1234712_1235633_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.6	1.0e-57
>prophage 106
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1240350	1240596	5064681		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003036157.1|1240350_1240596_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	50.0	1.1e-14
>prophage 107
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1255831	1256782	5064681		Brevibacillus_phage(100.0%)	1	NA	NA
WP_003836755.1|1255831_1256782_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	30.9	1.6e-10
>prophage 108
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1271521	1272648	5064681		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_003036255.1|1271521_1272256_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	7.7e-16
WP_000103754.1|1272411_1272648_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 109
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1275934	1281945	5064681		Pseudomonas_phage(33.33%)	5	NA	NA
WP_003036268.1|1275934_1276576_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	1.3e-27
WP_032948994.1|1276572_1277577_+	DNA polymerase III subunit delta'	NA	A0A1V0DYC6	Dinoroseobacter_phage	34.8	8.1e-08
WP_003036276.1|1277587_1278385_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003036277.1|1278677_1280111_+	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_032948995.1|1280166_1281945_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	33.4	4.1e-79
>prophage 110
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1291747	1292908	5064681	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_032949009.1|1291747_1292908_+|transposase	IS30-like element ISCfr4 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	4.6e-39
>prophage 111
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1323283	1323541	5064681		Erwinia_phage(100.0%)	1	NA	NA
WP_003030810.1|1323283_1323541_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	35.7	2.8e-05
>prophage 112
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1330825	1338536	5064681		Mycoplasma_phage(50.0%)	8	NA	NA
WP_032949062.1|1330825_1331527_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	4.9e-36
WP_003030804.1|1331526_1332771_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_003030802.1|1332860_1333772_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_003030799.1|1333787_1334609_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	36.1	3.3e-23
WP_032950831.1|1334708_1335755_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_003030794.1|1335782_1336562_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_032949064.1|1336558_1337416_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.8	4.3e-10
WP_003030791.1|1337399_1338536_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	40.3	7.2e-29
>prophage 113
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1344631	1355419	5064681	tail	Enterobacteria_phage(33.33%)	8	NA	NA
WP_047389650.1|1344631_1347337_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	E5G6P0	Salmonella_phage	48.4	4.8e-71
WP_047389083.1|1347336_1347933_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	56.0	9.5e-57
WP_050593504.1|1348005_1348989_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.5	2.5e-06
WP_032949066.1|1349736_1350126_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	69.0	6.9e-48
WP_032950842.1|1350636_1351131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127649098.1|1351745_1352057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032949067.1|1352942_1353611_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	2.1e-81
WP_032949068.1|1354048_1355419_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	4.7e-107
>prophage 114
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1359528	1371586	5064681	transposase	uncultured_Caudovirales_phage(33.33%)	13	NA	NA
WP_032949071.1|1359528_1360779_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_001607194.1|1360902_1361517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032949073.1|1361832_1362495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024193768.1|1362491_1362929_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_032949075.1|1362925_1363516_+	DUF4326 domain-containing protein	NA	A0A0S0N995	Pseudomonas_phage	43.0	4.4e-14
WP_100280114.1|1364578_1365747_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.1	7.1e-165
WP_032949077.1|1366030_1366540_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_003840850.1|1366714_1366957_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_071993032.1|1367035_1367269_+	DNA polymerase V	NA	A0A222YZE2	Escherichia_phage	81.8	6.6e-22
WP_032949079.1|1367345_1368044_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.7	3.8e-89
WP_032950850.1|1368129_1368450_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
WP_003030760.1|1369785_1370211_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
WP_032949081.1|1371100_1371586_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	34.9	3.0e-08
>prophage 115
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1389178	1390204	5064681		Bacillus_virus(100.0%)	1	NA	NA
WP_003030727.1|1389178_1390204_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	26.3	1.8e-10
>prophage 116
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1395109	1398884	5064681		Bacillus_phage(100.0%)	3	NA	NA
WP_003030710.1|1395109_1396600_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	28.8	1.4e-11
WP_032949093.1|1396764_1397535_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003030708.1|1397600_1398884_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	26.6	1.9e-09
>prophage 117
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1406766	1408020	5064681		Tupanvirus(100.0%)	1	NA	NA
WP_032949097.1|1406766_1408020_-	glycoside hydrolase family 18 protein	NA	A0A2K9L3D4	Tupanvirus	29.5	4.5e-24
>prophage 118
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1413682	1417742	5064681		Staphylococcus_phage(50.0%)	4	NA	NA
WP_008320453.1|1413682_1414666_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.4	2.5e-06
WP_003030679.1|1414802_1415561_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_032949100.1|1415701_1417060_+	MFS transporter	NA	NA	NA	NA	NA
WP_100280117.1|1417097_1417742_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.2	9.4e-18
>prophage 119
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1422570	1424517	5064681		Streptococcus_phage(100.0%)	1	NA	NA
WP_032949103.1|1422570_1424517_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.7	5.3e-40
>prophage 120
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1429596	1430229	5064681		Bacillus_phage(100.0%)	1	NA	NA
WP_032949108.1|1429596_1430229_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.7	1.7e-11
>prophage 121
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1435763	1436984	5064681		Klosneuvirus(100.0%)	1	NA	NA
WP_003030639.1|1435763_1436984_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.2e-27
>prophage 122
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1444530	1445361	5064681		Bacillus_virus(100.0%)	1	NA	NA
WP_032949121.1|1444530_1445361_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	55.3	9.1e-74
>prophage 123
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1454311	1455756	5064681		Bacillus_phage(50.0%)	2	NA	NA
WP_086551139.1|1454311_1454911_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	33.6	1.0e-05
WP_032949123.1|1454994_1455756_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	2.4e-20
>prophage 124
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1461914	1483182	5064681	transposase,tRNA	Shigella_phage(14.29%)	20	NA	NA
WP_100216202.1|1461914_1463083_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_032949128.1|1464601_1466413_+	hypothetical protein	NA	F1C5A8	Cronobacter_phage	60.6	4.2e-39
WP_032949129.1|1466444_1467920_-	glucosyltransferase domain-containing protein	NA	A0A192Y7W8	Salmonella_phage	26.3	1.1e-34
WP_032949131.1|1467922_1468840_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.7	1.9e-160
WP_032950860.1|1468836_1469199_-	GtrA family protein	NA	B9UDL8	Salmonella_phage	71.7	3.6e-43
WP_032949132.1|1469594_1471523_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	9.7e-127
WP_048997935.1|1471526_1472069_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_003030583.1|1472165_1472363_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003030578.1|1472418_1472775_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152659856.1|1472813_1472945_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_003832580.1|1473144_1474128_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_003030574.1|1474143_1476531_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003030571.1|1476535_1476835_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_003832584.1|1476988_1477969_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_003030569.1|1478029_1478581_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003030567.1|1478580_1479330_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_003836644.1|1479407_1479872_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_003836643.1|1480188_1480902_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_032949134.1|1480963_1482406_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
WP_003030561.1|1482402_1483182_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.3	1.2e-11
>prophage 125
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1488478	1493191	5064681		Pandoravirus(50.0%)	3	NA	NA
WP_003030555.1|1488478_1489525_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	47.1	8.8e-82
WP_003030553.1|1489651_1490485_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_032949144.1|1490812_1493191_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.2	1.5e-169
>prophage 126
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1503005	1508096	5064681		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_032949157.1|1503005_1503374_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	1.9e-15
WP_032949159.1|1503382_1504870_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_032949160.1|1504886_1505633_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.5	8.7e-07
WP_003029382.1|1505607_1506879_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_032949161.1|1506875_1508096_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.4	2.5e-96
>prophage 127
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1512258	1519672	5064681		Escherichia_phage(66.67%)	6	NA	NA
WP_032949163.1|1512258_1513281_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	2.9e-13
WP_003029361.1|1513273_1513942_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003029358.1|1513963_1514776_+	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032949165.1|1514856_1517922_-	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	26.4	9.4e-07
WP_032949167.1|1517914_1518937_-	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
WP_032949168.1|1518937_1519672_-	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	40.0	8.5e-23
>prophage 128
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1526564	1531111	5064681		Escherichia_phage(33.33%)	6	NA	NA
WP_003029332.1|1526564_1527233_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.8	4.1e-24
WP_032949179.1|1527229_1528015_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_032949180.1|1528018_1528831_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	32.5	6.8e-05
WP_032949181.1|1528840_1529518_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032949183.1|1529507_1530293_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032949184.1|1530292_1531111_-	amino acid ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.5	5.4e-18
>prophage 129
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1542083	1544928	5064681		Streptococcus_phage(50.0%)	2	NA	NA
WP_032949194.1|1542083_1543559_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	27.8	2.6e-15
WP_032949196.1|1543665_1544928_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	2.1e-21
>prophage 130
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1550495	1551248	5064681		Tupanvirus(100.0%)	1	NA	NA
WP_003843516.1|1550495_1551248_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.1	1.5e-06
>prophage 131
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1562193	1568988	5064681	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_003836487.1|1562193_1562883_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.1	3.1e-11
WP_003029256.1|1562953_1563700_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	32.4	1.5e-06
WP_032949208.1|1564120_1565125_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032949209.1|1565326_1567111_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	2.8e-19
WP_003029249.1|1567230_1568340_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003029247.1|1568505_1568988_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.7	5.6e-23
>prophage 132
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1575607	1586648	5064681		Bodo_saltans_virus(16.67%)	11	NA	NA
WP_032949212.1|1575607_1576306_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.4	1.5e-08
WP_003029224.1|1576345_1577719_-	multidrug efflux MATE transporter MdtK	NA	NA	NA	NA	NA
WP_003029220.1|1577936_1578584_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.3	1.2e-23
WP_003029219.1|1578625_1579774_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	44.9	1.2e-84
WP_032949218.1|1580064_1581270_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003029215.1|1581383_1582316_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003029211.1|1582312_1583338_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.3	8.2e-32
WP_003029209.1|1583635_1583725_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_032949220.1|1583900_1585070_+	MFS transporter	NA	NA	NA	NA	NA
WP_003029205.1|1585108_1585690_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	3.4e-43
WP_032935840.1|1585817_1586648_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	41.6	2.4e-18
>prophage 133
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1591752	1592277	5064681		Salmonella_phage(100.0%)	1	NA	NA
WP_003029187.1|1591752_1592277_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	1.7e-46
>prophage 134
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1599195	1600470	5064681	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_003029168.1|1599195_1600470_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.6	6.5e-87
>prophage 135
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1625484	1626786	5064681		Bacillus_phage(100.0%)	1	NA	NA
WP_003028962.1|1625484_1626786_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.8	5.2e-15
>prophage 136
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1647918	1650128	5064681		Bacillus_phage(100.0%)	2	NA	NA
WP_003028928.1|1647918_1648641_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	1.1e-35
WP_032949254.1|1648637_1650128_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.3	3.1e-24
>prophage 137
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1656785	1658916	5064681		Escherichia_phage(100.0%)	3	NA	NA
WP_003028918.1|1656785_1657400_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.0	4.0e-26
WP_032949257.1|1657442_1658297_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	32.3	3.8e-22
WP_032949259.1|1658298_1658916_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	2.1e-75
>prophage 138
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1663722	1668675	5064681		uncultured_virus(25.0%)	5	NA	NA
WP_003032384.1|1663722_1664049_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	2.2e-23
WP_003836327.1|1664156_1665371_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.9	1.9e-48
WP_003836325.1|1665431_1666766_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_003836323.1|1666929_1668396_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	8.4e-46
WP_003032393.1|1668471_1668675_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
>prophage 139
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1673273	1674200	5064681		Bacillus_phage(100.0%)	1	NA	NA
WP_032949266.1|1673273_1674200_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.0	7.2e-19
>prophage 140
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1679027	1680533	5064681		Cedratvirus(50.0%)	2	NA	NA
WP_032949269.1|1679027_1679825_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	26.5	3.1e-10
WP_003032416.1|1679834_1680533_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	2.6e-13
>prophage 141
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1683873	1684257	5064681		Streptococcus_phage(100.0%)	1	NA	NA
WP_003032424.1|1683873_1684257_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	3.6e-09
>prophage 142
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1716829	1718569	5064681		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_016150245.1|1716829_1718569_+	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	29.8	7.7e-14
>prophage 143
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1724026	1725970	5064681		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032949298.1|1724026_1725970_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.8	1.0e-11
>prophage 144
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1731859	1733774	5064681		Planktothrix_phage(100.0%)	2	NA	NA
WP_003836252.1|1731859_1732846_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	3.2e-17
WP_032949300.1|1732838_1733774_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.2	9.2e-14
>prophage 145
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1743569	1745967	5064681		Streptococcus_phage(50.0%)	2	NA	NA
WP_032949304.1|1743569_1745285_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.0	1.6e-35
WP_003020048.1|1745364_1745967_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	4.5e-22
>prophage 146
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1752321	1753404	5064681		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032949311.1|1752321_1753404_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	71.7	5.4e-143
>prophage 147
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1761494	1763039	5064681		Escherichia_phage(100.0%)	1	NA	NA
WP_003020103.1|1761494_1763039_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.1e-19
>prophage 148
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1767187	1769164	5064681		Tetraselmis_virus(100.0%)	1	NA	NA
WP_032949320.1|1767187_1769164_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.8	1.6e-161
>prophage 149
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1776215	1776989	5064681		Bacillus_virus(100.0%)	1	NA	NA
WP_003836184.1|1776215_1776989_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.7e-18
>prophage 150
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1783339	1784881	5064681		Salmonella_phage(100.0%)	1	NA	NA
WP_032949338.1|1783339_1784881_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	53.3	4.8e-36
>prophage 151
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1804520	1808946	5064681		Mycoplasma_phage(50.0%)	4	NA	NA
WP_003020210.1|1804520_1805537_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	58.9	2.5e-25
WP_003020212.1|1805553_1806699_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016150280.1|1807027_1808437_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_127649147.1|1808529_1808946_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	55.6	4.1e-30
>prophage 152
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1812394	1814356	5064681		Phage_TP(100.0%)	1	NA	NA
WP_032949356.1|1812394_1814356_-	U32 family peptidase	NA	Q6DW11	Phage_TP	27.8	2.1e-23
>prophage 153
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1829608	1832585	5064681		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_032949364.1|1829608_1831297_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.7	1.5e-14
WP_003020293.1|1831466_1832585_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.6	3.6e-33
>prophage 154
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1839352	1841746	5064681		Salmonella_phage(33.33%)	3	NA	NA
WP_003843755.1|1839352_1840621_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	78.4	2.0e-197
WP_003020321.1|1840623_1841043_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.5	3.9e-33
WP_003020322.1|1841215_1841746_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	9.1e-19
>prophage 155
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1846548	1850451	5064681		Klosneuvirus(100.0%)	1	NA	NA
WP_032949371.1|1846548_1850451_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	5.9e-54
>prophage 156
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1855392	1856382	5064681		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_032949373.1|1855392_1856382_+	2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	42.8	3.3e-70
>prophage 157
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1861359	1873822	5064681	tRNA	Enterobacteria_phage(14.29%)	10	NA	NA
WP_032949379.1|1861359_1862484_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.6	3.9e-120
WP_003020366.1|1862630_1862843_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_003020369.1|1862924_1863359_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_003833209.1|1863557_1864493_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.8	1.1e-139
WP_003843930.1|1864586_1865960_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	8.6e-53
WP_032949381.1|1866431_1867415_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_032949384.1|1867569_1868679_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.0	2.8e-09
WP_032949385.1|1871272_1872505_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.4	1.2e-16
WP_032949386.1|1872517_1873081_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_003020394.1|1873306_1873822_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	1.2e-23
>prophage 158
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1877493	1880483	5064681		Tupanvirus(50.0%)	4	NA	NA
WP_032949387.1|1877493_1878546_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	46.4	9.2e-87
WP_032949389.1|1878589_1879042_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_032949391.1|1879208_1879592_-	VOC family protein	NA	NA	NA	NA	NA
WP_003843948.1|1879712_1880483_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.1	6.6e-18
>prophage 159
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1892766	1893849	5064681		Indivirus(100.0%)	1	NA	NA
WP_032949400.1|1892766_1893849_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.3	4.0e-13
>prophage 160
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1911840	1913641	5064681		Planktothrix_phage(50.0%)	2	NA	NA
WP_003020556.1|1911840_1912833_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.7	4.7e-08
WP_003020558.1|1912834_1913641_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	1.3e-13
>prophage 161
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1917031	1918966	5064681		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003020571.1|1917031_1918966_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.5	4.5e-07
>prophage 162
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1926868	1927459	5064681		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003020601.1|1926868_1927459_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	7.7e-43
>prophage 163
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1932300	1937688	5064681	protease	Tupanvirus(50.0%)	4	NA	NA
WP_003840713.1|1932300_1934898_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	2.5e-85
WP_003020616.1|1935296_1935548_+	YciN family protein	NA	NA	NA	NA	NA
WP_032949411.1|1935658_1936705_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_003840709.1|1936926_1937688_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	3.4e-06
>prophage 164
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1942666	1949139	5064681		Acinetobacter_phage(66.67%)	5	NA	NA
WP_003020639.1|1942666_1944262_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.6	3.2e-51
WP_032950870.1|1944265_1945624_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	7.8e-38
WP_003020645.1|1945634_1946828_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_003020647.1|1946827_1947634_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003841287.1|1947666_1949139_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.4	8.2e-17
>prophage 165
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1959238	1962135	5064681		Lactobacillus_phage(33.33%)	3	NA	NA
WP_003020693.1|1959238_1960075_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	1.4e-08
WP_003020696.1|1960120_1961125_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.2	6.8e-15
WP_003020699.1|1961121_1962135_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	29.0	9.9e-14
>prophage 166
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1970566	1980807	5064681		Citrobacter_phage(25.0%)	10	NA	NA
WP_003020720.1|1970566_1971184_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	54.3	8.6e-53
WP_003020723.1|1971794_1972208_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_003020727.1|1972344_1973253_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	3.7e-60
WP_032949419.1|1973457_1974471_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_003020732.1|1974561_1975473_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_032949421.1|1975584_1976040_+	YchJ family protein	NA	NA	NA	NA	NA
WP_003020737.1|1976095_1976938_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	9.8e-15
WP_003020743.1|1977884_1978562_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_003020745.1|1978561_1979272_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_032949422.1|1979268_1980807_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.5	1.8e-19
>prophage 167
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	1994029	1998036	5064681		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_003020772.1|1994029_1994884_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	2.4e-45
WP_003020775.1|1994919_1995729_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_003020779.1|1995731_1996124_-	SirB family protein	NA	NA	NA	NA	NA
WP_032949424.1|1996120_1996954_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_032949425.1|1996953_1998036_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	38.8	4.3e-07
>prophage 168
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2001283	2007023	5064681		Tupanvirus(33.33%)	4	NA	NA
WP_001518537.1|2001283_2002231_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
WP_003020797.1|2002355_2004038_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.5	1.3e-21
WP_032949428.1|2004158_2005622_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_003020802.1|2005637_2007023_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.2	9.7e-28
>prophage 169
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2014647	2015568	5064681		Moraxella_phage(100.0%)	1	NA	NA
WP_032949433.1|2014647_2015568_-	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	27.1	5.8e-29
>prophage 170
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2024319	2025051	5064681		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003841536.1|2024319_2025051_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	2.4e-54
>prophage 171
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2039123	2039885	5064681		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_032949450.1|2039123_2039885_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.1	1.3e-13
>prophage 172
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2056344	2157001	5064681	transposase,terminase,integrase,tail,portal,head,tRNA,capsid,protease	Klebsiella_phage(27.78%)	113	2101021:2101048	2153308:2153335
WP_100216202.1|2056344_2057512_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_032949462.1|2058029_2058476_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_003020947.1|2058568_2059228_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_003020949.1|2059297_2059591_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_003020951.1|2059717_2060425_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003020956.1|2060448_2061261_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185666.1|2061264_2061531_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_003020959.1|2061617_2062535_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032949464.1|2062638_2063724_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_008322612.1|2063774_2064890_-	ribonuclease D	NA	NA	NA	NA	NA
WP_003020970.1|2064974_2066660_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	3.4e-35
WP_003020975.1|2066864_2067449_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_032949466.1|2067543_2068239_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	35.4	5.8e-05
WP_003020980.1|2068297_2070208_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.1	9.1e-93
WP_003020984.1|2070348_2070693_+	RidA family protein	NA	NA	NA	NA	NA
WP_003020986.1|2070699_2070879_-	YoaH family protein	NA	NA	NA	NA	NA
WP_003841618.1|2070962_2072324_+	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	40.2	2.9e-40
WP_003020991.1|2072327_2072906_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_032949468.1|2073089_2074454_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_003841621.1|2074584_2076186_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_032949469.1|2076192_2077752_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.1e-41
WP_003021002.1|2078211_2079174_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_003021004.1|2079232_2080033_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_008322630.1|2080045_2080897_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_003021010.1|2080957_2081416_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_003021013.1|2081848_2082415_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_003841628.1|2082411_2083221_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_032949470.1|2083284_2085030_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|2085249_2085459_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_003034983.1|2085471_2085615_-	YobF family protein	NA	NA	NA	NA	NA
WP_003034980.1|2086251_2086536_-	YebO family protein	NA	NA	NA	NA	NA
WP_003034977.1|2086610_2086754_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_032949471.1|2086918_2087158_+	membrane protein	NA	NA	NA	NA	NA
WP_003833778.1|2087272_2088064_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_032949472.1|2088238_2089612_+	MFS transporter	NA	NA	NA	NA	NA
WP_003034964.1|2089658_2090540_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_003034960.1|2090732_2092781_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	1.2e-87
WP_003034957.1|2092800_2093487_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_032949473.1|2093583_2094081_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_032949474.1|2094209_2095493_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_003034947.1|2095461_2098095_+	PqiB family protein	NA	NA	NA	NA	NA
WP_008322657.1|2098174_2099596_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_029139506.1|2099696_2099933_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_003034941.1|2100035_2100227_+	YebW family protein	NA	NA	NA	NA	NA
WP_032949476.1|2100227_2100869_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.5	6.6e-56
2101021:2101048	attL	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_072211991.1|2101209_2101308_+	DinI-like family protein	NA	S4TND2	Salmonella_phage	85.7	1.8e-05
WP_016150083.1|2101420_2102092_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	2.2e-78
WP_032949478.1|2102442_2102766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032949480.1|2102841_2103309_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_032950878.1|2103544_2103724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032949481.1|2103824_2104238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032949482.1|2104533_2104923_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	3.0e-51
WP_032949485.1|2105243_2105486_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	79.2	1.2e-29
WP_052132584.1|2105664_2106648_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.5	2.5e-06
WP_047389153.1|2106720_2107317_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	56.5	5.0e-58
WP_047389155.1|2107316_2109896_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	49.5	2.5e-61
WP_032949486.1|2109936_2113341_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	70.2	0.0e+00
WP_071993038.1|2113413_2114091_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	70.2	5.9e-79
WP_032949488.1|2113988_2114723_-|tail	phage tail protein	tail	A5LH41	Enterobacteria_phage	76.2	8.8e-113
WP_032949489.1|2114734_2115430_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	72.3	4.2e-96
WP_032949490.1|2115438_2115771_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	67.9	2.4e-41
WP_032950888.1|2115771_2119074_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	66.4	0.0e+00
WP_071993054.1|2119073_2119301_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	65.3	9.0e-24
WP_032949492.1|2119321_2119684_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	56.8	4.8e-27
WP_032949494.1|2119746_2120229_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	80.6	2.3e-61
WP_032949495.1|2120262_2120664_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	86.5	4.4e-58
WP_032949497.1|2120660_2121050_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	66.9	1.3e-43
WP_032950890.1|2121365_2121683_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	79.6	2.1e-39
WP_032949499.1|2122139_2123426_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	1.3e-212
WP_032949501.1|2123498_2124419_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	80.1	2.7e-135
WP_003832365.1|2124455_2125715_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	2.6e-221
WP_003832363.1|2125714_2125894_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	71.2	3.3e-13
WP_016150031.1|2125887_2127615_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	92.8	0.0e+00
WP_003832359.1|2127611_2128109_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	93.9	1.3e-83
WP_032947956.1|2128426_2128789_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	85.8	1.3e-56
WP_032949505.1|2129067_2129607_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	80.0	3.8e-44
WP_016150028.1|2129964_2130138_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_032938624.1|2130341_2130572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072211990.1|2130645_2130834_-	cold-shock protein	NA	NA	NA	NA	NA
WP_016150027.1|2130844_2131057_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	7.8e-22
WP_032949506.1|2131446_2131962_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	40.9	1.7e-06
WP_032949507.1|2131961_2132507_-	lysozyme	NA	K7PM52	Enterobacteria_phage	95.0	3.2e-99
WP_016150024.1|2132478_2132757_-	hypothetical protein	NA	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
WP_032938617.1|2132912_2133101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162835200.1|2133447_2133618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003841948.1|2134024_2134240_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.6	5.9e-25
WP_071992552.1|2134536_2134749_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_032938616.1|2135072_2135468_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	60.0	3.3e-37
WP_032949508.1|2135482_2136523_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	52.0	1.7e-101
WP_032949510.1|2136519_2136879_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	64.4	4.0e-42
WP_032949512.1|2136881_2137082_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	63.1	1.1e-17
WP_050593526.1|2137982_2139209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032949514.1|2139254_2139557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032949515.1|2139933_2140677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050592503.1|2141217_2143458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032943042.1|2143639_2144998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032943041.1|2145222_2145648_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032949517.1|2145703_2146114_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	63.6	2.4e-06
WP_032943039.1|2146233_2147028_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	55.2	7.2e-68
WP_032949518.1|2147082_2147637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032949519.1|2147639_2147855_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.3e-16
WP_032949520.1|2147956_2148346_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.8	3.5e-36
WP_032943037.1|2148574_2148790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032950892.1|2148847_2149174_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_050593527.1|2149315_2151796_+	exonuclease	NA	K7P6V4	Enterobacteria_phage	38.7	5.6e-111
WP_072211989.1|2151859_2152120_+	hypothetical protein	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	40.3	1.4e-12
WP_032949521.1|2152097_2153177_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	55.6	3.5e-110
WP_003034934.1|2153568_2153907_-	YebY family protein	NA	NA	NA	NA	NA
2153308:2153335	attR	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_032949522.1|2153927_2154800_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003034928.1|2154803_2155178_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_003034925.1|2155321_2155552_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_003841657.1|2155658_2156315_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003833802.1|2156338_2157001_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	31.1	9.1e-08
>prophage 173
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2164749	2166225	5064681		Cyanophage(100.0%)	1	NA	NA
WP_003034896.1|2164749_2166225_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
>prophage 174
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2170157	2226583	5064681	terminase,tail,portal,head,tRNA,capsid,protease	Enterobacteria_phage(29.63%)	69	NA	NA
WP_003034883.1|2170157_2171477_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_003844151.1|2171492_2172437_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_003034877.1|2172515_2173271_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	6.5e-18
WP_003034874.1|2173267_2174053_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_003034872.1|2174131_2175142_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
WP_003034869.1|2175150_2175762_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003034867.1|2175842_2176364_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003034865.1|2176398_2177142_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003034863.1|2177170_2177614_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003034862.1|2177615_2179388_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032949527.1|2179676_2180243_+	hydrolase	NA	NA	NA	NA	NA
WP_047389162.1|2180565_2181234_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	4.8e-81
WP_047389163.1|2181234_2181624_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	74.4	7.1e-53
WP_047389165.1|2181700_2181943_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.3	5.8e-29
WP_080753840.1|2182071_2183166_-|tail	tail fiber domain-containing protein	tail	Q5G8V6	Enterobacteria_phage	79.7	1.1e-61
WP_047389167.1|2183572_2184247_-	hypothetical protein	NA	O64337	Escherichia_phage	52.0	1.1e-53
WP_047389169.1|2184247_2184562_-	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	56.9	4.6e-26
WP_047389170.1|2184561_2187747_-	host specificity protein J	NA	O64335	Escherichia_phage	87.1	0.0e+00
WP_047389172.1|2187802_2188402_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	77.5	6.8e-79
WP_047389174.1|2188458_2188794_-	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	49.5	8.6e-23
WP_047389658.1|2188800_2189148_-	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	36.0	1.8e-07
WP_047389176.1|2189180_2189891_-	C40 family peptidase	NA	K7PGV2	Enterobacterial_phage	96.6	2.7e-143
WP_045407314.1|2189892_2190651_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	99.6	1.1e-147
WP_047389179.1|2190647_2190986_-|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	98.2	4.3e-62
WP_047389181.1|2190988_2194270_-|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	97.7	0.0e+00
WP_045261725.1|2194305_2194569_-	DUF4035 domain-containing protein	NA	K7PLY6	Enterobacterial_phage	97.7	8.5e-42
WP_047389184.1|2194592_2194994_-|tail	phage tail protein	tail	K7P7C2	Enterobacteria_phage	97.7	1.4e-67
WP_047362824.1|2195048_2195519_-|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	98.1	1.7e-80
WP_047389186.1|2195574_2195922_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	98.3	1.1e-57
WP_016063565.1|2195918_2196368_-	HK97 gp10 family phage protein	NA	K7PH84	Enterobacterial_phage	100.0	4.0e-76
WP_016042205.1|2196364_2196703_-|head	phage head closure protein	head	K7P7L2	Enterobacteria_phage	100.0	2.9e-58
WP_016063563.1|2196702_2197029_-|head,tail	phage head-tail connector protein	head,tail	K7PGU9	Enterobacterial_phage	100.0	2.6e-56
WP_047389190.1|2197062_2198220_-|capsid	phage major capsid protein	capsid	K7PJR8	Enterobacterial_phage	99.2	1.7e-211
WP_047389192.1|2198222_2198900_-|head,protease	HK97 family phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	99.6	1.6e-124
WP_047389193.1|2198917_2200192_-|portal	phage portal protein	portal	F1C584	Cronobacter_phage	99.5	7.3e-248
WP_047389195.1|2200191_2201706_-|terminase	terminase large subunit	terminase	Q9MCT1	Enterobacteria_phage	99.6	8.0e-294
WP_047389197.1|2201712_2202198_-	hypothetical protein	NA	K7PGU7	Enterobacterial_phage	97.5	2.2e-80
WP_047389199.1|2202350_2202587_-	hypothetical protein	NA	K7PHC8	Enterobacterial_phage	87.2	2.1e-31
WP_047389201.1|2202586_2202928_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	98.2	4.6e-64
WP_047389203.1|2202924_2203515_-	hypothetical protein	NA	K7P7D2	Enterobacteria_phage	95.9	3.9e-111
WP_047389205.1|2203496_2204954_-	glycosyltransferase family 2 protein	NA	A0A220NRM5	Escherichia_phage	87.9	7.3e-260
WP_047389207.1|2205062_2205320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052132595.1|2205356_2205854_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	83.2	2.8e-62
WP_047389210.1|2205877_2206426_-	lysozyme	NA	K7PM52	Enterobacteria_phage	96.7	4.4e-101
WP_016150496.1|2206397_2206676_-	hypothetical protein	NA	K7P6H9	Enterobacteria_phage	98.9	1.1e-44
WP_047389212.1|2206848_2208141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047389215.1|2208137_2208578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047389217.1|2208922_2209738_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	72.3	1.1e-111
WP_047389219.1|2209748_2211107_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	69.1	8.0e-176
WP_047389221.1|2211103_2211985_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	62.4	8.2e-81
WP_047389223.1|2212841_2213666_-	transporter	NA	Q8W644	Enterobacteria_phage	69.3	1.4e-111
WP_052132596.1|2213696_2213912_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	48.5	1.8e-10
WP_047389228.1|2214065_2214758_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	65.0	1.3e-84
WP_047389230.1|2214928_2215222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389232.1|2215299_2215686_+	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	59.2	8.4e-38
WP_047389234.1|2215977_2216385_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	75.4	3.7e-44
WP_047389235.1|2216574_2216988_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	64.2	1.2e-45
WP_052132585.1|2216984_2217563_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	54.7	5.8e-59
WP_047389237.1|2217573_2218167_+	hypothetical protein	NA	A0A2I7QNC9	Vibrio_phage	28.7	3.1e-07
WP_047389238.1|2218166_2218391_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	44.4	6.2e-09
WP_000073104.1|2218494_2218731_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	94.9	9.3e-40
WP_047389241.1|2218789_2220103_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	89.2	3.6e-234
WP_044701478.1|2220081_2220855_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	78.7	1.0e-55
WP_003034689.1|2220907_2221303_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_003034686.1|2221343_2222087_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	3.2e-25
WP_003839177.1|2222083_2223052_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_032949528.1|2223295_2224042_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003034677.1|2224044_2224611_-	VOC family protein	NA	NA	NA	NA	NA
WP_003034673.1|2224849_2226583_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	1.7e-85
>prophage 175
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2234596	2240242	5064681		Bacillus_thuringiensis_phage(50.0%)	5	NA	NA
WP_003034656.1|2234596_2234986_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
WP_003034651.1|2235003_2236053_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	1.8e-05
WP_003034649.1|2236049_2236922_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_032949531.1|2236941_2238543_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	1.2e-10
WP_003833879.1|2238586_2240242_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.8	1.6e-08
>prophage 176
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2252025	2253540	5064681		Cedratvirus(100.0%)	1	NA	NA
WP_032949534.1|2252025_2253540_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	28.7	4.8e-12
>prophage 177
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2265195	2266221	5064681		Wolbachia_phage(100.0%)	1	NA	NA
WP_003839115.1|2265195_2266221_+	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	34.0	8.7e-42
>prophage 178
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2273316	2274069	5064681		Bacillus_virus(100.0%)	1	NA	NA
WP_003030477.1|2273316_2274069_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	6.4e-26
>prophage 179
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2285983	2288710	5064681		Salmonella_phage(66.67%)	3	NA	NA
WP_032949546.1|2285983_2286346_+	GtrA family protein	NA	I1TED9	Salmonella_phage	76.7	1.2e-46
WP_032949547.1|2286342_2287278_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.8	1.3e-148
WP_032949548.1|2287267_2288710_+	glucosyltransferase domain-containing protein	NA	I1TED7	Salmonella_phage	22.4	4.6e-12
>prophage 180
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2304061	2308318	5064681		Burkholderia_phage(50.0%)	4	NA	NA
WP_032949554.1|2304061_2304529_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	7.5e-33
WP_032949555.1|2304509_2305940_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.9	1.2e-102
WP_032949556.1|2306016_2306709_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.1	8.0e-07
WP_032949557.1|2307151_2308318_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.0	1.8e-107
>prophage 181
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2313391	2314075	5064681		Bacillus_virus(100.0%)	1	NA	NA
WP_003030299.1|2313391_2314075_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	4.0e-27
>prophage 182
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2319044	2319860	5064681		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_003839037.1|2319044_2319860_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.2	2.5e-07
>prophage 183
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2333354	2334164	5064681		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003030258.1|2333354_2334164_-	propanediol diffusion facilitator PduF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.8	1.7e-11
>prophage 184
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2353821	2356476	5064681		Stx2-converting_phage(50.0%)	3	NA	NA
WP_032949573.1|2353821_2354994_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	87.2	5.8e-199
WP_003838979.1|2355133_2355901_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_032949574.1|2355897_2356476_-	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.0	2.8e-21
>prophage 185
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2364441	2365341	5064681		Cellulophaga_phage(100.0%)	1	NA	NA
WP_003030161.1|2364441_2365341_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	97.4	4.8e-12
>prophage 186
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2372918	2376752	5064681		Prochlorococcus_phage(33.33%)	3	NA	NA
WP_032949582.1|2372918_2373923_+	NAD-dependent epimerase	NA	A0A0K0KW07	Prochlorococcus_phage	31.7	5.6e-17
WP_032949583.1|2373981_2375148_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	55.0	1.1e-114
WP_032949584.1|2375345_2376752_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	1.8e-37
>prophage 187
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2380148	2391316	5064681		Enterobacteria_phage(28.57%)	11	NA	NA
WP_032949588.1|2380148_2381030_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.9	1.7e-09
WP_050593531.1|2381022_2382012_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_032949589.1|2382013_2383294_-	O-antigen translocase	NA	NA	NA	NA	NA
WP_032949590.1|2383281_2384388_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	31.0	2.9e-43
WP_032949591.1|2384391_2384925_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032949592.1|2384914_2385313_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_032949593.1|2385319_2386189_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	68.8	5.2e-112
WP_032949594.1|2386188_2387274_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	7.4e-100
WP_032949595.1|2387647_2388541_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.3	4.3e-45
WP_032949596.1|2388778_2389774_-	SDR family oxidoreductase	NA	A0A0K1L6Z1	Scale_drop_disease_virus	28.5	1.1e-09
WP_032949597.1|2389921_2391316_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.8	1.7e-19
>prophage 188
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2396777	2403515	5064681		Bacillus_phage(25.0%)	6	NA	NA
WP_032949601.1|2396777_2398148_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.3	5.4e-31
WP_032949602.1|2398284_2399721_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	31.4	7.7e-52
WP_032949603.1|2399723_2400947_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_032949604.1|2400943_2401423_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_003841801.1|2401425_2402391_-	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.6	6.9e-89
WP_003036748.1|2402393_2403515_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.5	2.4e-133
>prophage 189
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2407261	2417893	5064681		Streptococcus_virus(20.0%)	9	NA	NA
WP_032949608.1|2407261_2407750_-	colanic acid biosynthesis acetyltransferase WcaB	NA	A0A191KBJ5	Streptococcus_virus	41.0	1.2e-09
WP_003036760.1|2407752_2408595_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	NA	NA	NA	NA
WP_032949609.1|2408667_2410824_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	2.2e-18
WP_032949610.1|2410820_2411270_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_003036765.1|2411275_2412415_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_003841782.1|2413070_2414654_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.9	1.5e-37
WP_032949611.1|2414698_2416552_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_003036774.1|2416578_2417160_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	3.2e-33
WP_003036776.1|2417251_2417893_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	2.2e-35
>prophage 190
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2428670	2442738	5064681	tRNA,protease	Bacillus_phage(25.0%)	10	NA	NA
WP_032949615.1|2428670_2431751_+	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	22.7	2.6e-65
WP_032949616.1|2431747_2433160_+	MFS transporter	NA	NA	NA	NA	NA
WP_003844344.1|2433159_2434563_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.2	5.0e-32
WP_003036797.1|2434559_2435282_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_032936697.1|2435417_2435750_+	YegP family protein	NA	NA	NA	NA	NA
WP_003844346.1|2435909_2437271_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.9	4.1e-204
WP_003036804.1|2437541_2439818_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_003036810.1|2439848_2440169_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036813.1|2440492_2440717_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_032949617.1|2440791_2442738_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	1.6e-39
>prophage 191
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2453987	2455706	5064681		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_003027264.1|2453987_2455706_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	8.9e-31
>prophage 192
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2461538	2462267	5064681		Planktothrix_phage(100.0%)	1	NA	NA
WP_047389269.1|2461538_2462267_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.0	1.5e-27
>prophage 193
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2465496	2470002	5064681		Catovirus(50.0%)	4	NA	NA
WP_032949625.1|2465496_2466396_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.6	3.7e-12
WP_003027312.1|2466418_2467471_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_032949626.1|2467723_2469001_+	MFS transporter	NA	NA	NA	NA	NA
WP_032949627.1|2468997_2470002_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	27.7	4.1e-12
>prophage 194
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2480974	2489393	5064681	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_032949635.1|2480974_2483008_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	5.2e-54
WP_003027345.1|2483214_2483673_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.6e-49
WP_003027346.1|2483715_2484186_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
WP_003027347.1|2484232_2484952_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003027348.1|2484948_2486634_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_032949636.1|2486859_2487591_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.0	1.4e-105
WP_003027354.1|2487642_2487750_+	protein YohO	NA	NA	NA	NA	NA
WP_032949637.1|2487730_2488462_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032949638.1|2488445_2489393_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	2.6e-08
>prophage 195
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2500158	2500893	5064681		Streptococcus_phage(100.0%)	1	NA	NA
WP_032949642.1|2500158_2500893_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	43.6	2.3e-52
>prophage 196
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2515275	2516796	5064681		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003027396.1|2515275_2516796_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.8	3.4e-10
>prophage 197
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2520500	2524593	5064681		Cellulophaga_phage(50.0%)	3	NA	NA
WP_003027410.1|2520500_2521169_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	4.1e-56
WP_032949649.1|2521491_2522328_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_032949650.1|2522607_2524593_+	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	32.6	4.5e-10
>prophage 198
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2528498	2529356	5064681		Catovirus(100.0%)	1	NA	NA
WP_003027428.1|2528498_2529356_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.8	4.4e-23
>prophage 199
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2543041	2544958	5064681		Burkholderia_virus(100.0%)	1	NA	NA
WP_032949654.1|2543041_2544958_+	recombinase family protein	NA	Q6V7T7	Burkholderia_virus	30.5	3.3e-34
>prophage 200
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2550545	2551160	5064681		Bacillus_phage(100.0%)	1	NA	NA
WP_032949659.1|2550545_2551160_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	38.6	5.1e-05
>prophage 201
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2566438	2570743	5064681		Micromonas_pusilla_virus(50.0%)	4	NA	NA
WP_032949665.1|2566438_2567905_+	fructuronate reductase	NA	G9E6E2	Micromonas_pusilla_virus	28.8	2.9e-38
WP_032949666.1|2568024_2569011_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_032949667.1|2569046_2569760_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003027474.1|2570173_2570743_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	37.6	2.3e-12
>prophage 202
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2576511	2584144	5064681		Vibrio_phage(50.0%)	7	NA	NA
WP_032949671.1|2576511_2578101_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	31.8	4.7e-18
WP_085951589.1|2578104_2578449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003027494.1|2578782_2579973_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.4	1.4e-19
WP_003027496.1|2579988_2580696_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_003027498.1|2580846_2582607_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	5.4e-100
WP_003027502.1|2582731_2583016_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_003027504.1|2583136_2584144_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.6	1.0e-82
>prophage 203
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2587433	2587676	5064681		Klebsiella_phage(100.0%)	1	NA	NA
WP_003845150.1|2587433_2587676_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	1.7e-28
>prophage 204
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2594785	2595406	5064681		Bacillus_virus(100.0%)	1	NA	NA
WP_003027545.1|2594785_2595406_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	24.5	1.4e-10
>prophage 205
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2604208	2612757	5064681		uncultured_Caudovirales_phage(20.0%)	7	NA	NA
WP_032950910.1|2604208_2605456_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	49.3	1.8e-81
WP_016150682.1|2605418_2606855_-	magnesium transporter	NA	NA	NA	NA	NA
WP_032949677.1|2606960_2608604_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.8	2.8e-10
WP_047389279.1|2608679_2609330_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	34.3	3.7e-06
WP_032949679.1|2609329_2610394_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A2P1EL10	Moumouvirus	52.9	1.1e-18
WP_016150684.1|2610473_2611526_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_003027588.1|2611641_2612757_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.4	8.4e-115
>prophage 206
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2616945	2623181	5064681		Hokovirus(50.0%)	3	NA	NA
WP_003027595.1|2616945_2619792_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.2	3.2e-41
WP_032950913.1|2619960_2621799_+	two-component system sensor histidine kinase AtoS	NA	NA	NA	NA	NA
WP_032949680.1|2621795_2623181_+	acetoacetate metabolism transcriptional regulator AtoC	NA	Q6XM27	Feldmannia_irregularis_virus	28.8	4.0e-05
>prophage 207
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2627269	2636303	5064681		Pseudomonas_phage(40.0%)	6	NA	NA
WP_003027598.1|2627269_2629906_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.2	5.6e-93
WP_003027601.1|2630064_2630793_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_032949685.1|2631281_2633567_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.8	1.0e-284
WP_003027605.1|2633677_2634808_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	1.3e-174
WP_003027609.1|2634807_2635062_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	76.1	2.4e-25
WP_003839410.1|2635235_2636303_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	2.3e-08
>prophage 208
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2645415	2649520	5064681		Tupanvirus(66.67%)	3	NA	NA
WP_003027645.1|2645415_2646555_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.0	1.3e-30
WP_003027648.1|2646557_2647541_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.5	9.9e-35
WP_032949690.1|2647537_2649520_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.5	6.3e-20
>prophage 209
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2662191	2663196	5064681		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003839364.1|2662191_2663196_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.7	1.4e-28
>prophage 210
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2682114	2682714	5064681		Salmonella_phage(100.0%)	1	NA	NA
WP_003028083.1|2682114_2682714_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	3.1e-07
>prophage 211
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2696551	2697325	5064681		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003028114.1|2696551_2697325_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	27.7	3.6e-08
>prophage 212
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2701681	2703199	5064681		Mollivirus(100.0%)	1	NA	NA
WP_003028127.1|2701681_2703199_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.4e-88
>prophage 213
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2709696	2710833	5064681		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003028146.1|2709696_2710833_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.3	8.8e-19
>prophage 214
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2713843	2714620	5064681		Ralstonia_phage(50.0%)	2	NA	NA
WP_003028153.1|2713843_2714101_+	helix-turn-helix domain-containing protein	NA	A0A0M4UV99	Ralstonia_phage	53.8	2.3e-15
WP_032949705.1|2714251_2714620_+	C40 family peptidase	NA	H6SUH4	Campylobacter_virus	33.7	1.9e-07
>prophage 215
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2721170	2722256	5064681		Pandoravirus(100.0%)	1	NA	NA
WP_003028170.1|2721170_2722256_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.0	5.9e-89
>prophage 216
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2731444	2735287	5064681		Enterobacteria_phage(50.0%)	3	NA	NA
WP_003839292.1|2731444_2732386_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	89.3	7.5e-149
WP_003028217.1|2732584_2733214_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032949708.1|2733388_2735287_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.3	8.4e-14
>prophage 217
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2743345	2744266	5064681		Morganella_phage(100.0%)	1	NA	NA
WP_032949710.1|2743345_2744266_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.9	3.2e-75
>prophage 218
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2748743	2749478	5064681		Clostridioides_phage(100.0%)	1	NA	NA
WP_003028240.1|2748743_2749478_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.1	1.6e-13
>prophage 219
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2773452	2783319	5064681		Lactobacillus_phage(25.0%)	9	NA	NA
WP_003038106.1|2773452_2774379_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.6	7.5e-08
WP_032949735.1|2774468_2775467_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_003038102.1|2775463_2775682_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_032949736.1|2775683_2777699_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	2.9e-150
WP_032949737.1|2777770_2778778_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_003038094.1|2779008_2779770_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_003038091.1|2779933_2780905_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	3.3e-75
WP_003038086.1|2781288_2781546_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_003038080.1|2781591_2783319_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
>prophage 220
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2787229	2796714	5064681		Streptococcus_phage(20.0%)	11	NA	NA
WP_003838552.1|2787229_2788141_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	43.8	4.8e-60
WP_032949743.1|2788208_2789306_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	6.3e-30
WP_003038064.1|2789295_2790171_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_003038061.1|2790170_2791004_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_003038059.1|2791004_2792021_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_032949744.1|2792178_2792970_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.4	2.6e-17
WP_003838547.1|2793142_2794042_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.4	1.5e-24
WP_032949746.1|2794135_2794711_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_003038050.1|2794770_2795220_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_003038048.1|2795206_2795632_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_003038046.1|2795844_2796714_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	33.3	1.5e-18
>prophage 221
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2832593	2833307	5064681		Synechococcus_phage(100.0%)	1	NA	NA
WP_003037964.1|2832593_2833307_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	35.7	2.0e-37
>prophage 222
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2843110	2848708	5064681		Enterobacteria_phage(33.33%)	5	NA	NA
WP_003037932.1|2843110_2844400_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.7	1.7e-63
WP_003037929.1|2844496_2845123_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016150748.1|2845306_2846737_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_003838485.1|2847032_2848070_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.4	6.3e-72
WP_003037920.1|2848066_2848708_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
>prophage 223
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2855135	2861321	5064681		Escherichia_phage(33.33%)	5	NA	NA
WP_071524479.1|2855135_2855339_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	71.4	4.3e-17
WP_032937867.1|2855703_2856582_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_003037760.1|2856679_2858257_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_003037756.1|2858320_2859787_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	5.7e-87
WP_003037753.1|2859947_2861321_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	4.4e-41
>prophage 224
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2872682	2874224	5064681		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003037736.1|2872682_2874224_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.6	2.4e-160
>prophage 225
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2883201	2883633	5064681		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003037710.1|2883201_2883633_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	5.3e-17
>prophage 226
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2893010	2899365	5064681		Mycoplasma_phage(20.0%)	8	NA	NA
WP_003037696.1|2893010_2894294_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	35.4	9.9e-35
WP_003037694.1|2894355_2894556_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_003037690.1|2894567_2894903_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_003838439.1|2894904_2896755_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.9	1.4e-103
WP_003037683.1|2896770_2897286_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_003037681.1|2897394_2897718_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	9.2e-22
WP_002913991.1|2897738_2898125_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_003037677.1|2898150_2899365_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
>prophage 227
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2904985	2906494	5064681		Bacillus_virus(100.0%)	1	NA	NA
WP_016150762.1|2904985_2906494_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	4.6e-15
>prophage 228
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	2925786	3048891	5064681	plate,terminase,transposase,integrase,tail,holin,head,tRNA,portal,capsid	Cronobacter_phage(45.83%)	108	3011521:3011537	3055527:3055543
WP_003037627.1|2925786_2927040_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.9e-100
WP_003037624.1|2927366_2928557_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|2928658_2928997_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_003838398.1|2929057_2930395_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	34.1	1.4e-10
WP_032949809.1|2930391_2931135_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_127649073.1|2931157_2932588_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	1.2e-12
WP_032941156.1|2933224_2937112_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	5.0e-130
WP_003838390.1|2937368_2938919_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_071593187.1|2938931_2939468_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_003037603.1|2939485_2940121_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_032949814.1|2940124_2941489_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003037596.1|2941498_2942392_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_003037593.1|2942509_2943358_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003037590.1|2943413_2943674_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
WP_003037588.1|2943703_2944084_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_016150781.1|2944083_2944815_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003037583.1|2944826_2945555_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_032937937.1|2945689_2946595_-	GTPase Era	NA	NA	NA	NA	NA
WP_003037579.1|2946591_2947272_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	1.6e-20
WP_003037578.1|2947541_2948516_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003037577.1|2948531_2950331_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	3.8e-24
WP_003037576.1|2950601_2951066_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_032949816.1|2951062_2952019_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_003037574.1|2952018_2952669_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_003037573.1|2952700_2953276_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_049259737.1|2953272_2953437_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_003037572.1|2953700_2955323_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003037571.1|2955307_2956045_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_003037569.1|2956175_2957504_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.1	2.5e-41
WP_086504434.1|2957521_2958418_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032949823.1|2958520_2959108_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_003037563.1|2959187_2959571_-	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	70.9	3.6e-33
WP_003037561.1|2959888_2960578_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	49.3	7.9e-55
WP_032949825.1|2960611_2961691_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003037559.1|2961898_2962318_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.5	8.3e-15
WP_003037557.1|2962387_2963086_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_032949826.1|2963122_2965783_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_047389317.1|2965897_2967253_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003838356.1|2967297_2967621_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_032949828.1|2967617_2968916_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.0	3.1e-44
WP_003031249.1|2974912_2977486_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	1.5e-127
WP_003845843.1|2977615_2978347_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_003031246.1|2978343_2979324_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_003031245.1|2979455_2980193_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003031244.1|2980462_2980801_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001748131.1|2980958_2981345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072021790.1|2982345_2982678_-	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	55.0	1.0e-23
WP_047389669.1|2982783_2984484_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.4	9.9e-224
WP_003838080.1|2984486_2985032_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.1	3.0e-65
WP_047389334.1|2985003_2985729_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	54.8	2.1e-66
WP_052132586.1|2985718_2986177_-|tail	tail assembly chaperone	tail	Q2A0A8	Sodalis_phage	30.4	7.2e-12
WP_047389337.1|2986267_2988271_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	78.4	2.7e-148
WP_003838073.1|2988281_2988869_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	83.1	1.1e-92
WP_047389339.1|2988861_2990046_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	80.2	3.6e-180
WP_047389341.1|2990042_2990372_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	73.3	2.1e-37
WP_047389343.1|2990368_2992408_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.0	3.5e-252
WP_047389345.1|2992595_2992853_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.2	6.2e-21
WP_044713196.1|2992999_2993332_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	68.2	3.9e-36
WP_044713197.1|2993331_2993673_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	86.1	2.1e-45
WP_044713199.1|2993669_2993966_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_023185863.1|2993978_2994434_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.3e-58
WP_047389355.1|2994430_2995558_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	82.4	1.4e-173
WP_044713206.1|2995554_2996259_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	4.0e-70
WP_045719146.1|2996255_2996738_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_031602415.1|2996734_2997226_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000505908.1|2997280_2997472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047389360.1|2997490_2998189_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	2.3e-62
WP_047389363.1|2998199_2999219_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	73.5	7.1e-137
WP_047389365.1|2999253_3000072_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	51.4	1.0e-45
WP_047389367.1|3000215_3002000_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	70.2	9.3e-249
WP_047389368.1|3001996_3003016_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.8	6.7e-135
WP_044713218.1|3003015_3003345_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	58.2	1.5e-27
WP_047389371.1|3003614_3005375_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_047389373.1|3005436_3008094_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	46.7	5.6e-242
WP_044713224.1|3008133_3008352_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.7	1.8e-05
WP_047389374.1|3008354_3008924_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	47.9	5.2e-44
WP_044713225.1|3008939_3009260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047389376.1|3009293_3009581_-	regulatory protein	NA	NA	NA	NA	NA
WP_044713228.1|3009684_3009984_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	55.3	7.7e-23
WP_044713229.1|3010050_3011043_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.6	5.7e-107
WP_100250063.1|3011206_3011254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003826458.1|3011353_3012514_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
3011521:3011537	attL	GGACCGTCTGATTCAGT	NA	NA	NA	NA
WP_003031242.1|3012610_3013732_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_003031241.1|3013742_3014813_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	4.5e-89
WP_032949830.1|3015027_3015402_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_003839843.1|3015560_3016079_+	YfiR family protein	NA	NA	NA	NA	NA
WP_032949832.1|3016071_3017298_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.6	1.1e-06
WP_003839836.1|3017310_3017793_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914145.1|3017924_3018272_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003031232.1|3018311_3019079_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003031230.1|3019123_3019672_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003031228.1|3019690_3019939_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003031226.1|3020192_3021554_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003031224.1|3021719_3022511_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_008324538.1|3022529_3023819_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003031221.1|3023868_3024462_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003031220.1|3024584_3025463_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_032937967.1|3025548_3027210_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003826401.1|3027359_3027704_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_003839823.1|3027754_3028051_-	RnfH family protein	NA	NA	NA	NA	NA
WP_071524313.1|3028034_3028490_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_003031211.1|3028632_3029115_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.2e-28
WP_047389381.1|3029697_3040929_+	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_032949834.1|3041029_3042439_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_047389383.1|3042435_3044622_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.4	3.2e-17
WP_085951585.1|3044629_3045793_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032642877.1|3046433_3047675_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.8	2.6e-101
WP_101677551.1|3047782_3048891_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.4	1.0e-48
3055527:3055543	attR	GGACCGTCTGATTCAGT	NA	NA	NA	NA
>prophage 229
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3059539	3059755	5064681		Vibrio_phage(100.0%)	1	NA	NA
WP_032642895.1|3059539_3059755_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	39.0	2.3e-05
>prophage 230
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3073934	3075489	5064681		Yersinia_phage(50.0%)	3	NA	NA
WP_032642912.1|3073934_3074756_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.0	8.8e-45
WP_032642914.1|3074788_3075259_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_032642916.1|3075267_3075489_+	DUF987 domain-containing protein	NA	A0A0S2MXL3	Klebsiella_phage	44.3	4.6e-09
>prophage 231
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3080986	3085342	5064681		Escherichia_phage(100.0%)	1	NA	NA
WP_071993044.1|3080986_3085342_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	38.4	2.7e-148
>prophage 232
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3091388	3097211	5064681		Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
WP_003839789.1|3091388_3092936_-	sugar ABC transporter ATP-binding protein	NA	M1HXU1	Acanthocystis_turfacea_Chlorella_virus	22.1	7.3e-08
WP_032949851.1|3092987_3093917_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032949853.1|3093955_3094942_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_032949856.1|3095285_3097211_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.3	7.4e-26
>prophage 233
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3107407	3110650	5064681		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_032949863.1|3107407_3110650_-	transporter substrate-binding domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.3	1.6e-33
>prophage 234
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3121990	3127212	5064681		Tupanvirus(50.0%)	5	NA	NA
WP_032949866.1|3121990_3123007_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.5	4.7e-80
WP_003839743.1|3123053_3124445_-	DUF4832 domain-containing protein	NA	NA	NA	NA	NA
WP_003845996.1|3124476_3124884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003037168.1|3124886_3125999_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_032949867.1|3126000_3127212_-	glycosyltransferase family 4 protein	NA	A0A2P0VNG4	Tetraselmis_virus	31.6	5.0e-12
>prophage 235
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3153718	3154432	5064681		Bacillus_virus(100.0%)	1	NA	NA
WP_003037218.1|3153718_3154432_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.1	3.1e-14
>prophage 236
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3158434	3162455	5064681		Klosneuvirus(50.0%)	4	NA	NA
WP_032949880.1|3158434_3159718_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	4.8e-29
WP_003839698.1|3159860_3161261_+	GABA permease	NA	NA	NA	NA	NA
WP_003037236.1|3161306_3161993_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_003037241.1|3162005_3162455_-	peptidoglycan-binding protein LysM	NA	A0A1V0DZX0	Clostridioides_phage	38.2	3.7e-05
>prophage 237
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3168216	3173513	5064681		Lactobacillus_phage(20.0%)	5	NA	NA
WP_003846033.1|3168216_3168462_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.5	2.9e-12
WP_003037273.1|3168458_3168869_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.0	6.6e-17
WP_032949887.1|3168841_3170986_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.9	8.1e-199
WP_032949888.1|3170996_3171956_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.5	6.5e-132
WP_003037282.1|3172310_3173513_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.1	1.9e-27
>prophage 238
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3188029	3193450	5064681	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|3188029_3188215_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_003037323.1|3188452_3191080_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.8	8.4e-81
WP_003037326.1|3191208_3191709_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003037330.1|3191795_3192860_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	4.0e-114
WP_003037333.1|3192952_3193450_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	2.6e-31
>prophage 239
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3199010	3199976	5064681		Tetraselmis_virus(100.0%)	1	NA	NA
WP_032949898.1|3199010_3199976_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	4.0e-36
>prophage 240
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3228872	3235210	5064681	holin	Pithovirus(33.33%)	6	NA	NA
WP_003840297.1|3228872_3229688_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	W5SAS9	Pithovirus	28.1	1.2e-12
WP_003037433.1|3229690_3230548_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_003037436.1|3230544_3231396_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_003037438.1|3232141_3232492_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_008322725.1|3232488_3232818_+	multidrug efflux SMR transporter	NA	E5EPE2	Acinetobacter_phage	33.0	4.2e-06
WP_003840305.1|3232831_3235210_+|holin	choline trimethylamine-lyase	holin	A0A2C9CWX5	Yersinia_phage	37.5	8.1e-06
>prophage 241
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3243785	3246347	5064681		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_032949913.1|3243785_3246347_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	2.0e-31
>prophage 242
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3249821	3253525	5064681		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_047389401.1|3249821_3250814_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	38.0	2.1e-32
WP_003840324.1|3250876_3252004_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	5.0e-06
WP_003034172.1|3252143_3252770_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.6	4.4e-36
WP_003825728.1|3252763_3253525_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.7	2.5e-57
>prophage 243
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3256698	3258731	5064681		Tupanvirus(50.0%)	2	NA	NA
WP_003034157.1|3256698_3257304_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.9	6.1e-27
WP_032949919.1|3257303_3258731_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	25.6	1.8e-32
>prophage 244
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3266080	3266752	5064681		Vibrio_phage(100.0%)	1	NA	NA
WP_003034139.1|3266080_3266752_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
>prophage 245
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3270114	3273138	5064681		Streptococcus_phage(50.0%)	2	NA	NA
WP_003034129.1|3270114_3271413_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.9	1.4e-129
WP_003034127.1|3271500_3273138_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	6.7e-153
>prophage 246
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3276612	3319187	5064681	plate,transposase,tail,head,protease	Shigella_phage(50.0%)	53	NA	NA
WP_032949930.1|3276612_3277911_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	4.1e-36
WP_032949931.1|3277968_3280725_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.5	1.3e-52
WP_032949933.1|3280768_3281911_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.7	3.7e-49
WP_003034111.1|3281992_3283333_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_032949935.1|3283353_3284694_-	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	23.9	4.5e-06
WP_052132588.1|3285795_3286302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047389403.1|3286528_3286774_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	50.8	3.0e-09
WP_172730100.1|3286766_3288758_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	48.1	1.9e-162
WP_047389405.1|3288825_3289776_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	42.1	1.4e-54
WP_047389407.1|3289772_3290012_+	hypothetical protein	NA	A0A0C4UQY4	Shigella_phage	40.8	4.6e-10
WP_047389409.1|3290015_3290264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389411.1|3290253_3290778_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	77.0	1.5e-69
WP_052132589.1|3290862_3291129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389415.1|3291121_3291604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389417.1|3291600_3292041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389420.1|3292037_3292286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052132590.1|3292282_3293089_+	hypothetical protein	NA	A0A1W6JPA7	Morganella_phage	36.8	4.5e-09
WP_047389421.1|3293088_3293301_+	hypothetical protein	NA	O64352	Escherichia_phage	65.1	1.1e-07
WP_047389422.1|3293297_3293744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389423.1|3293733_3294231_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	44.0	3.5e-28
WP_047389424.1|3294271_3294706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389425.1|3294777_3295197_+	positive regulator of late transcription	NA	A0A0C4UQZ9	Shigella_phage	65.9	5.9e-45
WP_172730103.1|3295320_3295815_+	lysozyme	NA	C9DGM9	Escherichia_phage	73.1	6.4e-67
WP_071698591.1|3295801_3296188_+	hypothetical protein	NA	A0A0C4UR28	Shigella_phage	47.6	2.1e-20
WP_157843604.1|3296346_3296544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052132598.1|3296563_3296842_+	DUF2730 family protein	NA	C9DGN2	Escherichia_phage	69.6	1.4e-31
WP_080753842.1|3296841_3297129_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	84.2	1.6e-38
WP_047389432.1|3297138_3297717_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	80.7	7.8e-80
WP_047389434.1|3297725_3297905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389436.1|3297895_3298087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052132591.1|3298083_3299757_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	82.4	8.7e-265
WP_047389438.1|3299756_3301292_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	75.8	6.2e-225
WP_047389440.1|3301275_3302607_+|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	72.1	4.6e-184
WP_047389442.1|3302726_3303185_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	63.9	1.9e-49
WP_047389685.1|3303384_3304494_+|protease	protease	protease	C9DGP0	Escherichia_phage	64.3	3.9e-120
WP_047389444.1|3304490_3305411_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	73.2	4.8e-132
WP_172730101.1|3305483_3305954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389446.1|3305953_3306376_+	DUF1320 family protein	NA	A0A0C4UR02	Shigella_phage	62.1	1.9e-43
WP_047389447.1|3306375_3306909_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	71.0	1.3e-73
WP_047389448.1|3306905_3307124_+	DUF2635 domain-containing protein	NA	A0A0C4UR31	Shigella_phage	62.7	1.0e-08
WP_047389452.1|3307120_3308635_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	65.7	4.0e-184
WP_047389454.1|3308644_3309001_+|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	70.3	4.7e-43
WP_052132592.1|3309010_3309466_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	62.7	6.6e-42
WP_047389456.1|3309595_3311548_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	44.8	2.9e-134
WP_047389458.1|3311559_3312990_+	DNA circularization protein	NA	A0A0C4UR32	Shigella_phage	46.8	1.1e-95
WP_047389460.1|3312982_3314116_+|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	67.1	1.2e-140
WP_047389461.1|3314112_3314703_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	61.7	4.0e-63
WP_047389463.1|3314699_3315137_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	69.0	6.8e-52
WP_047389464.1|3315138_3316221_+|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	56.0	5.0e-112
WP_047389466.1|3316211_3316796_+	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	40.9	4.7e-32
WP_052132593.1|3316808_3317930_+	hypothetical protein	NA	A0A0C4UQS2	Shigella_phage	40.3	1.6e-17
WP_047389468.1|3317931_3318363_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	58.3	1.1e-41
WP_047389470.1|3318617_3319187_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	71.4	1.0e-71
>prophage 247
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3323678	3324527	5064681		Vibrio_phage(100.0%)	1	NA	NA
WP_003034084.1|3323678_3324527_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.3	1.8e-40
>prophage 248
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3329441	3330197	5064681		Bacillus_phage(100.0%)	1	NA	NA
WP_003846524.1|3329441_3330197_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	28.7	3.9e-07
>prophage 249
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3336948	3338448	5064681		Bacillus_virus(100.0%)	1	NA	NA
WP_003034052.1|3336948_3338448_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	4.6e-15
>prophage 250
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3346682	3362247	5064681	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_032949945.1|3346682_3347888_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.2	7.3e-72
WP_032949947.1|3347887_3348334_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_003846496.1|3348411_3349218_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	2.2e-16
WP_032949948.1|3349352_3350450_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_003034016.1|3351051_3352305_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	2.7e-13
WP_003034012.1|3352539_3353871_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_032949949.1|3353994_3355824_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	34.4	1.9e-18
WP_032949950.1|3355820_3359366_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.1	1.5e-08
WP_003034003.1|3359358_3362247_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.9	2.0e-67
>prophage 251
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3367727	3374551	5064681		Cronobacter_phage(33.33%)	6	NA	NA
WP_003033990.1|3367727_3368522_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.0	1.9e-116
WP_032949954.1|3368528_3369404_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_032949956.1|3369592_3371839_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.6	5.1e-10
WP_003033982.1|3371851_3372382_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032949959.1|3373066_3373762_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_032949961.1|3373837_3374551_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	4.1e-46
>prophage 252
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3381128	3382139	5064681		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032949969.1|3381128_3382139_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.4	3.3e-33
>prophage 253
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3385777	3388273	5064681		Aichi_virus(50.0%)	2	NA	NA
WP_003840970.1|3385777_3387196_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.7	5.1e-24
WP_003033923.1|3387511_3388273_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	2.6e-19
>prophage 254
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3403020	3403626	5064681		Canarypox_virus(100.0%)	1	NA	NA
WP_003033877.1|3403020_3403626_-	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	26.9	3.2e-07
>prophage 255
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3415480	3416302	5064681		Yersinia_phage(100.0%)	1	NA	NA
WP_014226750.1|3415480_3416302_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.9	9.8e-44
>prophage 256
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3428514	3429195	5064681		Bacillus_phage(100.0%)	1	NA	NA
WP_032950013.1|3428514_3429195_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.1	2.1e-31
>prophage 257
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3433971	3435998	5064681		Morganella_phage(50.0%)	3	NA	NA
WP_024360479.1|3433971_3434880_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.4	3.2e-72
WP_024360478.1|3435063_3435252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446196.1|3435764_3435998_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	56.6	1.1e-16
>prophage 258
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3445492	3451674	5064681		Morganella_phage(33.33%)	8	NA	NA
WP_000203924.1|3445492_3445711_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	65.7	3.4e-20
WP_010434226.1|3445979_3446207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023303013.1|3446770_3447175_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_014226777.1|3447573_3448425_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.0	1.5e-47
WP_014226778.1|3448451_3449441_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014226779.1|3449465_3450359_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032950021.1|3450507_3451299_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014226781.1|3451422_3451674_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	57.7	2.0e-08
>prophage 259
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3454739	3455908	5064681	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_100216202.1|3454739_3455908_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
>prophage 260
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3461476	3483957	5064681	integrase,tRNA,tail	Enterobacteria_phage(16.67%)	26	3469472:3469486	3479192:3479206
WP_047389488.1|3461476_3464374_-|tail	phage tail length tape measure family protein	tail	Q5G8W8	Enterobacteria_phage	50.0	2.8e-101
WP_000436982.1|3464383_3464704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651577.1|3464703_3464874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032645662.1|3465045_3465420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047389492.1|3465517_3465793_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_047389493.1|3465804_3466239_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_047389495.1|3466577_3469334_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.6	1.2e-298
WP_047389497.1|3469326_3469665_-	prophage protein	NA	A0A1B5FPL8	Escherichia_phage	64.5	1.5e-35
3469472:3469486	attL	TTCAGCGCTTCCAGC	NA	NA	NA	NA
WP_047389498.1|3469674_3470301_-	prophage protein	NA	NA	NA	NA	NA
WP_047389500.1|3470297_3470498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047389501.1|3470494_3470758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047389503.1|3471455_3471965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047389505.1|3471961_3472141_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_047389507.1|3472133_3472943_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	42.8	5.1e-29
WP_047389509.1|3472956_3473391_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	51.4	2.6e-27
WP_024133422.1|3473390_3473588_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.4	6.6e-07
WP_134932720.1|3473836_3474274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000884061.1|3474312_3474630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001131482.1|3474766_3475993_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.9	5.0e-145
WP_003026902.1|3476310_3477069_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	37.3	3.2e-09
WP_032948043.1|3477235_3477790_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003026911.1|3477867_3479385_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	1.3e-86
3479192:3479206	attR	TTCAGCGCTTCCAGC	NA	NA	NA	NA
WP_096878465.1|3479394_3480493_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_032950023.1|3480584_3482318_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	1.1e-60
WP_003825520.1|3482323_3483037_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_003026928.1|3483060_3483957_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	27.9	2.5e-29
>prophage 261
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3488656	3493862	5064681		Pandoravirus(50.0%)	3	NA	NA
WP_032950025.1|3488656_3490090_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	25.5	1.1e-29
WP_032950028.1|3490183_3490927_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032950030.1|3490988_3493862_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.0	3.4e-261
>prophage 262
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3501789	3503022	5064681		Catovirus(100.0%)	1	NA	NA
WP_003026984.1|3501789_3503022_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.6	4.1e-102
>prophage 263
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3520531	3521215	5064681		Bacillus_virus(100.0%)	1	NA	NA
WP_032950052.1|3520531_3521215_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	24.1	3.4e-10
>prophage 264
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3533986	3605762	5064681	transposase,integrase,tRNA,protease	Enterobacteria_phage(20.0%)	59	3544612:3544627	3611564:3611579
WP_003027071.1|3533986_3535141_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	5.3e-128
WP_003027074.1|3535540_3536935_+	galactose/proton symporter	NA	O13311	Aichi_virus	25.5	1.4e-26
WP_003838223.1|3537012_3537510_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_016150969.1|3537604_3538312_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_003027080.1|3538386_3539118_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_003027083.1|3539137_3540085_+	glutathione synthase	NA	NA	NA	NA	NA
WP_003027086.1|3540196_3540760_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_003027087.1|3540759_3541176_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_032950062.1|3541172_3542153_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_047389522.1|3542170_3542875_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003027097.1|3542893_3543460_+	YggT family protein	NA	NA	NA	NA	NA
WP_003027101.1|3543456_3543747_+	YggU family protein	NA	NA	NA	NA	NA
WP_003027104.1|3543754_3544348_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_032950063.1|3544340_3545477_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
3544612:3544627	attL	CCGCAGATGCAGAAAT	NA	NA	NA	NA
WP_003027108.1|3545592_3546639_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_032950065.1|3546827_3547547_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_003027115.1|3547596_3547923_-	YggL family protein	NA	NA	NA	NA	NA
WP_003027117.1|3547922_3548642_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_032950950.1|3548802_3549855_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003027126.1|3549882_3550152_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_008321260.1|3550238_3551324_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
WP_003027130.1|3551535_3552792_+	nucleoside permease	NA	NA	NA	NA	NA
WP_047389526.1|3552844_3554980_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_003838201.1|3555448_3556156_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_016154414.1|3556512_3557703_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	54.7	1.5e-122
WP_032950067.1|3558104_3559127_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016154416.1|3559695_3560919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016154417.1|3560915_3561404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016154418.1|3561400_3563362_+	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_016154424.1|3567387_3568125_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	32.6	9.7e-27
WP_016154425.1|3568551_3568764_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_016154426.1|3569088_3569262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016154429.1|3570173_3571541_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_016154430.1|3571717_3572170_+	peptide deformylase	NA	Q6VT21	Vibrio_phage	32.6	7.8e-11
WP_023302365.1|3573215_3576656_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023336667.1|3576805_3577240_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_023302364.1|3577459_3578407_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_025887108.1|3578719_3578983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071532327.1|3578972_3579377_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047389714.1|3579469_3581995_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.8	3.9e-144
WP_032950071.1|3582076_3582529_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_016154433.1|3582618_3583083_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_009654818.1|3583096_3585592_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.6	2.0e-92
WP_032950072.1|3585777_3586788_+	cation diffusion facilitator family transporter	NA	A0A1V0SED0	Indivirus	25.1	7.8e-19
WP_016154435.1|3586833_3587196_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016154436.1|3587580_3587829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009654821.1|3588109_3590248_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016154438.1|3591524_3592151_+	hypothetical protein	NA	A0A2H4J137	uncultured_Caudovirales_phage	42.6	5.7e-44
WP_032950075.1|3592143_3593280_+	hypothetical protein	NA	A0A2H4J138	uncultured_Caudovirales_phage	43.3	7.3e-74
WP_001572362.1|3593744_3594767_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032443218.1|3597333_3597543_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_087728540.1|3598160_3599311_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.6	9.8e-50
WP_016154441.1|3600292_3600643_-	DUF3147 family protein	NA	NA	NA	NA	NA
WP_009652456.1|3600933_3601146_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_104009829.1|3601158_3601392_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	80.0	5.8e-10
WP_009652407.1|3601643_3602606_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_009652460.1|3602609_3603038_+	universal stress protein	NA	NA	NA	NA	NA
WP_023336652.1|3603053_3604340_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	53.8	6.3e-122
WP_016154442.1|3605387_3605762_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	61.0	2.8e-30
3611564:3611579	attR	CCGCAGATGCAGAAAT	NA	NA	NA	NA
>prophage 265
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3634253	3635816	5064681		Yersinia_phage(50.0%)	3	NA	NA
WP_009652424.1|3634253_3635072_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	35.7	3.1e-42
WP_009652519.1|3635071_3635326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045890390.1|3635354_3635816_+	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	33.3	1.4e-10
>prophage 266
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3652179	3653820	5064681		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003024493.1|3652179_3653820_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.7	7.5e-11
>prophage 267
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3663515	3668761	5064681		Staphylococcus_phage(33.33%)	4	NA	NA
WP_032950116.1|3663515_3664343_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.6	3.2e-63
WP_003024523.1|3664531_3665986_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_003024529.1|3666030_3666486_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	34.7	2.1e-19
WP_003024532.1|3666589_3668761_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.3e-103
>prophage 268
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3672869	3675645	5064681		Bacillus_virus(50.0%)	2	NA	NA
WP_003024543.1|3672869_3675128_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.5	4.4e-86
WP_003024544.1|3675246_3675645_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	43.9	9.9e-18
>prophage 269
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3678944	3687041	5064681		Bacillus_virus(25.0%)	8	NA	NA
WP_003024571.1|3678944_3680837_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.0e-92
WP_003024575.1|3680865_3681447_-	esterase YqiA	NA	NA	NA	NA	NA
WP_003838143.1|3681446_3682274_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_003024582.1|3682298_3682721_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_003024585.1|3682717_3683350_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	34.7	1.2e-20
WP_032937374.1|3683555_3685040_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_032950122.1|3685197_3685875_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.4	9.9e-34
WP_003024594.1|3685880_3687041_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	5.0e-86
>prophage 270
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3692732	3693386	5064681		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032950128.1|3692732_3693386_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	1.4e-45
>prophage 271
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3696984	3698418	5064681		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_032950130.1|3696984_3698418_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.8	1.7e-38
>prophage 272
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3703668	3704910	5064681		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_003024653.1|3703668_3704910_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.3	2.4e-94
>prophage 273
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3716264	3810783	5064681	plate,terminase,transposase,integrase,tail,holin,head,tRNA,portal,capsid	Cronobacter_phage(61.36%)	78	3725833:3725879	3757743:3757789
WP_003024694.1|3716264_3717278_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	7.4e-110
WP_001144069.1|3717514_3717730_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003024697.1|3717967_3719713_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.4e-77
WP_003024699.1|3720072_3721920_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_157676228.1|3721932_3722133_-	DUF3156 family protein	NA	NA	NA	NA	NA
WP_032950147.1|3722081_3723131_+	YncE family protein	NA	NA	NA	NA	NA
WP_032950149.1|3723141_3725139_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.2	1.9e-08
WP_003024707.1|3725169_3725676_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3725833:3725879	attL	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAA	NA	NA	NA	NA
WP_032950187.1|3726077_3726845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032950189.1|3727413_3727650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032950191.1|3727826_3728159_-	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	53.2	2.9e-23
WP_032950966.1|3728264_3729965_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.4	5.8e-224
WP_032950193.1|3729967_3730513_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.5	1.1e-64
WP_032950195.1|3730484_3731210_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	54.8	4.7e-66
WP_032950197.1|3731199_3731733_-|tail	tail assembly chaperone	tail	F1BUK2	Cronobacter_phage	36.4	4.4e-21
WP_032950199.1|3731745_3733749_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	78.1	1.5e-146
WP_032950200.1|3733759_3734347_-	protein phage	NA	F1BUK5	Cronobacter_phage	83.1	4.0e-92
WP_021293733.1|3734339_3735524_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	80.4	1.7e-182
WP_032950202.1|3735520_3735850_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.9	6.0e-37
WP_032950204.1|3735846_3737907_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.2	5.8e-271
WP_032950205.1|3738094_3738352_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	57.3	2.9e-18
WP_032950211.1|3738456_3738837_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	64.0	1.4e-29
WP_032950212.1|3738836_3739178_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	2.0e-51
WP_001738730.1|3739164_3739467_-|holin	phage holin family protein	holin	A0A0M5M1H1	Salmonella_phage	55.3	1.4e-19
WP_000044253.1|3739477_3739933_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.8	5.9e-59
WP_032950213.1|3739929_3741057_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	81.6	8.9e-173
WP_032950215.1|3741053_3741761_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	75.2	3.1e-99
WP_021293728.1|3741757_3742264_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	68.7	6.2e-65
WP_032950216.1|3742260_3742749_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.5e-63
WP_032950218.1|3742809_3743511_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	69.4	3.5e-90
WP_032950220.1|3743514_3744537_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.8	1.8e-159
WP_032950222.1|3744598_3745402_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	57.9	2.0e-78
WP_032950223.1|3745563_3747339_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.4	3.4e-291
WP_032950224.1|3747335_3748397_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.1	3.5e-163
WP_012602735.1|3748393_3748717_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	93.3	4.7e-50
WP_000364823.1|3748690_3748897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032950225.1|3749016_3751041_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.8	5.9e-300
WP_032950227.1|3751033_3751246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032950229.1|3751242_3752112_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	80.3	1.6e-129
WP_032950231.1|3752101_3752431_-	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	46.8	1.1e-11
WP_032950234.1|3752421_3752655_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_003838010.1|3752722_3753124_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	2.2e-49
WP_047389555.1|3753123_3753552_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	59.0	1.3e-31
WP_001738706.1|3753563_3753737_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_021293717.1|3753746_3754250_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	4.5e-60
WP_021293716.1|3754280_3754502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032950238.1|3754643_3755225_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	37.8	6.3e-29
WP_032950239.1|3755241_3755808_+	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	32.2	7.5e-19
WP_032950241.1|3755811_3756831_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.7	1.4e-121
WP_032950242.1|3756827_3757625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127649302.1|3758262_3758931_-	hypothetical protein	NA	NA	NA	NA	NA
3757743:3757789	attR	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAA	NA	NA	NA	NA
WP_032950251.1|3759404_3760256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032950253.1|3760330_3761506_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032950255.1|3761502_3763695_-	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.1	1.4e-17
WP_047389559.1|3763875_3781923_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_050593581.1|3782051_3783332_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000019445.1|3783587_3784568_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_071524484.1|3785472_3785796_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_032950257.1|3785909_3787721_-	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_003024721.1|3787731_3788160_-	diol dehydratase small subunit	NA	NA	NA	NA	NA
WP_003024724.1|3788162_3788747_-	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
WP_032950258.1|3788758_3790426_-	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
WP_003024730.1|3790818_3791247_+	heme-binding protein	NA	NA	NA	NA	NA
WP_003024734.1|3791269_3792433_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_032950260.1|3792449_3792803_+	glycerol dehydratase reactivase beta/small subunit family protein	NA	NA	NA	NA	NA
WP_003841452.1|3792803_3793334_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_032950263.1|3793311_3795237_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_032950265.1|3795328_3796426_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_032950267.1|3796988_3798647_+	glycerone kinase	NA	NA	NA	NA	NA
WP_003846231.1|3798736_3799891_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.8	1.6e-84
WP_003024755.1|3799958_3800807_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032950269.1|3800803_3801586_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_162138602.1|3801822_3802500_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003024763.1|3802553_3804074_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	49.3	2.9e-33
WP_168150126.1|3804504_3805884_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.7	2.6e-33
WP_003024768.1|3805957_3806290_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_003024771.1|3806499_3807483_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_032950271.1|3807690_3810783_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	3.8e-157
>prophage 274
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3821804	3822773	5064681		Escherichia_phage(100.0%)	1	NA	NA
WP_003828551.1|3821804_3822773_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	31.8	3.5e-32
>prophage 275
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3843223	3845518	5064681		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003024871.1|3843223_3845518_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.4	5.3e-156
>prophage 276
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3851760	3852906	5064681		Streptococcus_phage(100.0%)	1	NA	NA
WP_003024885.1|3851760_3852906_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.2	5.3e-48
>prophage 277
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3861470	3862577	5064681		Bacillus_phage(100.0%)	1	NA	NA
WP_003024911.1|3861470_3862577_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	W8CYL7	Bacillus_phage	29.6	7.0e-13
>prophage 278
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3874430	3880519	5064681		Streptococcus_phage(33.33%)	8	NA	NA
WP_003024942.1|3874430_3875294_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	5.6e-50
WP_003839987.1|3875357_3877409_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_003024946.1|3877366_3877762_+	YraN family protein	NA	NA	NA	NA	NA
WP_003024948.1|3877796_3878387_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	3.2e-12
WP_003024954.1|3878396_3878972_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_032950303.1|3879065_3879701_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003839984.1|3879738_3880167_-	YhbP family protein	NA	NA	NA	NA	NA
WP_003024963.1|3880219_3880519_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	54.5	2.5e-13
>prophage 279
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3886291	3888220	5064681		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_032950310.1|3886291_3888220_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	4.6e-52
>prophage 280
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3893811	3900456	5064681		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_003024990.1|3893811_3896502_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	2.5e-24
WP_003024992.1|3896526_3898014_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003024996.1|3898042_3898495_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003024998.1|3899112_3900456_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	4.8e-64
>prophage 281
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3906284	3909166	5064681	protease	Pandoravirus(50.0%)	2	NA	NA
WP_032950318.1|3906284_3907133_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.9	3.9e-19
WP_003025013.1|3907231_3909166_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	4.1e-117
>prophage 282
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3915859	3917338	5064681		Indivirus(50.0%)	2	NA	NA
WP_003025033.1|3915859_3916831_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.2	1.6e-08
WP_003839952.1|3917053_3917338_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	65.7	6.0e-17
>prophage 283
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3921442	3935579	5064681		Staphylococcus_phage(25.0%)	16	NA	NA
WP_003025057.1|3921442_3922243_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.6	9.6e-20
WP_003839941.1|3922458_3923436_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_003025063.1|3923449_3924436_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_003025065.1|3924456_3925023_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.3	4.2e-54
WP_003025068.1|3925019_3925595_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003025070.1|3925563_3926112_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_003025073.1|3926118_3926844_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_003025074.1|3926890_3928324_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003025078.1|3928346_3928634_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
WP_003025083.1|3928717_3929209_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003025085.1|3929254_3930109_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_003025086.1|3930105_3930378_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_003025087.1|3930508_3931228_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_003025088.1|3931224_3931878_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_003844840.1|3932107_3934444_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.8	1.7e-40
WP_100280240.1|3934649_3935579_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	32.8	6.7e-17
>prophage 284
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3942354	3943437	5064681		Salmonella_phage(100.0%)	1	NA	NA
WP_003025099.1|3942354_3943437_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	90.0	2.2e-75
>prophage 285
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3947599	3949090	5064681		Burkholderia_virus(100.0%)	1	NA	NA
WP_032950325.1|3947599_3949090_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	24.2	1.1e-08
>prophage 286
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3952929	3953433	5064681	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_003025130.1|3952929_3953433_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	7.3e-26
>prophage 287
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3957335	3958703	5064681	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003025151.1|3957335_3958703_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	2.5e-20
>prophage 288
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3976346	3977390	5064681		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3976346_3977390_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 289
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3989204	3990089	5064681		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_032950337.1|3989204_3990089_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	3.6e-28
>prophage 290
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	3996696	4000852	5064681		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_003025295.1|3996696_3997722_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	9.0e-71
WP_032950346.1|3997791_3998973_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032950347.1|3998982_4000086_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003025300.1|4000093_4000852_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.1e-20
>prophage 291
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4011308	4012780	5064681	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_003031159.1|4011308_4011818_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_003031157.1|4011832_4012780_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.8	2.0e-08
>prophage 292
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4032679	4038251	5064681		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_003031109.1|4032679_4033864_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
WP_003023659.1|4033933_4036048_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.1	6.2e-58
WP_003023657.1|4036144_4036615_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003023654.1|4036710_4037085_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003023651.1|4037210_4037498_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	39.2	2.4e-05
WP_003023649.1|4037505_4037865_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_003023646.1|4037864_4038251_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.6	6.7e-19
>prophage 293
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4044007	4049295	5064681		Tupanvirus(25.0%)	4	NA	NA
WP_003847948.1|4044007_4045909_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.9	1.5e-74
WP_032950363.1|4046018_4047509_-	nicotinate phosphoribosyltransferase	NA	A0A218KC49	Bacillus_phage	52.2	2.8e-142
WP_032950364.1|4047523_4048384_-	ribose-phosphate pyrophosphokinase	NA	G0X553	Salmonella_phage	40.6	2.5e-50
WP_032950365.1|4048575_4049295_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	28.4	2.5e-19
>prophage 294
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4053030	4057076	5064681		environmental_Halophage(33.33%)	3	NA	NA
WP_003023605.1|4053030_4055118_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	89.1	5.5e-67
WP_003023603.1|4055209_4056427_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.2	5.7e-32
WP_003023601.1|4056512_4057076_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	57.1	3.5e-61
>prophage 295
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4076099	4076936	5064681		Vibrio_phage(100.0%)	1	NA	NA
WP_003023558.1|4076099_4076936_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	8.4e-67
>prophage 296
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4093828	4097600	5064681		Bacillus_phage(66.67%)	3	NA	NA
WP_003023529.1|4093828_4095451_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	8.1e-143
WP_003023527.1|4095525_4096878_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	4.3e-12
WP_135953044.1|4096874_4097600_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 297
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4104158	4105109	5064681	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_032950397.1|4104158_4105109_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.0	5.4e-70
>prophage 298
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4111107	4113501	5064681		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_032950405.1|4111107_4113501_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	7.3e-15
>prophage 299
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4120750	4123198	5064681		Dickeya_phage(100.0%)	1	NA	NA
WP_003023492.1|4120750_4123198_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 300
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4147394	4149205	5064681		Enterococcus_phage(50.0%)	2	NA	NA
WP_032950427.1|4147394_4148138_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	3.7e-10
WP_032950429.1|4148134_4149205_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	4.4e-20
>prophage 301
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4152597	4155188	5064681		Streptococcus_phage(33.33%)	5	NA	NA
WP_032937237.1|4152597_4152966_-	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	29.5	4.6e-09
WP_032937236.1|4152962_4153184_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003023442.1|4153305_4153587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003827581.1|4153689_4154403_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.1	3.7e-15
WP_003023438.1|4154420_4155188_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	3.7e-13
>prophage 302
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4160931	4163761	5064681		Salicola_phage(50.0%)	3	NA	NA
WP_003023425.1|4160931_4161786_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	7.0e-45
WP_003023423.1|4162041_4163100_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_003023420.1|4163092_4163761_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.5e-13
>prophage 303
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4167029	4171102	5064681		Dickeya_phage(50.0%)	4	NA	NA
WP_003827558.1|4167029_4167656_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.3e-29
WP_032950434.1|4167730_4169929_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.6	6.1e-117
WP_003023404.1|4170022_4170268_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	4.7e-10
WP_003837818.1|4170436_4171102_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	54.9	3.3e-58
>prophage 304
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4176446	4179194	5064681		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_032950440.1|4176446_4179194_-	ribosome-associated ATPase/putative transporter RbbA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.6	6.6e-20
>prophage 305
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4190704	4192747	5064681		Indivirus(100.0%)	1	NA	NA
WP_050593562.1|4190704_4192747_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.3	1.2e-45
>prophage 306
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4224687	4226672	5064681		Bacillus_virus(50.0%)	2	NA	NA
WP_003024319.1|4224687_4225692_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	2.5e-17
WP_032950483.1|4225688_4226672_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.5e-14
>prophage 307
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4236573	4238907	5064681		Escherichia_phage(100.0%)	1	NA	NA
WP_032950487.1|4236573_4238907_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.9	1.3e-72
>prophage 308
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4244051	4246958	5064681		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_032950490.1|4244051_4245026_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	27.0	6.4e-18
WP_003024276.1|4245084_4245795_-	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_003024273.1|4246175_4246466_+	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_000014594.1|4246745_4246958_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 309
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4251365	4252361	5064681		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_032950987.1|4251365_4252361_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.8	4.5e-11
>prophage 310
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4282151	4283996	5064681		Tupanvirus(100.0%)	1	NA	NA
WP_003024195.1|4282151_4283996_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.9	1.4e-13
>prophage 311
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4301395	4310766	5064681		Rhizobium_phage(20.0%)	9	NA	NA
WP_003024152.1|4301395_4301647_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
WP_003024148.1|4301699_4302131_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_032950516.1|4302379_4303924_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003837638.1|4303933_4305217_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.8e-07
WP_003024138.1|4305220_4306156_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_003024135.1|4306156_4307194_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003024132.1|4307386_4308412_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	2.3e-18
WP_032950517.1|4308421_4309618_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	5.4e-35
WP_003827312.1|4309833_4310766_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.1	1.0e-36
>prophage 312
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4316160	4318143	5064681		Archaeal_BJ1_virus(100.0%)	2	NA	NA
WP_003837619.1|4316160_4317105_+	hypothetical protein	NA	A0ZYL4	Archaeal_BJ1_virus	28.3	5.8e-16
WP_032950527.1|4317135_4318143_-	LPS 1,2-glucosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.2e-11
>prophage 313
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4322868	4327431	5064681		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_003024099.1|4322868_4323348_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.2	6.3e-27
WP_003024097.1|4323386_4324196_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.6	3.1e-26
WP_003024094.1|4324294_4324462_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003024071.1|4324482_4324719_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003837605.1|4324937_4325603_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_100280309.1|4325774_4326995_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	9.4e-43
WP_006687626.1|4326972_4327431_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.6e-48
>prophage 314
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4331512	4336540	5064681		Pseudomonas_phage(33.33%)	4	NA	NA
WP_032950536.1|4331512_4333192_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.9	2.1e-24
WP_003024042.1|4333453_4334077_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.2e-19
WP_000135058.1|4334131_4334407_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_032950538.1|4334425_4336540_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 315
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4340794	4342186	5064681		environmental_Halophage(100.0%)	1	NA	NA
WP_003024026.1|4340794_4342186_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	95.9	2.5e-68
>prophage 316
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4354638	4360280	5064681		Wolbachia_phage(50.0%)	5	NA	NA
WP_032950545.1|4354638_4355676_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.3	3.1e-71
WP_032950546.1|4356076_4356697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071993049.1|4356733_4356901_-	DUF3950 domain-containing protein	NA	NA	NA	NA	NA
WP_032950548.1|4357029_4357320_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_032950550.1|4357454_4360280_-	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	48.2	1.8e-100
>prophage 317
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4368970	4369885	5064681	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_032950562.1|4368970_4369885_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	47.6	1.5e-69
>prophage 318
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4378439	4379822	5064681		Pandoravirus(100.0%)	1	NA	NA
WP_032950571.1|4378439_4379822_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.8	5.3e-42
>prophage 319
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4388000	4392841	5064681		Micromonas_sp._RCC1109_virus(50.0%)	5	NA	NA
WP_032950575.1|4388000_4389689_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.4	2.9e-58
WP_003827118.1|4389796_4389895_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_003840643.1|4390416_4390506_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_003840641.1|4390629_4391463_+	EamA family transporter	NA	NA	NA	NA	NA
WP_032950576.1|4391656_4392841_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.1	5.0e-17
>prophage 320
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4400962	4401897	5064681		Synechococcus_phage(100.0%)	2	NA	NA
WP_003840609.1|4400962_4401391_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.7e-13
WP_003023882.1|4401483_4401897_-	heat shock chaperone IbpA	NA	A0A1D8KSJ6	Synechococcus_phage	35.2	4.6e-18
>prophage 321
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4406003	4413373	5064681		Bacillus_virus(33.33%)	7	NA	NA
WP_003844435.1|4406003_4408418_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	2.4e-114
WP_003023865.1|4408446_4409520_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003023863.1|4409519_4410620_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	1.1e-53
WP_003023861.1|4410624_4412028_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003023858.1|4412634_4412775_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003844432.1|4412792_4413152_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003023846.1|4413115_4413373_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 322
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4420348	4430957	5064681		Moraxella_phage(20.0%)	9	NA	NA
WP_003023830.1|4420348_4421686_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	37.8	2.1e-64
WP_032950596.1|4421853_4422519_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_003023824.1|4422603_4423329_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003023821.1|4423343_4424117_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	3.4e-14
WP_003023819.1|4424163_4425054_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003023817.1|4425053_4426013_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_003023814.1|4426157_4427198_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	35.8	2.0e-46
WP_032950599.1|4427532_4429362_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.6	8.1e-123
WP_032950602.1|4429586_4430957_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.6	4.8e-35
>prophage 323
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4443239	4444232	5064681		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_003827009.1|4443239_4444232_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	3.8e-50
>prophage 324
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4447506	4451500	5064681		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_003023768.1|4447506_4449375_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	3.2e-66
WP_032950606.1|4449567_4449987_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_003023764.1|4449994_4451500_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	21.9	1.7e-17
>prophage 325
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4466851	4468498	5064681		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_032950611.1|4466851_4468498_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	9.0e-65
>prophage 326
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4477623	4483052	5064681		Bacillus_phage(33.33%)	4	NA	NA
WP_003829018.1|4477623_4479645_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	2.2e-113
WP_003017996.1|4479692_4481174_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003017994.1|4481310_4482579_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	8.3e-42
WP_001280776.1|4482722_4483052_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 327
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4487105	4491304	5064681		Catovirus(33.33%)	4	NA	NA
WP_032950621.1|4487105_4488236_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.5	7.4e-26
WP_032950623.1|4488232_4489495_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.2	2.7e-24
WP_003841192.1|4489491_4490169_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_032950625.1|4490173_4491304_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	1.1e-18
>prophage 328
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4507723	4511569	5064681		Bacillus_phage(100.0%)	3	NA	NA
WP_003841210.1|4507723_4508626_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.5	1.9e-24
WP_003017925.1|4508625_4509342_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_003017922.1|4509406_4511569_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.6	7.8e-117
>prophage 329
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4515487	4518924	5064681	transposase	Catovirus(50.0%)	3	NA	NA
WP_003017915.1|4515487_4517317_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.5	2.5e-84
WP_003828942.1|4517380_4518001_+	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_032950636.1|4518039_4518924_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.0	5.7e-66
>prophage 330
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4531039	4534359	5064681		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_003841233.1|4531039_4532680_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.5	1.3e-42
WP_003017888.1|4532758_4533013_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_003017886.1|4533016_4533565_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_003017884.1|4533567_4534359_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.5	6.8e-26
>prophage 331
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4545308	4545923	5064681		Streptococcus_phage(100.0%)	1	NA	NA
WP_003017851.1|4545308_4545923_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	45.7	2.8e-19
>prophage 332
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4558104	4560891	5064681		Enterococcus_phage(100.0%)	1	NA	NA
WP_032950653.1|4558104_4560891_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	30.3	4.9e-47
>prophage 333
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4564802	4567272	5064681		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_003028633.1|4564802_4566212_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	9.0e-05
WP_003028636.1|4566222_4567272_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	2.6e-09
>prophage 334
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4579980	4582777	5064681		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003847911.1|4579980_4580877_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	93.8	4.6e-63
WP_032950674.1|4581043_4581940_+	sugar kinase	NA	NA	NA	NA	NA
WP_032950678.1|4581973_4582777_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.1	8.4e-24
>prophage 335
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4585918	4586827	5064681		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_032950680.1|4585918_4586827_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	32.4	7.0e-27
>prophage 336
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4590158	4593209	5064681		Escherichia_phage(100.0%)	1	NA	NA
WP_085952512.1|4590158_4593209_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.7	6.5e-08
>prophage 337
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4606573	4607194	5064681		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003840480.1|4606573_4607194_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.4	1.0e-61
>prophage 338
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4613485	4615554	5064681		Bacillus_phage(50.0%)	2	NA	NA
WP_003028758.1|4613485_4614859_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	1.1e-15
WP_003028763.1|4614855_4615554_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.5e-05
>prophage 339
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4630343	4631189	5064681		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003028793.1|4630343_4631189_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.5	1.8e-16
>prophage 340
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4634465	4635797	5064681		Erwinia_phage(100.0%)	1	NA	NA
WP_003028803.1|4634465_4635797_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.2	2.6e-46
>prophage 341
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4656962	4657625	5064681		Synechococcus_phage(100.0%)	1	NA	NA
WP_016151282.1|4656962_4657625_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	33.2	1.1e-29
>prophage 342
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4673632	4675489	5064681		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003028868.1|4673632_4675489_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.3	1.0e-08
>prophage 343
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4684266	4704801	5064681		uncultured_Mediterranean_phage(14.29%)	17	NA	NA
WP_003031107.1|4684266_4685217_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_003031109.1|4686164_4687349_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
WP_003033128.1|4687579_4687963_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003033125.1|4687964_4688510_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.6	1.1e-14
WP_003033122.1|4688663_4689092_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003033119.1|4689095_4689803_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_001207203.1|4690217_4690715_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003033114.1|4690781_4691147_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_047389603.1|4691467_4695496_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	1.6e-22
WP_003033107.1|4695572_4699796_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.4	1.0e-67
WP_003033104.1|4699907_4700225_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_032950746.1|4700229_4700535_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003033098.1|4701627_4701840_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	78.6	2.2e-24
WP_032950748.1|4701959_4703093_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_003842025.1|4703089_4703860_-	thiazole synthase	NA	NA	NA	NA	NA
WP_003033088.1|4703861_4704062_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_032937282.1|4704042_4704801_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SCZ9	Indivirus	32.1	3.5e-11
>prophage 344
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4710167	4711931	5064681		Klosneuvirus(50.0%)	3	NA	NA
WP_003033072.1|4710167_4710848_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	30.1	3.3e-21
WP_003842015.1|4710881_4711472_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044509.1|4711658_4711931_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
>prophage 345
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4717422	4719012	5064681		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_032950760.1|4717422_4719012_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	4.2e-67
>prophage 346
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4732993	4736677	5064681		Dickeya_phage(100.0%)	1	NA	NA
WP_032948291.1|4732993_4736677_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	3.7e-26
>prophage 347
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4740192	4741036	5064681		Brucella_phage(50.0%)	2	NA	NA
WP_032948293.1|4740192_4740471_-	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	51.2	2.5e-12
WP_003841416.1|4740874_4741036_-	phage protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	52.1	3.2e-07
>prophage 348
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4753692	4754478	5064681		Pseudomonas_phage(100.0%)	1	NA	NA
WP_032948304.1|4753692_4754478_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	46.7	3.0e-50
>prophage 349
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4770315	4771425	5064681		Mycoplasma_phage(100.0%)	1	NA	NA
WP_003031682.1|4770315_4771425_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 350
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4784296	4784905	5064681		Lactococcus_phage(100.0%)	1	NA	NA
WP_003031703.1|4784296_4784905_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 351
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4790704	4799697	5064681		Escherichia_phage(25.0%)	7	NA	NA
WP_003031715.1|4790704_4792120_+	replicative DNA helicase	NA	O80281	Escherichia_phage	77.7	4.1e-199
WP_003031716.1|4792136_4793216_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.5	3.1e-29
WP_032948322.1|4793344_4794538_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_032948323.1|4794785_4795499_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_003031719.1|4795626_4795983_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_003031720.1|4796098_4798921_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_003826621.1|4799172_4799697_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	94.5	1.1e-53
>prophage 352
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4803654	4805004	5064681		Moraxella_phage(100.0%)	1	NA	NA
WP_003031735.1|4803654_4805004_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	8.8e-159
>prophage 353
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4811196	4813155	5064681		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003826645.1|4811196_4813155_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	4.6e-92
>prophage 354
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4830572	4832096	5064681		Pithovirus(100.0%)	1	NA	NA
WP_032948336.1|4830572_4832096_-	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.9	3.6e-07
>prophage 355
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4837953	4839482	5064681		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_032948344.1|4837953_4838634_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	8.4e-09
WP_003844769.1|4838723_4839482_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	1.8e-15
>prophage 356
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4845219	4846008	5064681		Pithovirus(100.0%)	1	NA	NA
WP_003841124.1|4845219_4846008_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.0	1.5e-12
>prophage 357
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4852579	4855405	5064681		Burkholderia_virus(50.0%)	3	NA	NA
WP_003031844.1|4852579_4854082_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
WP_008321468.1|4854239_4854329_+	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
WP_032948350.1|4854322_4855405_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	27.3	2.0e-12
>prophage 358
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4882065	4883727	5064681		Hepacivirus(100.0%)	1	NA	NA
WP_032948357.1|4882065_4883727_-	fatty acid--CoA ligase	NA	Q75ZG1	Hepacivirus	24.4	3.3e-30
>prophage 359
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4892427	4894411	5064681		Cronobacter_phage(50.0%)	2	NA	NA
WP_000027827.1|4892427_4892721_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
WP_003025464.1|4892764_4894411_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.1	2.9e-188
>prophage 360
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4899409	4899943	5064681		Morganella_phage(100.0%)	1	NA	NA
WP_003025522.1|4899409_4899943_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.8	1.6e-47
>prophage 361
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4905845	4906823	5064681		Tupanvirus(100.0%)	1	NA	NA
WP_003830517.1|4905845_4906823_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	8.1e-29
>prophage 362
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4915567	4916113	5064681		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_003839477.1|4915567_4916113_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.0	2.2e-28
>prophage 363
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4920122	4923335	5064681		Vibrio_phage(50.0%)	2	NA	NA
WP_032948373.1|4920122_4921454_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	1.5e-17
WP_008323056.1|4921463_4923335_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	2.6e-60
>prophage 364
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4928858	4933418	5064681		Pithovirus(50.0%)	3	NA	NA
WP_003025606.1|4928858_4930157_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	2.9e-66
WP_003025609.1|4930373_4930799_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_032948374.1|4930955_4933418_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.3	2.1e-65
>prophage 365
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4937243	4938410	5064681		Ralstonia_phage(100.0%)	1	NA	NA
WP_032948382.1|4937243_4938410_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	45.0	1.4e-83
>prophage 366
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4956950	4958504	5064681		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032948391.1|4956950_4958504_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	5.6e-08
>prophage 367
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4982797	4986196	5064681		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_003025726.1|4982797_4983325_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	9.3e-56
WP_003025728.1|4983634_4984591_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_016149467.1|4984693_4986196_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.4	3.6e-12
>prophage 368
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	4989550	4990549	5064681		Klosneuvirus(100.0%)	1	NA	NA
WP_032948402.1|4989550_4990549_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.1	8.2e-69
>prophage 369
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	5002938	5005726	5064681		Cronobacter_phage(50.0%)	2	NA	NA
WP_003839580.1|5002938_5003403_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	1.4e-52
WP_003844922.1|5003587_5005726_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
>prophage 370
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	5009411	5013457	5064681		Enterobacteria_phage(50.0%)	2	NA	NA
WP_003025788.1|5009411_5010359_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	3.5e-13
WP_003025791.1|5010748_5013457_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	27.5	3.4e-45
>prophage 371
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	5017856	5018792	5064681		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003025818.1|5017856_5018792_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	1.4e-51
>prophage 372
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	5029714	5041628	5064681	integrase,tRNA	Klosneuvirus(20.0%)	8	5026127:5026140	5048015:5048028
5026127:5026140	attL	AGGTGTTCCTGCAT	NA	NA	NA	NA
WP_032948415.1|5029714_5032570_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
WP_003025862.1|5032569_5033013_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_003025870.1|5033149_5034661_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	7.1e-48
WP_032948416.1|5034927_5036028_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_003025875.1|5036027_5037110_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_032950778.1|5037211_5038714_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	2.0e-82
WP_032937718.1|5038862_5039882_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.0	2.4e-44
WP_032948418.1|5040350_5041628_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.8	1.1e-73
5048015:5048028	attR	ATGCAGGAACACCT	NA	NA	NA	NA
>prophage 373
NZ_CP026056	Citrobacter freundii strain FDAARGOS_73 chromosome, complete genome	5064681	5044960	5053534	5064681	integrase	Enterobacteria_phage(88.89%)	11	5030318:5030330	5057548:5057560
5030318:5030330	attL	GTGCGCCAGGCGC	NA	NA	NA	NA
WP_032948422.1|5044960_5045536_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	50.8	1.9e-38
WP_032948423.1|5045552_5045795_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	59.3	1.1e-19
WP_032948425.1|5045791_5046595_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	26.5	5.1e-13
WP_016242327.1|5047147_5047414_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	64.8	2.8e-24
WP_032948426.1|5047410_5047965_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	73.9	3.9e-36
WP_032948427.1|5047957_5048257_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	69.7	5.3e-32
WP_032948429.1|5048249_5048699_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	67.3	1.7e-45
WP_032950782.1|5048803_5049031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032948430.1|5049027_5049348_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_032948431.1|5049359_5051693_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.0	0.0e+00
WP_032948432.1|5052268_5053534_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.0	8.2e-82
5057548:5057560	attR	GCGCCTGGCGCAC	NA	NA	NA	NA
>prophage 1
NZ_CP026058	Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence	326508	65614	114895	326508	transposase	Escherichia_phage(38.46%)	48	NA	NA
WP_016236480.1|65614_66595_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.2e-184
WP_001752509.1|66911_67412_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_001067855.1|67738_68443_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067848.1|68947_69652_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_004098990.1|69727_71119_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_004098991.1|71115_73182_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_016241538.1|73686_74184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372348.1|74220_74472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032951190.1|74572_74779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024196077.1|75193_75493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372347.1|75608_77222_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	37.0	2.2e-07
WP_007372346.1|77797_78019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372345.1|78279_78498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372343.1|78780_79104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372342.1|79139_80063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372341.1|80243_80471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016241545.1|80789_81188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009651680.1|81209_81527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372340.1|81614_82100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008786567.1|82510_83377_-	hypothetical protein	NA	J9Q7H0	Salmonella_phage	37.2	8.4e-46
WP_016241546.1|83949_84198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372338.1|85159_86242_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	56.5	1.1e-79
WP_007372337.1|87770_88490_-	HNH endonuclease	NA	G0X580	Salmonella_phage	39.5	2.2e-07
WP_016241550.1|88643_89069_-	hypothetical protein	NA	A0A0K1YBA5	Cronobacter_phage	42.8	1.6e-26
WP_007372336.1|89180_89483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372335.1|89619_90165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016241551.1|90236_90761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372333.1|90904_91096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372332.1|91187_91511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372331.1|91732_95110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032951184.1|95313_95559_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	44.4	6.3e-07
WP_008786574.1|95607_96267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372328.1|96328_97153_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	61.1	1.9e-18
WP_016241553.1|97152_97452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372327.1|97484_97835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008786575.1|98085_98433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008786576.1|98443_98818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032951183.1|101136_101841_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	6.9e-139
WP_017384073.1|102853_103150_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023280966.1|103573_104230_+	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_023280857.1|104292_105276_-	oxidoreductase	NA	NA	NA	NA	NA
WP_017384071.1|106487_106763_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_017384070.1|106797_107907_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.3	4.9e-30
WP_012561111.1|107950_108349_+	VOC family protein	NA	NA	NA	NA	NA
WP_012561110.1|108413_109250_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_017384060.1|110684_111113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407551.1|112758_113775_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_032951158.1|113872_114895_+|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP026058	Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence	326508	233533	286460	326508	transposase	Escherichia_phage(36.36%)	55	NA	NA
WP_047389887.1|233533_234238_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.0e-138
WP_007372216.1|234362_234650_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_007372215.1|234698_235034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016241591.1|235295_235868_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	32.7	2.6e-19
WP_007372214.1|235903_236113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372213.1|236654_237983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372212.1|238215_239295_-	restriction endonuclease	NA	A0A1P8CWV0	Bacillus_phage	23.8	9.0e-05
WP_016241595.1|239754_240063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016241596.1|240059_240695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372211.1|240701_241430_-	signal peptidase I	NA	NA	NA	NA	NA
WP_016241597.1|241434_241851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032155232.1|242141_242792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372209.1|242798_243914_+	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_016241600.1|243937_244912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085954994.1|245718_246844_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.8	1.4e-48
WP_001067855.1|247036_247741_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001515736.1|247799_248051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001325018.1|248164_249310_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000254595.1|249303_250107_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.8e-10
WP_000449980.1|250108_251047_+	MCE family protein	NA	NA	NA	NA	NA
WP_000948259.1|251046_251688_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001515737.1|252035_253313_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_007372207.1|254711_254900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009652915.1|254935_256126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099531002.1|256238_256640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372203.1|256797_257304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172730106.1|257772_258111_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	1.6e-32
WP_040063370.1|258030_259182_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.7e-41
WP_016241518.1|260295_260721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099531012.1|260734_261010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009652923.1|261296_261611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372199.1|262474_263437_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	41.1	9.6e-59
WP_009652914.1|263450_263837_+	plasmid stability protein	NA	NA	NA	NA	NA
WP_007372197.1|263863_264268_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_024196074.1|264302_264632_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_007372195.1|264683_265487_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	2.1e-14
WP_007372194.1|265540_267352_-	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_007372193.1|267362_267791_-	diol dehydratase small subunit	NA	NA	NA	NA	NA
WP_009652918.1|267793_268378_-	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
WP_016241522.1|268389_270057_-	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
WP_007372190.1|270449_270878_+	heme-binding protein	NA	NA	NA	NA	NA
WP_007372189.1|270900_272064_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_007372188.1|272080_272434_+	glycerol dehydratase reactivase beta/small subunit family protein	NA	NA	NA	NA	NA
WP_007372187.1|272434_272965_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_009653098.1|272942_274868_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_007372185.1|274957_276055_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_007372183.1|276615_276894_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_007372182.1|277083_278181_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_007372180.1|278737_279808_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_007372179.1|279818_280451_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_047389899.1|280461_281880_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_007372177.1|281954_283604_+	glycerone kinase	NA	NA	NA	NA	NA
WP_007372176.1|283707_284478_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_072146302.1|284684_284876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|285479_286460_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
