The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	0	4038	4271053		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_038623721.1|435_3267_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.0	1.8e-307
WP_038623723.1|3492_4038_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	91.6	2.1e-50
>prophage 2
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	8341	13776	4271053		Klosneuvirus(50.0%)	4	NA	NA
WP_038629845.1|8341_9733_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.2	2.0e-25
WP_038623731.1|9739_11212_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_038623733.1|11330_12338_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_038623735.1|12369_13776_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	2.3e-16
>prophage 3
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	27058	31759	4271053		Bacillus_phage(50.0%)	5	NA	NA
WP_052133839.1|27058_28369_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.3	7.1e-12
WP_038623751.1|28365_28794_-	superoxide response transcriptional regulator SoxS	NA	NA	NA	NA	NA
WP_038623753.1|28884_29352_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_038623755.1|29393_30059_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_038623757.1|30409_31759_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.3e-159
>prophage 4
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	37992	39948	4271053		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038623771.1|37992_39948_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.3	5.8e-87
>prophage 5
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	43120	47164	4271053		Salmonella_phage(100.0%)	3	NA	NA
WP_038623777.1|43120_44665_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	43.5	1.3e-36
WP_038623779.1|44979_46617_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_038623781.1|46609_47164_-	hypothetical protein	NA	J9Q7G7	Salmonella_phage	49.7	6.6e-44
>prophage 6
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	76310	78245	4271053		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_052133843.1|76310_78245_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.1	1.2e-07
>prophage 7
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	86845	88830	4271053		Yersinia_phage(50.0%)	2	NA	NA
WP_038623833.1|86845_87139_+	co-chaperone GroES	NA	A0A2C9CWL1	Yersinia_phage	44.8	6.0e-12
WP_038623835.1|87183_88830_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.4	2.6e-189
>prophage 8
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	92164	95623	4271053		Hokovirus(100.0%)	1	NA	NA
WP_038623841.1|92164_95623_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	30.3	1.3e-33
>prophage 9
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	98883	99435	4271053		Morganella_phage(100.0%)	1	NA	NA
WP_038623851.1|98883_99435_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	53.3	2.0e-48
>prophage 10
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	113113	113656	4271053		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_038623873.1|113113_113656_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.9	3.8e-28
>prophage 11
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	117631	121288	4271053		Vibrio_phage(50.0%)	2	NA	NA
WP_038623879.1|117631_119299_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.8	7.1e-17
WP_038623880.1|119380_121288_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.6	2.0e-60
>prophage 12
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	127279	136554	4271053		Brazilian_cedratvirus(33.33%)	7	NA	NA
WP_038623894.1|127279_128578_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	36.1	3.2e-65
WP_038623896.1|128785_129232_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_038623898.1|129248_131684_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.6	1.1e-63
WP_038623900.1|131761_132496_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_038623902.1|132637_134263_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_038623904.1|134236_134569_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_038623906.1|134622_136554_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.2	4.8e-09
>prophage 13
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	153756	155998	4271053		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_038623944.1|153756_154287_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	2.9e-57
WP_038629860.1|154389_154839_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_038623947.1|154990_155998_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	4.4e-70
>prophage 14
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	169226	173197	4271053		Streptococcus_phage(50.0%)	4	NA	NA
WP_038623973.1|169226_170090_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.3	1.5e-47
WP_038623975.1|170151_172242_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_038623977.1|172199_172595_+	YraN family protein	NA	NA	NA	NA	NA
WP_038623979.1|172609_173197_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	34.8	1.4e-12
>prophage 15
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	188916	189888	4271053		Escherichia_phage(100.0%)	1	NA	NA
WP_038624007.1|188916_189888_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	34.4	3.8e-39
>prophage 16
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	196989	200544	4271053		Hokovirus(100.0%)	1	NA	NA
WP_038624018.1|196989_200544_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	30.4	1.5e-32
>prophage 17
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	205623	207069	4271053		Bacillus_virus(100.0%)	1	NA	NA
WP_038629868.1|205623_207069_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	26.1	5.2e-16
>prophage 18
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	210611	249136	4271053	integrase,lysis,terminase,capsid,tRNA,head,plate,portal,tail	Erwinia_phage(78.05%)	48	197147:197162	250725:250740
197147:197162	attL	AGCCGCGCGCCGCCTT	NA	NA	NA	NA
WP_038624026.1|210611_211649_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	99.7	1.2e-200
WP_016065995.1|211648_212221_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	100.0	4.9e-103
WP_016066025.1|212344_212608_+	DNA-binding protein	NA	F1BUS7	Erwinia_phage	100.0	9.0e-44
WP_016065999.1|212638_213148_+	phage regulatory CII family protein	NA	F1BUS6	Erwinia_phage	100.0	3.1e-88
WP_103790892.1|213155_213350_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	100.0	1.2e-32
WP_103790891.1|213438_213726_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	100.0	1.7e-51
WP_016066030.1|213795_214023_+	DUF2732 domain-containing protein	NA	F1BUS3	Erwinia_phage	100.0	2.4e-32
WP_016066032.1|214022_214247_+	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	100.0	2.7e-36
WP_016065980.1|214246_216499_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	100.0	0.0e+00
WP_038624033.1|216699_216897_+	hypothetical protein	NA	F1BUR9	Erwinia_phage	98.5	1.5e-27
WP_038624035.1|217391_218435_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	100.0	1.1e-204
WP_016065981.1|218434_220198_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	100.0	0.0e+00
WP_016065988.1|220343_221192_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	100.0	3.8e-152
WP_016065984.1|221242_222322_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	100.0	5.5e-204
WP_016065991.1|222325_222994_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	100.0	4.4e-119
WP_016066006.1|223086_223551_+|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	100.0	1.8e-82
WP_016066034.1|223550_223754_+	hypothetical protein	NA	F1BUQ5	Erwinia_phage	100.0	1.1e-33
WP_016066031.1|223759_223984_+	hypothetical protein	NA	F1BUQ4	Erwinia_phage	100.0	1.7e-35
WP_038624037.1|223967_224477_+	lysozyme	NA	E5G6N1	Salmonella_phage	66.9	6.2e-57
WP_016066008.1|224473_224920_+|lysis	control of lysis protein	lysis	F1BUQ1	Erwinia_phage	100.0	8.4e-74
WP_016066005.1|224997_225465_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	100.0	3.0e-82
WP_016066007.1|225461_225911_+	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	100.0	1.5e-75
WP_016065994.1|225980_226565_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	100.0	3.4e-107
WP_016066017.1|226561_226912_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	100.0	6.6e-58
WP_038624040.1|226916_227825_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	99.7	3.8e-158
WP_016065992.1|227817_228426_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	100.0	5.1e-114
WP_038624042.1|228422_229727_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	98.2	6.8e-148
WP_038624044.1|229726_230332_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	55.2	5.3e-55
WP_038624046.1|230303_230735_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_038624048.1|231154_231751_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	75.7	1.5e-73
WP_038624050.1|231813_232983_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	99.0	6.6e-219
WP_038624052.1|232995_233508_+|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	98.8	4.6e-92
WP_038624054.1|233567_233864_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	96.9	1.1e-45
WP_071883652.1|233866_234001_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	74.4	2.5e-10
WP_038624056.1|233993_236471_+|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	97.5	0.0e+00
WP_016065996.1|236474_237002_+|tail	phage tail protein	tail	F1BUT6	Erwinia_phage	100.0	8.9e-83
WP_103790887.1|236998_238171_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	65.7	5.0e-142
WP_016066033.1|238238_238457_+	transcriptional regulator	NA	F1BUT0	Erwinia_phage	100.0	2.6e-36
WP_038624058.1|238908_239427_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_038624060.1|239476_241321_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_038624062.1|241604_243350_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.1	3.0e-74
WP_001144069.1|243471_243687_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_038624065.1|243989_245006_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	2.0e-107
WP_038624067.1|245075_245363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038624069.1|245768_246365_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_038624071.1|246472_246832_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_038624073.1|246999_247818_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_038624076.1|247906_249136_-	multifunctional CCA addition/repair protein	NA	K4F6S9	Cronobacter_phage	45.0	1.4e-86
250725:250740	attR	AAGGCGGCGCGCGGCT	NA	NA	NA	NA
>prophage 19
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	254424	261676	4271053		uncultured_Mediterranean_phage(20.0%)	7	NA	NA
WP_038624085.1|254424_255846_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	1.3e-38
WP_038624087.1|256776_257433_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.4	6.6e-43
WP_038624089.1|257523_257907_-	cell wall hydrolase	NA	M1F286	Cronobacter_phage	44.4	3.6e-17
WP_038624091.1|258050_258818_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_038629873.1|259012_259798_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_038624093.1|259847_261008_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.2	3.8e-86
WP_038624095.1|261016_261676_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	50.0	4.9e-46
>prophage 20
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	266118	275365	4271053		Bacillus_virus(66.67%)	8	NA	NA
WP_038624107.1|266118_268014_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	8.5e-91
WP_038624109.1|268162_268498_-	quinol monooxygenase	NA	NA	NA	NA	NA
WP_038624111.1|268531_269113_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038624113.1|269184_269373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038624115.1|269374_271648_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.2	1.5e-86
WP_038624117.1|271755_272493_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_038624119.1|272592_274017_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_038624121.1|274540_275365_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	41.9	2.1e-54
>prophage 21
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	283093	287028	4271053		Diadromus_pulchellus_ascovirus(50.0%)	2	NA	NA
WP_038624136.1|283093_283987_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.0	3.6e-60
WP_038624138.1|284943_287028_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	37.1	2.9e-23
>prophage 22
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	296022	313764	4271053	integrase	Bacillus_phage(40.0%)	13	NA	NA
WP_038624146.1|296022_296982_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	83.1	3.8e-47
WP_038624147.1|296985_297603_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_052133851.1|297607_298552_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_071883736.1|299710_302557_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.8	3.1e-12
WP_038624153.1|302602_303115_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_038624155.1|303443_305309_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_038624157.1|305323_306646_-	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.0	6.0e-19
WP_038624159.1|307044_308700_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_038624161.1|308741_308999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080782483.1|309248_311999_-	hypothetical protein	NA	D6R422	Bacillus_phage	33.6	3.3e-67
WP_052133856.1|312209_312641_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_038624165.1|312637_312988_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_038624167.1|313224_313764_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	51.1	4.2e-35
>prophage 23
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	317298	327378	4271053		Mycobacterium_phage(25.0%)	7	NA	NA
WP_038629880.1|317298_317799_-	DUF1643 domain-containing protein	NA	A0A142F2K6	Mycobacterium_phage	45.3	3.4e-31
WP_052133858.1|317828_318707_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_038624171.1|318703_319180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038624173.1|319176_321153_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	25.3	3.6e-28
WP_038624177.1|322727_323111_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_081981747.1|323183_326270_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	40.9	2.3e-77
WP_038624179.1|326736_327378_-	deoxynucleoside kinase	NA	A0A2P0ZKF7	Vibrio_phage	53.9	1.9e-63
>prophage 24
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	347209	351176	4271053		Moraxella_phage(100.0%)	2	NA	NA
WP_038624204.1|347209_348883_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	24.0	4.5e-27
WP_052133862.1|348938_351176_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.9	3.2e-28
>prophage 25
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	356652	357090	4271053		Campylobacter_phage(100.0%)	1	NA	NA
WP_038624214.1|356652_357090_-	hypothetical protein	NA	X2KQY5	Campylobacter_phage	36.4	9.2e-09
>prophage 26
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	367719	368871	4271053		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038624242.1|367719_368871_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.4	3.1e-128
>prophage 27
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	381355	382150	4271053		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_038624269.1|381355_382150_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.8	2.6e-09
>prophage 28
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	399076	400315	4271053		Catovirus(100.0%)	1	NA	NA
WP_038624299.1|399076_400315_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.1	2.2e-100
>prophage 29
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	408296	413916	4271053		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_038624317.1|408296_411167_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	52.5	5.3e-270
WP_038624319.1|411271_412177_-	endonuclease	NA	NA	NA	NA	NA
WP_038624321.1|412479_413916_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	5.2e-32
>prophage 30
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	418329	425340	4271053	tRNA	Brevibacillus_phage(25.0%)	5	NA	NA
WP_038624333.1|418329_419223_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.5	7.1e-32
WP_038624335.1|419248_419953_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_038624337.1|419959_421690_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	4.0e-63
WP_103790883.1|422711_423809_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	7.0e-05
WP_038624341.1|423819_425340_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.1	2.8e-84
>prophage 31
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	437728	438730	4271053		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038624367.1|437728_438730_-	HTH-type transcriptional regulator GalR	NA	C6ZCU4	Enterobacteria_phage	27.7	4.7e-24
>prophage 32
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	444487	446632	4271053		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038624371.1|444487_446632_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.4	2.2e-18
>prophage 33
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	450916	459598	4271053		Planktothrix_phage(40.0%)	9	NA	NA
WP_038624381.1|450916_451627_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	49.5	3.9e-49
WP_038624382.1|451693_452377_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_038624383.1|452387_452621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038624384.1|453062_453590_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_038629892.1|453602_455849_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.0	4.6e-11
WP_038624385.1|456012_456888_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_038624386.1|456884_457679_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.5	3.4e-118
WP_038624387.1|457656_458619_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	1.5e-11
WP_038624388.1|458611_459598_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	1.6e-16
>prophage 34
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	470280	485709	4271053	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_038624405.1|470280_473172_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.6	7.9e-64
WP_038624407.1|473168_476711_+	exodeoxyribonuclease V subunit beta	NA	A0A068EQC7	Bacillus_phage	22.8	3.6e-10
WP_038624410.1|476707_478564_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	25.8	6.7e-24
WP_038624411.1|478642_479971_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_038624412.1|480324_481569_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	28.5	5.5e-14
WP_038624413.1|482059_483211_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_038624414.1|483267_484071_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.6	1.4e-15
WP_038624415.1|484033_484498_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_038624416.1|484503_485709_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	38.0	8.1e-71
>prophage 35
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	489925	493120	4271053		Bacillus_phage(50.0%)	3	NA	NA
WP_038624429.1|489925_490684_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	27.9	6.7e-07
WP_038624431.1|490723_492091_-	LOG family protein	NA	NA	NA	NA	NA
WP_038624433.1|492274_493120_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A1S5R3L8	Pseudomonas_phage	36.8	8.0e-41
>prophage 36
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	503976	509253	4271053		Streptococcus_phage(33.33%)	3	NA	NA
WP_038624457.1|503976_505125_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.4	9.5e-45
WP_038624459.1|505115_507845_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.9	6.5e-52
WP_038624461.1|507936_509253_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.2	4.6e-35
>prophage 37
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	513224	517197	4271053		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
WP_038624465.1|513224_514862_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.1	2.9e-156
WP_038624466.1|514940_516236_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.5	1.6e-128
WP_038624467.1|516525_517197_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	28.5	8.6e-14
>prophage 38
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	527539	529583	4271053		Hokovirus(50.0%)	2	NA	NA
WP_038624484.1|527539_528976_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	2.2e-35
WP_038624486.1|528977_529583_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	39.9	2.7e-27
>prophage 39
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	532731	536401	4271053		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_038624495.1|532731_533493_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.7	4.6e-56
WP_038624497.1|533486_534113_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.9	1.4e-34
WP_038629894.1|534284_535358_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	36.4	1.2e-06
WP_038624499.1|535408_536401_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.6e-32
>prophage 40
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	542858	552864	4271053	tRNA	Catovirus(20.0%)	8	NA	NA
WP_038624515.1|542858_545402_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	22.1	6.1e-28
WP_038624517.1|545714_546056_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_038624519.1|546126_547014_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_038624521.1|547366_547867_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.6	1.2e-31
WP_038624523.1|547961_549032_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.5	2.0e-113
WP_038624525.1|549163_549673_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_038624527.1|549810_552438_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.3	1.6e-79
WP_038624529.1|552684_552864_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.7e-12
>prophage 41
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	564111	565191	4271053		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_038624546.1|564111_565191_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.3	4.5e-89
>prophage 42
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	572111	574685	4271053		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038624561.1|572111_574685_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.7	1.7e-126
>prophage 43
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	580752	582054	4271053		Burkholderia_virus(100.0%)	1	NA	NA
WP_038624563.1|580752_582054_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.2	3.4e-43
>prophage 44
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	587357	587777	4271053		Achromobacter_phage(100.0%)	1	NA	NA
WP_038624571.1|587357_587777_-	thioredoxin TrxC	NA	V9SJ74	Achromobacter_phage	38.5	9.1e-14
>prophage 45
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	596946	602287	4271053		Bacillus_virus(20.0%)	5	NA	NA
WP_038624585.1|596946_598143_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.3	1.9e-27
WP_038624587.1|598525_599488_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	71.7	8.0e-130
WP_081981751.1|599505_601740_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.3	3.1e-193
WP_038624591.1|601628_602039_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	34.8	1.9e-11
WP_038624592.1|602044_602287_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	48.6	1.5e-13
>prophage 46
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	606086	611062	4271053		Enterobacteria_phage(66.67%)	7	NA	NA
WP_038624596.1|606086_606509_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	58.4	5.5e-35
WP_038624597.1|606543_607092_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_038624598.1|607184_607364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038624600.1|607526_607958_+	OsmC family protein	NA	NA	NA	NA	NA
WP_038624602.1|608115_609804_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	82.0	1.4e-251
WP_038624604.1|609797_610526_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_038624606.1|610597_611062_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	72.7	1.1e-57
>prophage 47
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	616201	617023	4271053		Mycobacterium_phage(100.0%)	1	NA	NA
WP_038624614.1|616201_617023_-	alpha/beta hydrolase	NA	A0A249XMC3	Mycobacterium_phage	28.6	3.3e-15
>prophage 48
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	622067	623027	4271053		Erwinia_phage(100.0%)	1	NA	NA
WP_038624623.1|622067_623027_+	UV damage endonuclease UvsE	NA	A0A2H4IBJ4	Erwinia_phage	51.4	3.0e-92
>prophage 49
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	629108	631393	4271053		Escherichia_phage(50.0%)	2	NA	NA
WP_038624631.1|629108_630392_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	87.5	3.2e-211
WP_038624633.1|630910_631393_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	44.9	1.3e-27
>prophage 50
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	636227	667804	4271053	tRNA	Bacillus_phage(16.67%)	30	NA	NA
WP_038624644.1|636227_636905_-	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	50.0	7.8e-55
WP_038624646.1|637179_637563_+	autonomous glycyl radical cofactor GrcA	NA	Q56BW7	Escherichia_virus	70.2	8.9e-32
WP_038624648.1|637790_639131_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.6	1.9e-44
WP_038629906.1|639263_640001_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_038624650.1|639985_641605_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_133052062.1|641610_641883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038624651.1|642048_642624_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.0	1.6e-05
WP_038624652.1|642654_643305_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_038624653.1|643304_644261_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_038624654.1|644257_644725_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_038624655.1|644963_646763_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.6	1.9e-23
WP_038624656.1|646772_647747_+	signal peptidase I	NA	NA	NA	NA	NA
WP_038624657.1|647878_648559_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.9	6.2e-20
WP_038624658.1|648555_649461_+	GTPase Era	NA	NA	NA	NA	NA
WP_038624660.1|649468_650203_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_038624662.1|650263_650995_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_038624663.1|650994_651375_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_038624664.1|651387_651642_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	6.3e-18
WP_038624665.1|651701_652541_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038624666.1|652781_653417_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_038629908.1|653476_654001_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_038624667.1|653997_655455_-	membrane-bound lytic murein transglycosylase MltF	NA	I1VXB7	Halocynthia_phage	47.7	2.5e-10
WP_038624668.1|655719_659610_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	1.9e-129
WP_038629909.1|660251_661676_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.4	4.3e-15
WP_052133868.1|661681_662413_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_038624669.1|662412_663747_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	38.8	7.2e-12
WP_038624670.1|663870_664209_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_038624672.1|664318_665011_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_038624674.1|665047_666232_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_038624676.1|666550_667804_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.5	1.7e-100
>prophage 51
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	674504	680851	4271053		Faustovirus(20.0%)	8	NA	NA
WP_038624691.1|674504_675719_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	2.5e-35
WP_038624692.1|675743_676130_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.4	1.9e-53
WP_038624693.1|676139_676463_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.9e-23
WP_038629912.1|676541_677060_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_038624694.1|677074_678925_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	39.2	2.2e-104
WP_038624695.1|678928_679264_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_038624696.1|679318_679519_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_038624697.1|679564_680851_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.3	9.0e-36
>prophage 52
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	690528	690960	4271053		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_038624703.1|690528_690960_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	2.6e-19
>prophage 53
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	710315	713322	4271053		Indivirus(50.0%)	2	NA	NA
WP_038624733.1|710315_711686_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	39.2	8.1e-43
WP_038624735.1|711855_713322_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	6.8e-88
>prophage 54
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	717546	717732	4271053		Escherichia_phage(100.0%)	1	NA	NA
WP_038624745.1|717546_717732_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	61.2	1.6e-07
>prophage 55
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	728405	733101	4271053		Prochlorococcus_phage(50.0%)	5	NA	NA
WP_038624757.1|728405_729173_+	phosphate ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.9	1.3e-13
WP_038624759.1|729221_729860_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.8	7.6e-28
WP_038624761.1|729856_730894_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	4.1e-71
WP_038624763.1|731128_731755_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_038624765.1|731817_733101_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.5	1.4e-65
>prophage 56
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	736806	737160	4271053		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038624775.1|736806_737160_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	48.7	2.6e-22
>prophage 57
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	740864	742460	4271053		Bacillus_phage(100.0%)	1	NA	NA
WP_038624783.1|740864_742460_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.0	1.2e-18
>prophage 58
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	746894	747608	4271053		Cyanophage(100.0%)	1	NA	NA
WP_038624795.1|746894_747608_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	37.9	4.8e-39
>prophage 59
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	767964	769509	4271053		Escherichia_phage(100.0%)	1	NA	NA
WP_038624820.1|767964_769509_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	4.1e-19
>prophage 60
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	776526	778032	4271053		Bacillus_virus(100.0%)	1	NA	NA
WP_038624838.1|776526_778032_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.7	4.3e-13
>prophage 61
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	781419	782616	4271053		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038624846.1|781419_782616_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.5	3.4e-05
>prophage 62
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	788984	789935	4271053		Cyanophage(100.0%)	1	NA	NA
WP_038624858.1|788984_789935_-	transaldolase	NA	A0A127KMN5	Cyanophage	32.0	5.7e-11
>prophage 63
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	793842	818534	4271053		Planktothrix_phage(20.0%)	25	NA	NA
WP_071883662.1|793842_794700_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	M4ZRP4	Bacillus_phage	32.7	3.1e-16
WP_038624866.1|794891_795317_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_038624868.1|795356_795812_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_038624871.1|795878_796475_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_038624873.1|796563_797460_+	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	31.9	5.1e-30
WP_038624875.1|797662_798673_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038624877.1|798672_799506_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_038624879.1|799505_800381_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_038624881.1|800370_801459_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	40.3	3.0e-32
WP_038624883.1|801534_802413_+	cysteine synthase CysM	NA	C3U2M1	Lactococcus_phage	40.4	8.8e-51
WP_038624885.1|802471_804412_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	43.9	1.4e-40
WP_038624887.1|804411_805617_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	59.6	5.1e-25
WP_038624889.1|805787_806468_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_038624891.1|806464_807814_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_038624893.1|807876_808380_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_038624896.1|808423_810151_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.3	3.9e-18
WP_038624898.1|810307_810565_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_038624900.1|810961_811930_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.6	2.5e-75
WP_103790917.1|811823_812087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133870.1|812105_812903_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_038624902.1|813121_814165_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_038624904.1|814233_816261_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	41.4	8.3e-145
WP_038624906.1|816253_816472_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_038624908.1|816502_817519_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_038624910.1|817613_818534_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.0	2.5e-08
>prophage 64
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	831082	831811	4271053		Clostridioides_phage(100.0%)	1	NA	NA
WP_038624932.1|831082_831811_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	24.8	9.3e-14
>prophage 65
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	853251	857915	4271053	integrase	Cronobacter_phage(40.0%)	5	839391:839405	862977:862991
839391:839405	attL	CTGGCGGCGCTGCTG	NA	NA	NA	NA
WP_038624965.1|853251_854163_-	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	86.2	3.3e-149
WP_038624967.1|854159_854519_-	GtrA family protein	NA	F1C5B1	Cronobacter_phage	60.8	4.0e-34
WP_038624969.1|854647_855805_-|integrase	tyrosine-type recombinase/integrase	integrase	E5AGD0	Erwinia_phage	73.3	4.6e-164
WP_038624971.1|856119_857055_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	74.0	6.2e-111
WP_038624973.1|857297_857915_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	W5SAS9	Pithovirus	28.3	6.9e-10
862977:862991	attR	CTGGCGGCGCTGCTG	NA	NA	NA	NA
>prophage 66
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	873240	874326	4271053		Pandoravirus(100.0%)	1	NA	NA
WP_038624999.1|873240_874326_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.0	6.7e-93
>prophage 67
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	881868	883305	4271053		Streptococcus_phage(100.0%)	1	NA	NA
WP_038625008.1|881868_883305_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.9	3.7e-14
>prophage 68
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	886981	888115	4271053		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_038625014.1|886981_888115_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.0	8.2e-17
>prophage 69
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	894596	896114	4271053		Mollivirus(100.0%)	1	NA	NA
WP_038625032.1|894596_896114_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.8	4.4e-90
>prophage 70
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	903399	907624	4271053		Acanthocystis_turfacea_Chlorella_virus(50.0%)	5	NA	NA
WP_038625038.1|903399_904173_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.0	6.9e-07
WP_038625040.1|904212_905103_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_038625042.1|905281_905923_+	glutathione transferase	NA	NA	NA	NA	NA
WP_038625044.1|906045_906600_+	NUDIX hydrolase YfcD	NA	NA	NA	NA	NA
WP_038625046.1|906604_907624_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.1	2.9e-21
>prophage 71
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	920899	921499	4271053		Salmonella_phage(100.0%)	1	NA	NA
WP_038625070.1|920899_921499_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	36.2	1.3e-05
>prophage 72
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	941257	941803	4271053		Lactobacillus_phage(100.0%)	1	NA	NA
WP_038629930.1|941257_941803_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	33.9	2.8e-15
>prophage 73
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	951487	958227	4271053		Pseudomonas_phage(50.0%)	5	NA	NA
WP_038625119.1|951487_952930_-	catalase	NA	A0A2K9L0T1	Tupanvirus	44.9	3.0e-96
WP_038625121.1|953157_954354_+	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_038625123.1|954388_954649_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	64.2	1.6e-24
WP_038625125.1|954651_955782_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.9e-175
WP_038625127.1|955941_958227_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	64.2	3.4e-288
>prophage 74
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	961874	967875	4271053		Bacillus_phage(50.0%)	2	NA	NA
WP_038625131.1|961874_964511_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	31.4	9.0e-107
WP_038625135.1|965022_967875_+	two-component system sensor histidine kinase RcsC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.4	4.2e-33
>prophage 75
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	978221	983104	4271053		Organic_Lake_phycodnavirus(50.0%)	3	NA	NA
WP_103790963.1|978221_980372_+	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.2	6.6e-23
WP_038625147.1|980368_981538_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_038625149.1|982000_983104_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.9	1.2e-113
>prophage 76
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	993277	996276	4271053		Streptococcus_phage(50.0%)	2	NA	NA
WP_103790968.1|993277_995338_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	43.4	2.9e-129
WP_038625172.1|995415_996276_-	benzoate transporter	NA	M1HZA4	Paramecium_bursaria_Chlorella_virus	34.0	4.6e-28
>prophage 77
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	999278	1006956	4271053		Vibrio_phage(50.0%)	7	NA	NA
WP_038625174.1|999278_1000283_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	7.9e-88
WP_038625176.1|1000358_1000643_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_038625178.1|1000768_1002523_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.2	3.3e-97
WP_038625180.1|1002682_1003387_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_038625182.1|1003425_1004628_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.3	6.2e-23
WP_038629937.1|1004871_1005213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038625184.1|1005360_1006956_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	30.9	1.9e-19
>prophage 78
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1012748	1013321	4271053		Bacillus_phage(100.0%)	1	NA	NA
WP_038625191.1|1012748_1013321_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	37.6	2.5e-14
>prophage 79
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1023022	1023880	4271053		Catovirus(100.0%)	1	NA	NA
WP_038625204.1|1023022_1023880_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	31.2	4.8e-25
>prophage 80
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1029271	1037233	4271053		Bacillus_virus(25.0%)	7	NA	NA
WP_103790964.1|1029271_1030060_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.0	1.9e-12
WP_038625213.1|1030262_1032209_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.9	1.8e-11
WP_038625214.1|1032284_1033127_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_038625215.1|1033139_1034264_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	1.6e-36
WP_038629940.1|1034250_1035171_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038625216.1|1035275_1036433_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_038625217.1|1036567_1037233_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	1.4e-56
>prophage 81
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1041004	1042525	4271053		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_038625221.1|1041004_1042525_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.1	2.0e-10
>prophage 82
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1048721	1050755	4271053	tRNA	Indivirus(100.0%)	1	NA	NA
WP_038625228.1|1048721_1050755_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.6	5.2e-54
>prophage 83
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1058170	1059589	4271053		Aichi_virus(100.0%)	1	NA	NA
WP_038625234.1|1058170_1059589_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	25.7	6.0e-25
>prophage 84
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1064869	1066414	4271053		Bacillus_virus(100.0%)	1	NA	NA
WP_038625240.1|1064869_1066414_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.9	1.9e-16
>prophage 85
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1085858	1095964	4271053	tRNA	Bacillus_phage(40.0%)	8	NA	NA
WP_038625254.1|1085858_1087331_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	28.7	4.0e-40
WP_038625255.1|1087383_1088667_-	MFS transporter	NA	NA	NA	NA	NA
WP_038625256.1|1088736_1089747_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038625257.1|1089757_1090972_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	30.5	3.0e-49
WP_038625258.1|1091218_1092118_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_038625259.1|1092370_1093753_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	84.7	2.7e-187
WP_038625260.1|1093866_1094571_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	35.3	8.4e-36
WP_038625261.1|1094581_1095964_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.2	1.1e-26
>prophage 86
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1108042	1117310	4271053		Bacillus_phage(25.0%)	6	NA	NA
WP_038625269.1|1108042_1111378_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	8.3e-17
WP_038625270.1|1111488_1112130_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_038629943.1|1112455_1113097_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.5	2.2e-35
WP_038625271.1|1113131_1113713_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_038625272.1|1113734_1115561_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_038625273.1|1115732_1117310_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	2.0e-37
>prophage 87
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1120650	1123803	4271053		Streptococcus_phage(50.0%)	2	NA	NA
WP_038625275.1|1120650_1122828_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	31.1	3.2e-17
WP_052133876.1|1122897_1123803_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	27.8	2.2e-12
>prophage 88
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1128989	1129997	4271053		Catovirus(100.0%)	1	NA	NA
WP_071883665.1|1128989_1129997_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.5	2.7e-11
>prophage 89
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1134870	1136829	4271053		Bacillus_phage(50.0%)	2	NA	NA
WP_038625282.1|1134870_1135767_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.8	7.1e-48
WP_038625283.1|1135815_1136829_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	45.6	3.5e-75
>prophage 90
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1142961	1146314	4271053		Organic_Lake_phycodnavirus(50.0%)	3	NA	NA
WP_038625288.1|1142961_1143780_+	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	28.9	1.3e-08
WP_038625289.1|1143798_1144749_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_038625290.1|1144907_1146314_+	NADP-dependent phosphogluconate dehydrogenase	NA	V5UT40	Synechococcus_phage	29.4	1.2e-30
>prophage 91
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1155335	1156235	4271053		Cellulophaga_phage(100.0%)	1	NA	NA
WP_038625302.1|1155335_1156235_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	89.5	7.7e-10
>prophage 92
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1161743	1163039	4271053		Klosneuvirus(100.0%)	1	NA	NA
WP_038625308.1|1161743_1163039_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.6	5.3e-28
>prophage 93
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1173198	1174386	4271053		Stx2-converting_phage(100.0%)	1	NA	NA
WP_038625318.1|1173198_1174386_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	62.6	5.4e-144
>prophage 94
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1184350	1185835	4271053		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_038625326.1|1184350_1185835_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	6.3e-09
>prophage 95
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1194726	1203219	4271053		Bacillus_phage(33.33%)	5	NA	NA
WP_038625334.1|1194726_1196892_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.8	7.8e-16
WP_038625335.1|1197171_1197912_+	phosphonate metabolism transcriptional regulator PhnF	NA	NA	NA	NA	NA
WP_038625336.1|1197908_1198460_+	phosphonate C-P lyase system protein PhnH	NA	NA	NA	NA	NA
WP_038625337.1|1198528_1201297_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	32.7	2.1e-50
WP_038625338.1|1201923_1203219_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	39.2	1.8e-68
>prophage 96
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1209436	1213039	4271053		Acinetobacter_phage(50.0%)	5	NA	NA
WP_038625342.1|1209436_1209928_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	37.2	2.1e-17
WP_038625343.1|1210164_1210425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038625344.1|1210629_1210920_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_038625345.1|1211006_1212263_-	MFS transporter	NA	NA	NA	NA	NA
WP_038625346.1|1212277_1213039_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.8	4.0e-15
>prophage 97
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1221482	1222340	4271053		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_038625352.1|1221482_1222340_+	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	47.2	4.9e-62
>prophage 98
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1225629	1231284	4271053		Pseudomonas_virus(33.33%)	5	NA	NA
WP_038625356.1|1225629_1226292_-	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	39.4	3.5e-36
WP_038625357.1|1226928_1227633_+	phosphohydrolase	NA	S4W232	Pandoravirus	25.5	7.4e-08
WP_038625358.1|1227702_1228011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081981765.1|1228011_1229607_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_038625360.1|1229874_1231284_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	48.5	1.2e-102
>prophage 99
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1235656	1236334	4271053		Salmonella_phage(100.0%)	1	NA	NA
WP_038625372.1|1235656_1236334_+	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	56.3	6.6e-54
>prophage 100
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1261619	1263206	4271053		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038625430.1|1261619_1263206_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.5	4.1e-06
>prophage 101
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1266564	1274054	4271053		uncultured_Caudovirales_phage(80.0%)	6	NA	NA
WP_038625441.1|1266564_1267572_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	41.6	2.8e-61
WP_038625443.1|1268193_1269558_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_081981769.1|1269884_1271363_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	70.0	6.8e-189
WP_038625445.1|1271841_1272195_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	58.3	2.0e-22
WP_038625447.1|1272291_1273575_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.9	1.1e-174
WP_038625449.1|1273622_1274054_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	1.8e-49
>prophage 102
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1279890	1281420	4271053		Catovirus(100.0%)	1	NA	NA
WP_038625461.1|1279890_1281420_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.9	3.6e-84
>prophage 103
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1285843	1286765	4271053		Morganella_phage(50.0%)	2	NA	NA
WP_038625465.1|1285843_1286056_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	77.1	2.9e-24
WP_038625468.1|1286525_1286765_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	68.4	7.2e-24
>prophage 104
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1294890	1304387	4271053		Enterobacteria_phage(60.0%)	5	NA	NA
WP_038625486.1|1294890_1298574_+	glycosyltransferase	NA	I7HJE4	Enterobacteria_phage	23.7	3.4e-11
WP_038625488.1|1298586_1302078_+	glycosyltransferase	NA	A0A1V0SLJ0	Klosneuvirus	30.7	3.1e-06
WP_038625491.1|1302136_1302988_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.2	3.5e-44
WP_038625493.1|1302972_1303521_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	60.6	1.6e-58
WP_038625495.1|1303517_1304387_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.9	1.2e-105
>prophage 105
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1309782	1310535	4271053		Bacillus_virus(100.0%)	1	NA	NA
WP_038625507.1|1309782_1310535_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	6.4e-26
>prophage 106
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1333790	1334579	4271053		Cronobacter_phage(100.0%)	1	NA	NA
WP_038625542.1|1333790_1334579_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	78.2	5.4e-92
>prophage 107
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1341263	1341947	4271053		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038625557.1|1341263_1341947_+	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	1.3e-78
>prophage 108
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1358560	1360040	4271053		Bacillus_thuringiensis_phage(100.0%)	2	NA	NA
WP_038625575.1|1358560_1359610_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.6	4.6e-06
WP_038625576.1|1359650_1360040_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	6.5e-06
>prophage 109
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1365372	1367106	4271053	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_038629965.1|1365372_1367106_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.9	4.0e-87
>prophage 110
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1372375	1373886	4271053		Enterobacteria_phage(33.33%)	3	NA	NA
WP_038625592.1|1372375_1372978_-	LexA family transcriptional regulator	NA	Q76H56	Enterobacteria_phage	64.0	3.3e-17
WP_038625594.1|1373149_1373620_+	lysozyme	NA	A0A2R4ALG9	Vibrio_phage	40.8	4.0e-26
WP_052134011.1|1373622_1373886_+	hypothetical protein	NA	M4Q0Z5	Dunaliella_viridis_virus	41.2	2.2e-10
>prophage 111
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1379985	1380435	4271053		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_038625604.1|1379985_1380435_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	54.4	4.8e-37
>prophage 112
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1387261	1407704	4271053	transposase,tRNA	Bacillus_virus(22.22%)	21	NA	NA
WP_038625615.1|1387261_1387825_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	39.8	8.2e-26
WP_038625617.1|1388290_1388611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038625619.1|1389121_1389463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103791075.1|1389647_1390767_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.0	3.3e-50
WP_038625623.1|1390974_1391781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038625625.1|1391855_1394096_+	tape measure protein	NA	A0A0N9RUX9	Escherichia_phage	25.4	1.7e-05
WP_038629971.1|1394375_1394585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038625627.1|1394581_1394956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038625629.1|1395021_1395216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038625631.1|1395212_1396823_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	36.7	1.5e-40
WP_038625633.1|1397404_1397968_-	hydrolase	NA	NA	NA	NA	NA
WP_038625634.1|1398280_1400059_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	29.1	8.1e-11
WP_038625636.1|1400060_1400495_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_038625638.1|1400674_1401418_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_038625640.1|1401454_1401979_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	33.3	2.9e-09
WP_038625641.1|1402063_1402678_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_038625643.1|1402686_1403691_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.8	1.8e-07
WP_038625645.1|1403802_1404588_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_038625646.1|1404587_1405340_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	31.2	8.4e-18
WP_038625647.1|1405417_1406365_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_038625648.1|1406378_1407704_+	murein DD-endopeptidase MepM	NA	G9BW84	Planktothrix_phage	43.8	1.2e-19
>prophage 113
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1419107	1420583	4271053		Cyanophage(100.0%)	1	NA	NA
WP_038625660.1|1419107_1420583_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.0	1.6e-76
>prophage 114
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1426958	1427186	4271053		Pectobacterium_phage(100.0%)	1	NA	NA
WP_038625673.1|1426958_1427186_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	6.9e-16
>prophage 115
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1430492	1436490	4271053		Erwinia_phage(50.0%)	5	NA	NA
WP_038625680.1|1430492_1430927_+	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	70.8	1.1e-54
WP_038625681.1|1430938_1431259_+	DUF1493 family protein	NA	A0A218M4K1	Erwinia_phage	70.6	2.0e-37
WP_081981777.1|1431304_1431538_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	58.3	1.2e-10
WP_081981779.1|1432583_1432811_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_038625683.1|1433379_1436490_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.6	2.0e-57
>prophage 116
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1441271	1443128	4271053		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004265627.1|1441271_1443128_+	DUF4102 domain-containing protein	NA	A0A0U1UNT3	Pseudomonas_phage	50.6	1.2e-100
>prophage 117
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1465199	1466431	4271053		Wolbachia_phage(50.0%)	2	NA	NA
WP_003454800.1|1465199_1466201_-	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	28.1	1.4e-20
WP_003454802.1|1466206_1466431_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	61.6	3.0e-16
>prophage 118
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1479055	1479883	4271053		Cronobacter_phage(100.0%)	1	NA	NA
WP_004265548.1|1479055_1479883_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	39.6	4.1e-42
>prophage 119
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1487262	1489278	4271053		Streptococcus_phage(100.0%)	1	NA	NA
WP_038625712.1|1487262_1489278_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	26.9	3.1e-27
>prophage 120
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1500335	1507153	4271053		Cyanophage(33.33%)	4	NA	NA
WP_016451637.1|1500335_1500905_+	Hsp20/alpha crystallin family protein	NA	A0A1D7SX46	Cyanophage	27.1	8.1e-05
WP_016451636.1|1500998_1503848_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	40.9	2.6e-128
WP_016451635.1|1503865_1505296_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_020306398.1|1505323_1507153_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	41.6	8.1e-107
>prophage 121
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1511537	1511978	4271053		Streptomyces_phage(100.0%)	1	NA	NA
WP_012761376.1|1511537_1511978_+	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	38.5	5.8e-11
>prophage 122
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1515158	1516310	4271053		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_012761372.1|1515158_1516310_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.0	2.8e-28
>prophage 123
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1520775	1523598	4271053		Streptococcus_phage(50.0%)	3	NA	NA
WP_038625732.1|1520775_1521669_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.4	6.5e-17
WP_038625734.1|1521806_1522676_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_038625736.1|1522950_1523598_+	serine/threonine protein phosphatase	NA	S4TNS0	Salmonella_phage	48.6	1.2e-57
>prophage 124
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1530759	1532805	4271053		Moraxella_phage(100.0%)	1	NA	NA
WP_038625749.1|1530759_1532805_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	1.4e-86
>prophage 125
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1538807	1539017	4271053		Morganella_phage(100.0%)	1	NA	NA
WP_004386688.1|1538807_1539017_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	5.3e-23
>prophage 126
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1544738	1546310	4271053		Moraxella_phage(100.0%)	1	NA	NA
WP_038625772.1|1544738_1546310_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	6.2e-39
>prophage 127
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1550394	1557746	4271053	tRNA	Pandoravirus(33.33%)	7	NA	NA
WP_038625778.1|1550394_1551777_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	39.3	1.1e-39
WP_038625780.1|1551880_1552063_+	YoaH family protein	NA	NA	NA	NA	NA
WP_038625782.1|1552063_1552417_-	RidA family protein	NA	NA	NA	NA	NA
WP_038625785.1|1552547_1554458_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.6	1.9e-90
WP_038625787.1|1554514_1555216_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_038625789.1|1555274_1555865_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_133052055.1|1556066_1557746_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	27.3	4.6e-40
>prophage 128
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1571326	1577142	4271053		Salmonella_phage(33.33%)	5	NA	NA
WP_038625814.1|1571326_1572517_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.2	1.2e-29
WP_038625816.1|1572669_1572903_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_038625818.1|1572981_1574709_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_038625820.1|1574955_1575666_+	phage-associated protein	NA	A0A059VF66	Pseudomonas_phage	48.4	6.5e-44
WP_038625822.1|1575864_1577142_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	39.0	9.9e-11
>prophage 129
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1584355	1601628	4271053		Bacillus_phage(28.57%)	17	NA	NA
WP_038625837.1|1584355_1584964_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.8	2.8e-19
WP_038629978.1|1584976_1585996_-	asparaginase	NA	NA	NA	NA	NA
WP_038629979.1|1586090_1587947_-	signal peptide peptidase SppA	NA	K4I1N3	Providencia_phage	26.6	2.2e-06
WP_038625839.1|1588119_1588671_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_071883672.1|1588813_1589071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038625843.1|1589089_1591012_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	32.2	4.8e-41
WP_071883673.1|1591011_1591335_+	YnjH family protein	NA	NA	NA	NA	NA
WP_038625845.1|1591373_1592180_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_038625847.1|1592973_1593822_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	36.4	2.4e-13
WP_038625848.1|1593876_1594335_-	YchJ family protein	NA	NA	NA	NA	NA
WP_038625850.1|1594444_1595347_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_038625852.1|1595447_1596461_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_038625854.1|1596656_1597565_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.9	3.1e-59
WP_038625856.1|1597589_1598930_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	6.6e-82
WP_038625858.1|1598944_1599949_+	NAD-dependent epimerase	NA	NA	NA	NA	NA
WP_038625860.1|1600091_1600499_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_038629981.1|1601013_1601628_+	thymidine kinase	NA	A0A191ZC13	Erwinia_phage	53.1	1.3e-53
>prophage 130
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1611626	1613638	4271053		Planktothrix_phage(50.0%)	2	NA	NA
WP_038625874.1|1611626_1612640_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	5.8e-14
WP_038625876.1|1612636_1613638_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.2	1.5e-14
>prophage 131
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1623507	1626464	4271053		Acinetobacter_phage(100.0%)	3	NA	NA
WP_038625901.1|1623507_1624869_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.7	5.6e-36
WP_038625902.1|1624871_1625870_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.1	2.5e-49
WP_038625903.1|1625885_1626464_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	35.8	1.8e-28
>prophage 132
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1631676	1636954	4271053	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_038625913.1|1631676_1632438_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.0	4.4e-06
WP_038625916.1|1632630_1633680_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	26.5	3.3e-20
WP_038625918.1|1633707_1633959_-	DUF2498 family protein	NA	NA	NA	NA	NA
WP_038625919.1|1634365_1636954_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	36.2	1.4e-88
>prophage 133
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1642158	1642752	4271053		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038625925.1|1642158_1642752_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	1.1e-41
>prophage 134
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1650269	1652255	4271053		Bacillus_phage(100.0%)	1	NA	NA
WP_038625938.1|1650269_1652255_-	cyclic di-GMP phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	32.3	6.1e-15
>prophage 135
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1662243	1666391	4271053		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_038625949.1|1662243_1663218_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	29.9	2.0e-32
WP_038629984.1|1663335_1664547_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_038625951.1|1664812_1665076_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_038625954.1|1665181_1665472_-	hypothetical protein	NA	A0A2H4J657	uncultured_Caudovirales_phage	48.3	2.6e-15
WP_038625956.1|1665737_1666391_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	42.5	4.4e-39
>prophage 136
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1670742	1675742	4271053		Lactobacillus_phage(33.33%)	5	NA	NA
WP_038625962.1|1670742_1671642_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	5.5e-08
WP_038625964.1|1671638_1672775_-	oxidoreductase	NA	NA	NA	NA	NA
WP_038625966.1|1672988_1673777_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_038625968.1|1673937_1674750_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.3	1.0e-13
WP_038625970.1|1674749_1675742_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.6	4.0e-07
>prophage 137
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1680292	1681327	4271053		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_052133892.1|1680292_1681327_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.3	3.5e-14
>prophage 138
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1696072	1697005	4271053	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_038626007.1|1696072_1697005_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.6	3.7e-140
>prophage 139
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1700158	1703341	4271053		Tupanvirus(50.0%)	4	NA	NA
WP_052133893.1|1700158_1701097_-	alpha/beta hydrolase	NA	A0A2K9L3Q7	Tupanvirus	25.6	5.8e-08
WP_038629987.1|1701160_1701778_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038626013.1|1702039_1702312_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_038626015.1|1702348_1703341_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.6	8.7e-71
>prophage 140
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1707538	1711441	4271053		Klosneuvirus(100.0%)	1	NA	NA
WP_038629988.1|1707538_1711441_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	28.9	2.1e-51
>prophage 141
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1714634	1715939	4271053		Bacillus_phage(100.0%)	1	NA	NA
WP_038626031.1|1714634_1715939_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	27.1	3.3e-17
>prophage 142
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1730468	1734683	4271053		Saudi_moumouvirus(50.0%)	3	NA	NA
WP_038626056.1|1730468_1731983_+	carboxylesterase/lipase family protein	NA	A0A1S5V000	Saudi_moumouvirus	36.7	1.0e-30
WP_038629989.1|1732159_1733827_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_038626057.1|1733828_1734683_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.7	3.0e-11
>prophage 143
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1741565	1745468	4271053		Pandoravirus(50.0%)	3	NA	NA
WP_038626071.1|1741565_1742960_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.3	2.6e-44
WP_038626073.1|1742987_1743911_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_038626075.1|1744025_1745468_-	aldehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	26.7	2.9e-06
>prophage 144
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1772921	1775069	4271053		Salmonella_phage(100.0%)	1	NA	NA
WP_038626112.1|1772921_1775069_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.8	1.2e-133
>prophage 145
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1780715	1782284	4271053		Bacillus_virus(100.0%)	1	NA	NA
WP_038626124.1|1780715_1782284_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	33.3	1.0e-41
>prophage 146
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1797075	1798611	4271053		Escherichia_phage(100.0%)	1	NA	NA
WP_038626145.1|1797075_1798611_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	42.6	2.8e-20
>prophage 147
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1803341	1804085	4271053		Tetraselmis_virus(100.0%)	1	NA	NA
WP_038626157.1|1803341_1804085_+	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	24.9	1.7e-07
>prophage 148
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1821428	1831976	4271053		Acinetobacter_phage(50.0%)	8	NA	NA
WP_081981791.1|1821428_1822310_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	55.0	8.5e-78
WP_038629999.1|1822378_1824526_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	21.1	1.4e-20
WP_038626189.1|1824575_1825367_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	31.3	9.4e-36
WP_038626191.1|1825353_1827720_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	48.1	2.9e-205
WP_038626193.1|1827709_1829152_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	43.1	1.5e-92
WP_038626195.1|1829148_1830477_-	guanine deaminase	NA	NA	NA	NA	NA
WP_038626197.1|1830857_1831607_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_038626199.1|1831649_1831976_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.9	2.4e-22
>prophage 149
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1836945	1838082	4271053		Planktothrix_phage(100.0%)	1	NA	NA
WP_038626209.1|1836945_1838082_+	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	31.8	1.8e-24
>prophage 150
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1852182	1853706	4271053		Cedratvirus(100.0%)	1	NA	NA
WP_038626231.1|1852182_1853706_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	1.1e-11
>prophage 151
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1860683	1862201	4271053		Bacillus_virus(100.0%)	1	NA	NA
WP_038626243.1|1860683_1862201_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.1	6.3e-12
>prophage 152
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1872441	1878422	4271053	holin	Catovirus(50.0%)	4	NA	NA
WP_038626266.1|1872441_1874127_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	28.9	9.0e-52
WP_038626268.1|1874169_1875636_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_038626270.1|1875647_1876250_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_052133898.1|1876412_1878422_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	2.0e-21
>prophage 153
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1882164	1883439	4271053	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_038626278.1|1882164_1883439_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.4	6.1e-85
>prophage 154
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1887462	1887984	4271053		Salmonella_phage(100.0%)	1	NA	NA
WP_038626286.1|1887462_1887984_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	63.2	4.1e-56
>prophage 155
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1893822	1900565	4271053		Streptomyces_phage(20.0%)	7	NA	NA
WP_038626298.1|1893822_1894644_+	NlpC/P60 family protein	NA	A0A2H5BM69	Streptomyces_phage	38.9	9.2e-18
WP_103790931.1|1894704_1894794_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_038626300.1|1895078_1896104_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.0	9.7e-33
WP_038626301.1|1896153_1897089_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038626303.1|1897200_1898385_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	27.1	8.9e-14
WP_038626305.1|1898688_1899837_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	44.5	6.1e-84
WP_038626307.1|1899905_1900565_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.8	4.0e-24
>prophage 156
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1906776	1911925	4271053		environmental_halophage(33.33%)	5	NA	NA
WP_038626319.1|1906776_1908000_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	1.4e-91
WP_038626321.1|1907996_1909277_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_038626323.1|1909251_1909998_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	29.1	2.9e-10
WP_038626326.1|1910046_1911543_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_038626328.1|1911550_1911925_-	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	34.9	7.4e-15
>prophage 158
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1952157	1963369	4271053		Trichoplusia_ni_ascovirus(25.0%)	10	NA	NA
WP_038626396.1|1952157_1952919_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	2.5e-17
WP_038626398.1|1953043_1953631_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_038626401.1|1953810_1955202_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_038626402.1|1955400_1957665_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.6	3.5e-144
WP_038626405.1|1957828_1958227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038626407.1|1958293_1958629_-	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_038626409.1|1958905_1960096_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_038626411.1|1960217_1961045_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	7.2e-71
WP_038626413.1|1961377_1962241_+	excinuclease Cho	NA	NA	NA	NA	NA
WP_103790933.1|1962406_1963369_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	53.5	1.1e-75
>prophage 159
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1969178	1970396	4271053		Klosneuvirus(100.0%)	1	NA	NA
WP_038626423.1|1969178_1970396_-	acetylornithine/succinylornithine family transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.5	1.6e-26
>prophage 160
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1982758	1983547	4271053		Bacillus_virus(100.0%)	1	NA	NA
WP_038626436.1|1982758_1983547_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	1.0e-29
>prophage 161
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	1997139	2005476	4271053		Acanthocystis_turfacea_Chlorella_virus(33.33%)	9	NA	NA
WP_038626452.1|1997139_1998573_+	serine/threonine protein kinase	NA	M1HKB5	Acanthocystis_turfacea_Chlorella_virus	27.0	2.3e-08
WP_038626454.1|1998606_1999284_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_038626456.1|1999578_1999809_-	putative cation transport regulator ChaB	NA	NA	NA	NA	NA
WP_038626458.1|2000199_2001297_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_038626460.1|2001461_2002316_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.1	1.3e-46
WP_038626461.1|2002348_2003158_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_038626462.1|2003154_2003553_-	siroheme synthase	NA	NA	NA	NA	NA
WP_038626464.1|2003566_2004394_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_038626466.1|2004393_2005476_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	40.3	3.3e-07
>prophage 162
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2008605	2009553	4271053		Tupanvirus(100.0%)	1	NA	NA
WP_038626473.1|2008605_2009553_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.5	7.8e-45
>prophage 163
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2039494	2056676	4271053		Moraxella_phage(25.0%)	7	NA	NA
WP_052133903.1|2039494_2049424_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	37.9	9.0e-51
WP_038626520.1|2049496_2050012_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_038626523.1|2050014_2051652_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_038626525.1|2052393_2052960_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A088CE87	Shigella_phage	31.0	1.4e-12
WP_038626527.1|2053170_2053923_-	glucose 1-dehydrogenase	NA	A0A0M4JSW6	Mollivirus	28.3	3.7e-13
WP_038626529.1|2054034_2054925_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052133904.1|2055119_2056676_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.4	3.6e-07
>prophage 164
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2065026	2065968	4271053		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_038626545.1|2065026_2065968_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	27.9	2.1e-05
>prophage 165
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2086012	2087179	4271053		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_038626568.1|2086012_2087179_+	glutathione-dependent formaldehyde dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	27.6	7.7e-10
>prophage 166
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2098547	2099564	4271053		Tupanvirus(100.0%)	1	NA	NA
WP_038626589.1|2098547_2099564_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.0	1.3e-45
>prophage 167
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2104714	2105983	4271053		Cronobacter_phage(100.0%)	1	NA	NA
WP_038626600.1|2104714_2105983_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	62.1	3.7e-151
>prophage 168
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2111265	2112054	4271053		Planktothrix_phage(100.0%)	1	NA	NA
WP_052133908.1|2111265_2112054_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.1	2.8e-24
>prophage 169
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2117031	2119118	4271053		Morganella_phage(50.0%)	4	NA	NA
WP_038626612.1|2117031_2117451_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.5	1.1e-35
WP_052133909.1|2117900_2118143_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038626614.1|2118171_2118765_-	LysE family translocator	NA	NA	NA	NA	NA
WP_038626615.1|2118851_2119118_-	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	52.3	3.1e-15
>prophage 170
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2125396	2126164	4271053		Escherichia_phage(100.0%)	1	NA	NA
WP_038626618.1|2125396_2126164_-	DNA-binding transcriptional repressor	NA	A0A077SK06	Escherichia_phage	28.6	9.8e-22
>prophage 171
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2138305	2139631	4271053		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_038626642.1|2138305_2139631_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.7	2.7e-104
>prophage 172
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2144592	2145321	4271053		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_038626654.1|2144592_2145321_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	35.1	2.7e-21
>prophage 173
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2154318	2155629	4271053		Burkholderia_virus(100.0%)	1	NA	NA
WP_038626674.1|2154318_2155629_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.3	1.5e-62
>prophage 174
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2164933	2169213	4271053		Enterobacteria_phage(50.0%)	2	NA	NA
WP_038626691.1|2164933_2166016_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.9	1.6e-190
WP_038626692.1|2166138_2169213_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
>prophage 175
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2177951	2179205	4271053		Phage_21(100.0%)	1	NA	NA
WP_038626698.1|2177951_2179205_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	8.8e-20
>prophage 176
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2182353	2183724	4271053		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_038626706.1|2182353_2183724_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	2.1e-107
>prophage 177
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2188689	2196262	4271053		Bacillus_virus(33.33%)	8	NA	NA
WP_038626717.1|2188689_2189805_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	37.4	6.2e-33
WP_103790982.1|2189797_2190649_+	spermidine/putrescine ABC transporter permease PotB	NA	NA	NA	NA	NA
WP_038626721.1|2190645_2191419_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_038626723.1|2191429_2192476_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_038626725.1|2192531_2193371_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.6	2.8e-22
WP_038626727.1|2193385_2194294_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_038626729.1|2194316_2195558_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_038626731.1|2195557_2196262_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	42.4	9.3e-35
>prophage 178
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2216777	2217410	4271053		Pseudomonas_phage(100.0%)	1	NA	NA
WP_038626768.1|2216777_2217410_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	40.5	7.3e-31
>prophage 179
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2220700	2221826	4271053		Ralstonia_phage(50.0%)	2	NA	NA
WP_038626777.1|2220700_2220937_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	46.6	9.1e-11
WP_038626780.1|2221091_2221826_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.6e-13
>prophage 180
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2234170	2235139	4271053		Brevibacillus_phage(100.0%)	1	NA	NA
WP_038626804.1|2234170_2235139_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	39.7	2.3e-15
>prophage 181
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2250659	2254579	4271053		Enterobacteria_phage(50.0%)	4	NA	NA
WP_038626837.1|2250659_2250905_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	44.9	1.1e-11
WP_038626839.1|2251052_2251328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038626841.1|2251898_2253014_+	N-methyl-L-tryptophan oxidase	NA	NA	NA	NA	NA
WP_038626843.1|2253109_2254579_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	34.6	1.2e-60
>prophage 182
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2259016	2259937	4271053		Morganella_phage(100.0%)	1	NA	NA
WP_038626850.1|2259016_2259937_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	43.0	2.9e-60
>prophage 183
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2267987	2268539	4271053		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_052133916.1|2267987_2268539_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	45.3	1.3e-28
>prophage 184
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2276458	2277961	4271053		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038626874.1|2276458_2277961_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	46.1	1.2e-95
>prophage 185
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2285816	2286524	4271053		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_038626882.1|2285816_2286524_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.4	9.4e-11
>prophage 186
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2314109	2316004	4271053		Enterobacteria_phage(100.0%)	2	NA	NA
WP_038626921.1|2314109_2314634_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	62.4	2.6e-26
WP_038626923.1|2314672_2316004_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	79.9	5.1e-183
>prophage 187
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2322267	2323366	4271053	protease	uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_038626932.1|2322267_2322930_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	56.2	2.1e-49
WP_038626936.1|2323039_2323366_+	sulfurtransferase TusE	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	54.6	6.2e-26
>prophage 188
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2327222	2329277	4271053		Catovirus(100.0%)	1	NA	NA
WP_038626954.1|2327222_2329277_-	DNA helicase IV	NA	A0A1V0SAC2	Catovirus	24.7	3.9e-09
>prophage 189
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2341851	2343777	4271053		Tupanvirus(100.0%)	1	NA	NA
WP_038626982.1|2341851_2343777_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.5	5.3e-48
>prophage 190
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2352623	2353409	4271053		Bacillus_virus(100.0%)	1	NA	NA
WP_038626999.1|2352623_2353409_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	2.1e-27
>prophage 191
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2357745	2360622	4271053	tRNA	Bandra_megavirus(50.0%)	2	NA	NA
WP_038627008.1|2357745_2359146_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.7	8.5e-80
WP_103790902.1|2359449_2360622_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.1	5.0e-102
>prophage 192
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2376984	2381519	4271053		Bacillus_phage(50.0%)	3	NA	NA
WP_038627035.1|2376984_2378733_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	1.6e-59
WP_038627037.1|2378768_2381030_-	ComEC family protein	NA	NA	NA	NA	NA
WP_038627039.1|2381234_2381519_-	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	36.4	4.1e-10
>prophage 193
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2385664	2386750	4271053		Streptococcus_phage(100.0%)	1	NA	NA
WP_038627047.1|2385664_2386750_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	48.9	1.9e-87
>prophage 194
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2390099	2412527	4271053	protease,tRNA	Tetraselmis_virus(18.18%)	16	NA	NA
WP_038627053.1|2390099_2392388_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	43.0	9.7e-166
WP_038627055.1|2392552_2393293_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.1	1.0e-20
WP_038627057.1|2393356_2394508_-	MFS transporter	NA	NA	NA	NA	NA
WP_038627060.1|2394912_2396205_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	1.2e-96
WP_038627062.1|2396304_2397648_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.2	2.4e-79
WP_038627064.1|2397655_2398267_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_038627066.1|2398458_2402148_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.8	8.2e-90
WP_017347019.1|2402266_2402761_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_038627069.1|2403283_2404252_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	5.7e-59
WP_038627071.1|2404396_2406166_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W5SAS9	Pithovirus	31.6	4.0e-10
WP_038627073.1|2406165_2407899_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.6	7.6e-14
WP_038627075.1|2407931_2408633_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|2408961_2409180_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_038627078.1|2409322_2411599_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	7.9e-168
WP_038627080.1|2411655_2411976_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	3.1e-14
WP_038627082.1|2412299_2412527_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	1.3e-14
>prophage 195
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2420452	2423188	4271053		Roseobacter_phage(50.0%)	4	NA	NA
WP_103790899.1|2420452_2421277_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	34.6	2.3e-08
WP_038627096.1|2421273_2421594_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038627097.1|2421702_2422245_+	lipoprotein	NA	NA	NA	NA	NA
WP_038627099.1|2422459_2423188_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.4	1.1e-27
>prophage 196
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2426335	2435636	4271053		Moumouvirus(25.0%)	11	NA	NA
WP_038627109.1|2426335_2427463_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2P1ELP3	Moumouvirus	26.5	3.0e-11
WP_038627111.1|2427523_2428000_-	YbjO family protein	NA	NA	NA	NA	NA
WP_038627113.1|2428123_2428969_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_038627115.1|2428965_2429910_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_038627118.1|2429920_2431054_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	3.2e-29
WP_038627120.1|2431174_2432287_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_038627122.1|2432680_2433160_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_038627125.1|2433249_2434152_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	4.4e-37
WP_038627127.1|2434172_2434895_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_038627128.1|2434878_2435169_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_038627131.1|2435372_2435636_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	62.0	2.3e-23
>prophage 197
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2442049	2443252	4271053		Stx2-converting_phage(100.0%)	1	NA	NA
WP_081981817.1|2442049_2443252_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	50.3	4.0e-102
>prophage 198
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2454550	2462937	4271053		Planktothrix_phage(33.33%)	6	NA	NA
WP_038627161.1|2454550_2456410_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	27.2	5.9e-12
WP_038630069.1|2456419_2457373_-	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
WP_038627164.1|2457613_2458846_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_038627165.1|2458847_2459612_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SIK8	Klosneuvirus	26.9	1.3e-10
WP_052134021.1|2459714_2461274_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_038627167.1|2461344_2462937_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.0	1.9e-59
>prophage 199
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2473796	2476862	4271053		Streptomyces_phage(50.0%)	4	NA	NA
WP_038627182.1|2473796_2474300_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	5.8e-07
WP_038627184.1|2474641_2475388_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_038627186.1|2475483_2476143_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_038627188.1|2476139_2476862_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	40.4	3.6e-34
>prophage 200
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2484730	2490835	4271053		Bacillus_phage(33.33%)	6	NA	NA
WP_038627197.1|2484730_2486899_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.0	1.2e-45
WP_038627198.1|2487016_2487538_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038630075.1|2487534_2488089_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038627200.1|2488246_2488981_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	55.8	1.7e-63
WP_038627202.1|2489168_2489903_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_038627204.1|2489899_2490835_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.1	3.7e-07
>prophage 201
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2500445	2501195	4271053		Bacillus_phage(100.0%)	1	NA	NA
WP_038627218.1|2500445_2501195_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	38.1	8.1e-05
>prophage 202
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2506884	2507832	4271053		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_038627229.1|2506884_2507832_+	2-hydroxyacid dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	26.3	1.6e-18
>prophage 203
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2511391	2513434	4271053		Bacillus_virus(100.0%)	1	NA	NA
WP_052134022.1|2511391_2513434_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	37.9	6.0e-26
>prophage 204
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2525127	2525784	4271053		Planktothrix_phage(100.0%)	1	NA	NA
WP_038627248.1|2525127_2525784_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	7.3e-18
>prophage 205
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2534795	2536292	4271053		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_038627260.1|2534795_2536292_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.6	4.7e-52
>prophage 206
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2548912	2549821	4271053		Streptococcus_phage(100.0%)	1	NA	NA
WP_038627284.1|2548912_2549821_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	26.8	4.0e-22
>prophage 207
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2557181	2558474	4271053		Klosneuvirus(100.0%)	1	NA	NA
WP_038627294.1|2557181_2558474_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	5.0e-18
>prophage 208
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2564216	2569548	4271053		Planktothrix_phage(50.0%)	6	NA	NA
WP_038627305.1|2564216_2565278_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.7	3.2e-23
WP_038627307.1|2565277_2565967_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_038627308.1|2565966_2566743_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038627310.1|2566892_2567048_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_038627313.1|2567218_2568001_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_038627315.1|2568078_2569548_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	2.5e-10
>prophage 209
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2574143	2583116	4271053		Edwardsiella_phage(20.0%)	8	NA	NA
WP_038627325.1|2574143_2575196_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.6	8.9e-82
WP_038627327.1|2575488_2575851_+	homeobox protein YbgS	NA	NA	NA	NA	NA
WP_038627329.1|2576038_2576632_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_038627331.1|2576613_2579763_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	29.7	7.6e-28
WP_038627334.1|2579731_2580667_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.2	5.2e-25
WP_038627336.1|2580663_2581380_-	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	27.3	2.8e-18
WP_038627338.1|2581403_2582462_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_038627340.1|2582624_2583116_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.8	3.8e-27
>prophage 210
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2607454	2608243	4271053		Kaumoebavirus(100.0%)	1	NA	NA
WP_038627383.1|2607454_2608243_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.3	5.2e-10
>prophage 211
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2613895	2615359	4271053		Hokovirus(100.0%)	1	NA	NA
WP_052133927.1|2613895_2615359_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	30.1	2.1e-57
>prophage 212
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2620190	2620955	4271053		Mycobacterium_phage(100.0%)	1	NA	NA
WP_038627404.1|2620190_2620955_+	esterase	NA	G1DB77	Mycobacterium_phage	36.6	4.9e-05
>prophage 213
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2628987	2630655	4271053	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_038627415.1|2628987_2630655_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.9	2.9e-289
>prophage 214
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2636719	2638387	4271053		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_038627425.1|2636719_2638387_+	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	40.5	3.8e-87
>prophage 215
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2642329	2643388	4271053		Pseudomonas_phage(100.0%)	1	NA	NA
WP_038627431.1|2642329_2643388_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	5.5e-47
>prophage 216
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2649268	2653495	4271053	tRNA	Planktothrix_phage(50.0%)	4	NA	NA
WP_038627445.1|2649268_2649994_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.3	2.4e-30
WP_038627447.1|2650195_2650678_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_084971216.1|2650698_2650896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038627449.1|2650912_2653495_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.1	4.5e-188
>prophage 217
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2659738	2666928	4271053		Synechococcus_phage(25.0%)	10	NA	NA
WP_038627463.1|2659738_2660815_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	48.3	3.0e-16
WP_038627464.1|2660956_2662168_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.2	1.1e-107
WP_038627466.1|2662267_2662531_+	DUF493 family protein	NA	NA	NA	NA	NA
WP_038627468.1|2662612_2663272_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_038627470.1|2663444_2664410_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_144380563.1|2664458_2664677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038627474.1|2664751_2664952_-	twin-arginine translocase subunit TatE	NA	NA	NA	NA	NA
WP_038627476.1|2665095_2665893_-	deaminated glutathione amidase	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.2	1.4e-10
WP_038627477.1|2665946_2666375_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038627478.1|2666718_2666928_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	81.2	2.4e-23
>prophage 218
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2674654	2683575	4271053	transposase,integrase,tRNA	Cyanophage(25.0%)	8	2675919:2675935	2688152:2688168
WP_038627487.1|2674654_2676130_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.6	1.7e-78
2675919:2675935	attL	ATCGGCTGCTGCTGGAG	NA	NA	NA	NA
WP_144380564.1|2676375_2677836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144380582.1|2678068_2678656_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	60.0	3.8e-26
WP_038627492.1|2678992_2679859_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.1	2.6e-31
WP_038627494.1|2679858_2680071_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_038627496.1|2680150_2681233_-	oxidoreductase	NA	NA	NA	NA	NA
WP_038627498.1|2681225_2681984_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_038627500.1|2682189_2683575_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.7	2.8e-43
2688152:2688168	attR	CTCCAGCAGCAGCCGAT	NA	NA	NA	NA
>prophage 219
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2689230	2691337	4271053	protease	Bacillus_phage(50.0%)	3	NA	NA
WP_038630092.1|2689230_2689917_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	3.5e-10
WP_038630093.1|2689887_2690511_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_038627512.1|2690539_2691337_+	SDR family oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	24.7	1.0e-05
>prophage 220
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2694759	2697384	4271053		uncultured_virus(100.0%)	1	NA	NA
WP_038627522.1|2694759_2697384_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.0	6.0e-103
>prophage 221
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2707891	2713430	4271053		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
WP_038627540.1|2707891_2709760_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.1	2.4e-114
WP_038627541.1|2709863_2710469_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_038627543.1|2710468_2710798_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_038627545.1|2710849_2712799_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.2	4.0e-43
WP_038627548.1|2712878_2713430_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.8	1.1e-27
>prophage 222
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2726126	2732134	4271053		Bacillus_phage(66.67%)	4	NA	NA
WP_038627578.1|2726126_2727896_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.8	1.7e-37
WP_038627580.1|2727888_2729664_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	5.7e-49
WP_038627582.1|2729717_2730179_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_038627583.1|2731438_2732134_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	72.4	2.4e-91
>prophage 223
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2735382	2740438	4271053	protease	Sodalis_phage(25.0%)	4	NA	NA
WP_038627591.1|2735382_2735655_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	57.3	1.1e-20
WP_038627593.1|2735867_2738222_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.3	1.3e-226
WP_038627595.1|2738411_2739686_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.1	1.9e-131
WP_038627597.1|2739814_2740438_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.9	4.9e-64
>prophage 224
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2763595	2770908	4271053	tRNA	uncultured_Mediterranean_phage(60.0%)	8	NA	NA
WP_038627637.1|2763595_2764066_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	44.7	8.6e-29
WP_038627638.1|2764155_2765262_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.5	1.8e-48
WP_038627640.1|2765265_2765715_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_052133930.1|2765897_2766497_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_038627642.1|2766572_2767541_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.6	1.2e-45
WP_071883699.1|2767551_2769399_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_038627644.1|2769426_2769759_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.2	1.5e-11
WP_038627646.1|2769783_2770908_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.0	4.0e-88
>prophage 225
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2775230	2776931	4271053		Pseudomonas_phage(100.0%)	1	NA	NA
WP_144380565.1|2775230_2776931_+	acyltransferase family protein	NA	B5WZU0	Pseudomonas_phage	26.9	4.7e-32
>prophage 226
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2780156	2792151	4271053		Bacillus_phage(40.0%)	9	NA	NA
WP_038627655.1|2780156_2781260_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.6	5.2e-101
WP_038627656.1|2781663_2782584_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_038627658.1|2782596_2783916_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.7	2.8e-24
WP_038627659.1|2783930_2784620_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	35.7	5.0e-33
WP_038627661.1|2784824_2786054_+	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_038627662.1|2786050_2789728_+	hypothetical protein	NA	G3MAB6	Bacillus_virus	27.9	1.8e-12
WP_071883746.1|2789795_2790179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038630101.1|2790175_2791093_-	fructokinase	NA	NA	NA	NA	NA
WP_038630102.1|2791239_2792151_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	65.6	1.6e-103
>prophage 227
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2799832	2805805	4271053		Enterobacteria_phage(33.33%)	7	NA	NA
WP_071883701.1|2799832_2800006_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	88.9	7.1e-05
WP_038627682.1|2800245_2800458_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	74.6	4.6e-22
WP_038627683.1|2800808_2801486_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_038627685.1|2801668_2801920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081981825.1|2801922_2802555_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038627687.1|2802715_2803009_-	peptidase inhibitor	NA	NA	NA	NA	NA
WP_103790955.1|2803270_2805805_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.8	1.2e-12
>prophage 228
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2811181	2812569	4271053		Planktothrix_phage(50.0%)	3	NA	NA
WP_038627700.1|2811181_2811859_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.9e-25
WP_038627702.1|2811934_2812129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081981827.1|2812221_2812569_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	46.6	4.3e-17
>prophage 229
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2819091	2822606	4271053		Tupanvirus(50.0%)	4	NA	NA
WP_038627712.1|2819091_2820150_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.0	3.0e-69
WP_038627714.1|2820280_2820676_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144380566.1|2820882_2821704_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_038627716.1|2821748_2822606_-	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	47.5	8.3e-62
>prophage 230
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2842234	2843932	4271053		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_038627740.1|2842234_2843932_-	molecular chaperone HscC	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	34.7	1.8e-84
>prophage 231
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2847656	2856176	4271053		uncultured_Caudovirales_phage(25.0%)	10	NA	NA
WP_038627746.1|2847656_2848616_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.8	3.8e-63
WP_038627748.1|2848605_2849610_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_038627750.1|2849606_2850365_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	27.1	8.8e-15
WP_038627752.1|2850473_2850833_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_038627754.1|2851116_2852496_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	9.0e-58
WP_038627757.1|2852544_2852883_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_038627759.1|2852974_2853358_+	RidA family protein	NA	NA	NA	NA	NA
WP_038627761.1|2853412_2853598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038627763.1|2853882_2854851_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_038627765.1|2855165_2856176_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.9	1.1e-28
>prophage 232
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2860252	2868049	4271053		Bodo_saltans_virus(25.0%)	6	NA	NA
WP_038627774.1|2860252_2860957_-	metal ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	23.2	1.9e-08
WP_038627778.1|2861522_2863958_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	50.9	2.3e-08
WP_038627779.1|2863961_2864861_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_038627781.1|2865000_2865663_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	31.3	1.1e-21
WP_038627783.1|2865883_2867152_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_038627785.1|2867284_2868049_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.8	2.5e-17
>prophage 233
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2879225	2925175	4271053	protease,integrase,coat,portal,tail	Enterobacteria_phage(26.19%)	63	2869899:2869916	2929969:2929986
2869899:2869916	attL	CGCGCGAACTGCTGGCGC	NA	NA	NA	NA
WP_038627799.1|2879225_2879585_+	GtrA family protein	NA	F1C5B1	Cronobacter_phage	61.7	2.3e-34
WP_038627801.1|2879581_2880505_+	glycosyltransferase	NA	M1FQW5	Enterobacteria_phage	84.5	6.2e-148
WP_038627804.1|2880491_2881880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052133937.1|2881900_2884015_-	hypothetical protein	NA	Q0H8C6	Salmonella_phage	58.5	3.0e-52
WP_038627806.1|2884039_2884549_+	HNH endonuclease	NA	A5H1J6	Xanthomonas_virus	44.0	6.7e-27
WP_038627808.1|2884627_2884972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052133938.1|2884925_2887640_-	transglycosylase SLT domain-containing protein	NA	A0A291LBB8	Klebsiella_phage	35.6	6.3e-23
WP_052133939.1|2887639_2888956_-	hypothetical protein	NA	A0A1R3Y5Q4	Salmonella_virus	53.6	3.7e-45
WP_038627809.1|2888955_2889621_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	70.6	6.7e-59
WP_071883702.1|2889586_2890075_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	71.7	8.0e-62
WP_038627811.1|2890082_2890754_-|tail	tail protein	tail	A0A088CPT1	Enterobacteria_phage	53.9	1.2e-28
WP_038627812.1|2890753_2892175_-	Packaged DNA stabilization protein gp10	NA	A0A088CQ70	Enterobacteria_phage	71.2	2.6e-201
WP_038627813.1|2892134_2892650_-	Packaged DNA stabilization protein gp4	NA	Q76H19	Enterobacteria_phage	67.8	2.0e-58
WP_052133940.1|2892627_2892870_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	61.4	1.3e-09
WP_038627814.1|2892910_2894215_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	67.8	5.9e-168
WP_038627815.1|2894214_2895126_-	scaffolding protein	NA	G5DA98	Enterobacteria_phage	79.6	4.4e-122
WP_038627817.1|2895140_2897321_-|portal	portal protein	portal	A0A075B8I1	Enterobacteria_phage	70.3	1.7e-292
WP_081981830.1|2897219_2897867_+	HNH endonuclease	NA	A0A0M4R2Z1	Salmonella_phage	80.1	6.2e-78
WP_038627819.1|2897871_2899320_-	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	77.3	5.6e-228
WP_038627821.1|2899288_2899789_-	hypothetical protein	NA	F8TUR4	EBPR_podovirus	48.4	4.3e-26
WP_038627822.1|2899800_2900040_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	57.7	2.2e-12
WP_038627824.1|2900093_2900360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038627828.1|2900638_2901592_-	hypothetical protein	NA	H2DE35	Erwinia_phage	31.4	3.3e-27
WP_038627830.1|2901787_2902084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038627832.1|2902080_2902425_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	49.1	7.0e-20
WP_038627833.1|2902421_2902889_-	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	47.7	2.0e-30
WP_081981864.1|2902857_2903091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133942.1|2903667_2904282_-	hypothetical protein	NA	A0A1V0E5R2	Salmonella_phage	44.8	1.9e-36
WP_103790954.1|2904271_2904397_-	YlcG family protein	NA	A0A2H4JF91	uncultured_Caudovirales_phage	85.0	4.3e-12
WP_038627834.1|2904393_2904999_-	bacteriophage Lambda NinG protein	NA	S4TSR3	Salmonella_phage	48.3	4.5e-46
WP_038627835.1|2904991_2905303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071883703.1|2905295_2905439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038627836.1|2905435_2905609_-	NinE family protein	NA	Q5G8S3	Enterobacteria_phage	55.4	8.1e-09
WP_038627838.1|2905593_2905935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038627839.1|2905927_2906293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038627841.1|2906289_2906484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038627844.1|2906480_2906936_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	78.5	2.8e-69
WP_038627846.1|2907117_2907873_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	90.4	4.3e-139
WP_038627849.1|2907874_2908117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133943.1|2908116_2908482_-	DUF2591 domain-containing protein	NA	A0A2D1GLI3	Escherichia_phage	38.2	7.7e-17
WP_038627851.1|2908478_2910362_-	AAA family ATPase	NA	Q5G8S8	Enterobacteria_phage	79.6	3.2e-308
WP_038627853.1|2910470_2911337_-	replication protein	NA	K7PL20	Enterobacteria_phage	51.0	8.4e-70
WP_071883704.1|2911497_2911788_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	66.7	1.6e-25
WP_038627857.1|2911911_2912139_-	transcriptional regulator	NA	G9L677	Escherichia_phage	80.0	2.4e-29
WP_038627859.1|2912216_2912900_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	62.6	1.1e-64
WP_144380584.1|2913080_2913179_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_038627862.1|2913281_2913530_+	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	63.0	7.5e-24
WP_052133944.1|2913526_2914000_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	52.4	5.4e-39
WP_038627865.1|2913989_2914424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144380567.1|2914724_2914949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038627867.1|2914951_2915149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071883706.1|2915109_2915388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103790988.1|2916436_2916562_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_038627870.1|2916564_2916762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038627872.1|2916928_2917801_+	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	52.3	1.1e-61
WP_038627875.1|2917800_2918304_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	63.9	3.6e-57
WP_038627877.1|2918322_2918625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038627879.1|2918627_2918846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038627882.1|2918842_2919133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038627883.1|2920026_2921190_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	68.3	2.0e-159
WP_038627885.1|2921453_2922707_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.8	6.8e-97
WP_038627888.1|2922717_2923821_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	5.0e-59
WP_038627890.1|2924065_2925175_+	membrane protein	NA	Q1MVN1	Enterobacteria_phage	51.0	4.2e-98
2929969:2929986	attR	CGCGCGAACTGCTGGCGC	NA	NA	NA	NA
>prophage 234
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2929595	2931101	4271053		Pithovirus(100.0%)	1	NA	NA
WP_038627900.1|2929595_2931101_+	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	24.3	1.8e-06
>prophage 235
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2936325	2936907	4271053		Caulobacter_phage(100.0%)	1	NA	NA
WP_038627912.1|2936325_2936907_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.0	4.8e-13
>prophage 236
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2953998	2954736	4271053		Planktothrix_phage(100.0%)	1	NA	NA
WP_038627947.1|2953998_2954736_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	1.3e-34
>prophage 237
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2965997	2970226	4271053		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_038627980.1|2965997_2966726_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	4.2e-38
WP_071883707.1|2966667_2967246_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	61.0	4.4e-51
WP_038627984.1|2967230_2967965_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_038627987.1|2968007_2968763_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_038627989.1|2968834_2970226_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	39.5	2.2e-11
>prophage 238
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2978960	2979992	4271053		Planktothrix_phage(100.0%)	1	NA	NA
WP_038627996.1|2978960_2979992_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	38.4	1.7e-32
>prophage 239
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	2991425	2995567	4271053		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_038628030.1|2991425_2994908_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	6.7e-211
WP_038628032.1|2994940_2995567_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.2	1.6e-25
>prophage 240
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3004459	3005212	4271053		Flavobacterium_phage(100.0%)	1	NA	NA
WP_038628054.1|3004459_3005212_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	43.7	2.9e-26
>prophage 241
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3017172	3018609	4271053	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_038628078.1|3017172_3018609_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	9.4e-26
>prophage 242
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3021970	3022318	4271053		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_038628088.1|3021970_3022318_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	49.5	5.0e-26
>prophage 243
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3028218	3029013	4271053		Planktothrix_phage(100.0%)	1	NA	NA
WP_038628097.1|3028218_3029013_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.7	7.3e-12
>prophage 244
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3034482	3041305	4271053	tRNA	Bodo_saltans_virus(50.0%)	6	NA	NA
WP_038628104.1|3034482_3036972_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.8	5.1e-35
WP_038628107.1|3037000_3037534_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_038628109.1|3037530_3038235_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_038628110.1|3038411_3038867_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_038628112.1|3038934_3039861_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_038628114.1|3039898_3041305_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	29.8	1.2e-25
>prophage 245
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3046847	3052948	4271053		Anomala_cuprea_entomopoxvirus(33.33%)	6	NA	NA
WP_038628137.1|3046847_3047774_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.1	4.5e-21
WP_081981833.1|3047802_3048549_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_038628142.1|3048630_3049167_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	34.0	1.0e-17
WP_038628144.1|3049405_3050689_+	cystathionine gamma-synthase family protein	NA	NA	NA	NA	NA
WP_038628147.1|3050756_3050984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038628149.1|3051373_3052948_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	39.8	4.5e-13
>prophage 246
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3056160	3056934	4271053		Escherichia_phage(100.0%)	1	NA	NA
WP_038628158.1|3056160_3056934_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	33.9	2.2e-29
>prophage 247
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3066004	3069832	4271053		Enterobacterial_phage(100.0%)	1	NA	NA
WP_038628181.1|3066004_3069832_+	hypothetical protein	NA	Q9LA58	Enterobacterial_phage	31.7	2.4e-84
>prophage 248
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3073237	3081180	4271053		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_038628184.1|3073237_3075925_+	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	22.7	1.5e-24
WP_038628186.1|3076184_3076688_-	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_152334473.1|3077665_3078163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152334474.1|3078298_3079354_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	74.0	4.1e-10
WP_038628189.1|3079755_3081180_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.4	8.7e-40
>prophage 249
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3092249	3092825	4271053		Sphingobium_phage(100.0%)	1	NA	NA
WP_038628211.1|3092249_3092825_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.0	2.2e-10
>prophage 250
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3097245	3100527	4271053		Chrysochromulina_ericina_virus(50.0%)	5	NA	NA
WP_038628222.1|3097245_3098286_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.1	4.8e-104
WP_038628223.1|3098526_3099138_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_038628225.1|3099142_3099886_+	cell division protein ZapD	NA	NA	NA	NA	NA
WP_038628227.1|3099895_3100102_+	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_038628230.1|3100128_3100527_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	32.0	1.3e-06
>prophage 251
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3126444	3130670	4271053		Ostreococcus_lucimarinus_virus(50.0%)	3	NA	NA
WP_038628284.1|3126444_3128169_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.7	2.7e-35
WP_121495252.1|3128904_3129003_+	leu operon leader peptide	NA	NA	NA	NA	NA
WP_038628286.1|3129104_3130670_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.7	1.8e-06
>prophage 252
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3139799	3148410	4271053		Bacillus_virus(33.33%)	6	NA	NA
WP_038628308.1|3139799_3140534_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	37.7	1.7e-23
WP_038628310.1|3140530_3141295_-	DedA family protein	NA	NA	NA	NA	NA
WP_038628313.1|3141488_3141950_-	DUF943 family protein	NA	NA	NA	NA	NA
WP_038628315.1|3141946_3142789_-	DUF3289 family protein	NA	NA	NA	NA	NA
WP_038628318.1|3142990_3145351_+	DNA polymerase II	NA	A0A0N7KVW0	Yellowstone_lake_phycodnavirus	25.3	1.1e-34
WP_038628320.1|3145506_3148410_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	40.4	6.1e-24
>prophage 253
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3156746	3160115	4271053		Pseudomonas_phage(50.0%)	3	NA	NA
WP_038628340.1|3156746_3157610_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	42.3	4.5e-07
WP_038628343.1|3157648_3159532_-	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_038630125.1|3159635_3160115_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	41.2	2.2e-27
>prophage 254
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3166956	3168102	4271053		Halovirus(100.0%)	1	NA	NA
WP_038628356.1|3166956_3168102_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.8	1.4e-51
>prophage 255
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3171549	3174366	4271053	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_038628369.1|3171549_3174366_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.1	1.0e-76
>prophage 256
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3178596	3183156	4271053		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_038628382.1|3178596_3179748_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	47.4	2.9e-78
WP_038628385.1|3180003_3181143_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	33.0	1.3e-25
WP_038628388.1|3181251_3183156_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.7	1.2e-148
>prophage 257
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3186219	3187173	4271053		Cyanophage(100.0%)	1	NA	NA
WP_038628396.1|3186219_3187173_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	9.7e-11
>prophage 258
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3195294	3203191	4271053		Vibrio_phage(25.0%)	8	NA	NA
WP_038628416.1|3195294_3195768_-	protein CreA	NA	A0A2I7SAK3	Vibrio_phage	34.0	1.3e-11
WP_038628418.1|3195966_3196848_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_038628420.1|3196883_3197531_-	phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_038628423.1|3197582_3198104_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_038628426.1|3198110_3198434_-	trp operon repressor	NA	NA	NA	NA	NA
WP_081981835.1|3198478_3200464_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	1.7e-12
WP_038628429.1|3200614_3201379_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	30.4	3.8e-18
WP_038628430.1|3201523_3203191_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	2.9e-42
>prophage 259
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3206837	3208070	4271053		Enterococcus_phage(100.0%)	1	NA	NA
WP_038628437.1|3206837_3208070_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.5	4.1e-86
>prophage 260
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3213614	3214934	4271053		Geobacillus_virus(100.0%)	1	NA	NA
WP_038628448.1|3213614_3214934_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.5	6.1e-80
>prophage 261
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3218235	3221042	4271053		Salmonella_phage(50.0%)	3	NA	NA
WP_071883711.1|3218235_3218397_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	67.9	6.6e-13
WP_038628458.1|3218523_3219138_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_038628460.1|3219452_3221042_-	peptide chain release factor 3	NA	A0A2K5B2A5	Erysipelothrix_phage	25.8	3.6e-34
>prophage 262
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3224659	3232381	4271053		Serratia_phage(50.0%)	4	NA	NA
WP_038628468.1|3224659_3225724_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	44.4	9.3e-63
WP_038628473.1|3226507_3226897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038630129.1|3228068_3228338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081981837.1|3228349_3232381_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.8	6.5e-40
>prophage 263
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3236201	3243474	4271053		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_038628483.1|3236201_3238340_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	40.4	1.2e-19
WP_038628485.1|3238426_3239323_-	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_038628486.1|3239391_3240834_-	serine/threonine protein kinase	NA	A0A1X9WIC8	Cercopithecine_herpesvirus	30.6	4.4e-07
WP_038628487.1|3240861_3243474_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	30.7	1.0e-78
>prophage 264
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3255058	3256057	4271053		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038628501.1|3255058_3256057_-	membrane protein	NA	A0A2H4JEI9	uncultured_Caudovirales_phage	27.7	2.1e-32
>prophage 265
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3280458	3282003	4271053		Salmonella_phage(100.0%)	1	NA	NA
WP_038628547.1|3280458_3282003_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	54.1	5.5e-40
>prophage 266
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3291205	3291979	4271053		Planktothrix_phage(100.0%)	1	NA	NA
WP_052133955.1|3291205_3291979_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	3.2e-28
>prophage 267
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3338414	3338615	4271053		Escherichia_phage(100.0%)	1	NA	NA
WP_103790868.1|3338414_3338615_-	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	6.7e-07
>prophage 268
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3346884	3347895	4271053		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038630150.1|3346884_3347895_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.4	7.6e-30
>prophage 269
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3354483	3355389	4271053		Indivirus(100.0%)	1	NA	NA
WP_038628647.1|3354483_3355389_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	28.3	3.3e-08
>prophage 270
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3364615	3365437	4271053		Yersinia_phage(100.0%)	1	NA	NA
WP_038628670.1|3364615_3365437_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.3	3.0e-45
>prophage 271
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3371077	3372322	4271053	integrase	Stenotrophomonas_phage(100.0%)	1	3368057:3368071	3374161:3374175
3368057:3368071	attL	GCTCCGGCAGCATTT	NA	NA	NA	NA
WP_038628678.1|3371077_3372322_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.2	1.5e-83
WP_038628678.1|3371077_3372322_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.2	1.5e-83
3374161:3374175	attR	AAATGCTGCCGGAGC	NA	NA	NA	NA
>prophage 272
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3385151	3390158	4271053	tRNA	Mycoplasma_phage(50.0%)	3	NA	NA
WP_038628693.1|3385151_3386663_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.7	3.5e-47
WP_038628695.1|3386838_3387297_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_038628697.1|3387302_3390158_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.6	2.4e-142
>prophage 273
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3394349	3395282	4271053		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_038628708.1|3394349_3395282_+	aspartate carbamoyltransferase	NA	M1IFC1	Paramecium_bursaria_Chlorella_virus	39.9	5.5e-51
>prophage 274
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3405893	3410823	4271053		Vibrio_phage(66.67%)	6	NA	NA
WP_038628726.1|3405893_3408014_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	63.1	1.3e-262
WP_038628727.1|3408010_3408475_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2D0YLR2	Vibrio_phage	55.2	2.6e-49
WP_038628728.1|3408639_3409281_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_038628729.1|3409426_3409948_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_038628730.1|3409999_3410431_-	YhbP family protein	NA	NA	NA	NA	NA
WP_038628731.1|3410520_3410823_+	hypothetical protein	NA	Q6VTR5	Choristoneura_fumiferana_defective_polyhedrosis_virus	44.4	2.6e-10
>prophage 275
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3415211	3417137	4271053		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_038628738.1|3415211_3417137_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.3	7.9e-52
>prophage 276
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3422561	3425252	4271053		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_038628747.1|3422561_3425252_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	6.9e-22
>prophage 277
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3430640	3432575	4271053	protease	Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_038628757.1|3430640_3432575_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	49.1	4.9e-118
>prophage 278
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3435966	3441699	4271053		Bacillus_phage(50.0%)	7	NA	NA
WP_038628765.1|3435966_3436629_+	two-component system response regulator PmrA	NA	W8CYM9	Bacillus_phage	39.1	4.3e-34
WP_038628767.1|3436625_3437681_+	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	23.8	1.2e-09
WP_038628769.1|3437874_3439047_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_038628771.1|3439255_3439513_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_038628773.1|3439528_3439840_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_038628775.1|3440098_3441070_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	24.5	1.9e-06
WP_038630163.1|3441432_3441699_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	66.7	1.5e-17
>prophage 279
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3445764	3458794	4271053		Bacillus_virus(14.29%)	14	NA	NA
WP_038630164.1|3445764_3446580_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	8.8e-21
WP_038628788.1|3446807_3447788_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_038628789.1|3447801_3448788_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.6e-40
WP_038628791.1|3448804_3449371_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	87.4	4.6e-61
WP_038628792.1|3449367_3449943_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_038628794.1|3449914_3450466_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_038628795.1|3450471_3451197_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_038628797.1|3451245_3452682_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_038628798.1|3452705_3452993_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	34.1	2.2e-06
WP_038628800.1|3453171_3453657_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_038628801.1|3453730_3454585_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_038628803.1|3454581_3454854_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_038628804.1|3454858_3455575_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_038628805.1|3456454_3458794_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	29.9	7.1e-39
>prophage 280
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3465809	3466298	4271053	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_038628811.1|3465809_3466298_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	48.8	1.3e-27
>prophage 281
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3470136	3472663	4271053	protease	uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_038628821.1|3470136_3471510_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.0	2.1e-22
WP_038628823.1|3471604_3472663_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	2.2e-24
>prophage 282
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3491559	3492603	4271053		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003855260.1|3491559_3492603_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 283
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3505681	3511107	4271053		Morganella_phage(33.33%)	5	NA	NA
WP_038628874.1|3505681_3506602_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.8	4.6e-74
WP_038628876.1|3506953_3507979_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	37.7	1.5e-65
WP_038628878.1|3508047_3509226_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_038628880.1|3509241_3510342_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_038628882.1|3510351_3511107_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.5e-19
>prophage 284
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3519079	3519697	4271053		Streptococcus_phage(100.0%)	1	NA	NA
WP_038628888.1|3519079_3519697_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.5	7.1e-23
>prophage 285
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3528610	3535088	4271053		uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_038628900.1|3528610_3529369_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.0	1.8e-23
WP_052133969.1|3529358_3530075_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_038628902.1|3530078_3530330_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
WP_038628904.1|3530457_3532095_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	C7U092	Ostreococcus_tauri_virus	28.9	2.9e-39
WP_038628906.1|3532091_3532697_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_038628908.1|3532709_3533465_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_038628910.1|3533540_3535088_-	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	50.8	4.7e-07
>prophage 286
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3543582	3544638	4271053		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038628921.1|3543582_3544638_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	49.1	1.3e-08
>prophage 287
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3548443	3550270	4271053		Catovirus(100.0%)	1	NA	NA
WP_038628929.1|3548443_3550270_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	36.5	3.2e-79
>prophage 288
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3555309	3559151	4271053		Bacillus_phage(50.0%)	3	NA	NA
WP_038628942.1|3555309_3557472_-	DNA helicase II	NA	A7KV33	Bacillus_phage	36.4	2.4e-113
WP_038628944.1|3557529_3558246_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_038628946.1|3558245_3559151_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.9	8.6e-17
>prophage 289
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3576044	3582205	4271053		Enterobacteria_phage(40.0%)	6	NA	NA
WP_038628966.1|3576044_3577175_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	33.1	4.4e-18
WP_038628967.1|3577179_3577872_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_038628969.1|3577849_3578731_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	9.0e-104
WP_038628971.1|3578727_3579819_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.1	2.3e-101
WP_038628973.1|3579815_3581078_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.9	1.0e-23
WP_038628975.1|3581074_3582205_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	30.1	2.2e-30
>prophage 290
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3586292	3591593	4271053		Streptomyces_phage(33.33%)	4	NA	NA
WP_038628985.1|3586292_3586625_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.4	2.6e-19
WP_038628987.1|3586742_3588038_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.4	6.1e-40
WP_038628989.1|3588042_3589527_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_038628991.1|3589568_3591593_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	9.0e-115
>prophage 291
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3599197	3600844	4271053		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_038629008.1|3599197_3600844_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.8	2.8e-66
>prophage 292
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3611071	3612934	4271053		Acinetobacter_phage(100.0%)	1	NA	NA
WP_038630176.1|3611071_3612934_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	30.2	2.5e-10
>prophage 293
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3618152	3618887	4271053		Synechococcus_phage(100.0%)	1	NA	NA
WP_038629028.1|3618152_3618887_+	redoxin family protein	NA	A0A1D8KSL1	Synechococcus_phage	56.3	1.2e-45
>prophage 294
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3639446	3640778	4271053		Erwinia_phage(100.0%)	1	NA	NA
WP_038629053.1|3639446_3640778_+	HslU--HslV peptidase ATPase subunit	NA	A0A173GE36	Erwinia_phage	28.8	3.5e-43
>prophage 295
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3646745	3647924	4271053		Salmonella_phage(100.0%)	1	NA	NA
WP_038629061.1|3646745_3647924_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	28.7	6.3e-12
>prophage 296
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3655978	3663343	4271053	tRNA	Feldmannia_irregularis_virus(25.0%)	9	NA	NA
WP_038629079.1|3655978_3656677_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.3e-07
WP_038629082.1|3656673_3658047_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.7	4.2e-15
WP_038629084.1|3658082_3658556_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_038629086.1|3658574_3659396_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_038629087.1|3659468_3660488_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_038629089.1|3660487_3660949_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_038629091.1|3660999_3661251_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	1.5e-16
WP_038629093.1|3661269_3661701_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_038629095.1|3662035_3663343_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	35.1	2.3e-10
>prophage 297
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3666534	3669932	4271053		Vibrio_phage(33.33%)	3	NA	NA
WP_038629104.1|3666534_3667563_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	76.9	2.6e-17
WP_038629108.1|3667574_3668771_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	1.3e-36
WP_038629111.1|3668999_3669932_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	36.6	2.3e-33
>prophage 298
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3683192	3687777	4271053		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_038629134.1|3683192_3683675_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.4	2.0e-25
WP_038629136.1|3683731_3684541_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	30.8	1.7e-19
WP_013094893.1|3684617_3684785_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_038629143.1|3684796_3685033_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_038629145.1|3685271_3685922_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_038629147.1|3686126_3687341_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	4.6e-42
WP_103790979.1|3687321_3687777_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	61.5	6.2e-48
>prophage 299
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3691189	3691849	4271053		Pithovirus(100.0%)	1	NA	NA
WP_081981844.1|3691189_3691849_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	33.7	1.1e-08
>prophage 300
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3699480	3706858	4271053	tRNA	Abalone_herpesvirus(33.33%)	6	NA	NA
WP_038629171.1|3699480_3700104_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	5.7e-20
WP_038629173.1|3700158_3700434_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_038629175.1|3700453_3702565_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_038629177.1|3702568_3703264_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_038629180.1|3703260_3705342_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_038629183.1|3705472_3706858_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	87.6	7.4e-60
>prophage 301
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3715548	3718015	4271053		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_038629202.1|3715548_3716598_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.4	1.0e-08
WP_038629204.1|3716605_3718015_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	9.0e-05
>prophage 302
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3721978	3724768	4271053		Bacillus_phage(100.0%)	1	NA	NA
WP_038629213.1|3721978_3724768_-	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	31.7	1.3e-68
>prophage 303
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3735521	3740900	4271053		Enterobacteria_phage(66.67%)	5	NA	NA
WP_038629224.1|3735521_3736511_-	ribose operon transcriptional repressor RbsR	NA	C6ZCU4	Enterobacteria_phage	31.5	2.6e-35
WP_038629226.1|3736525_3737455_-	ribokinase	NA	NA	NA	NA	NA
WP_038630189.1|3737515_3738391_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	25.1	7.3e-05
WP_038629228.1|3738420_3739392_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_038629230.1|3739388_3740900_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	24.8	1.2e-15
>prophage 304
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3745779	3750274	4271053		Stx_converting_phage(50.0%)	4	NA	NA
WP_038630190.1|3745779_3746172_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	41.8	7.5e-18
WP_038629244.1|3746365_3747028_+	response regulator	NA	NA	NA	NA	NA
WP_038629246.1|3747024_3748377_+	two-component system sensor histidine kinase QseC	NA	NA	NA	NA	NA
WP_038629248.1|3748405_3750274_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.0	2.1e-65
>prophage 305
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3765913	3776673	4271053		Tupanvirus(20.0%)	10	NA	NA
WP_038629283.1|3765913_3767284_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	33.1	8.1e-27
WP_038629285.1|3767515_3769345_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.3	2.0e-129
WP_038629287.1|3769489_3769723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038629289.1|3769883_3770927_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	35.9	1.0e-45
WP_038629291.1|3771029_3771992_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_038629293.1|3771988_3772876_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_038629296.1|3772923_3773691_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.8	2.2e-13
WP_038629298.1|3773703_3774438_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_038629301.1|3774522_3775185_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_038629303.1|3775359_3776673_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	38.3	3.8e-66
>prophage 306
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3782009	3784160	4271053		Bacillus_phage(100.0%)	1	NA	NA
WP_038629308.1|3782009_3784160_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	2.1e-37
>prophage 307
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3790533	3793797	4271053		Escherichia_phage(100.0%)	1	NA	NA
WP_081981848.1|3790533_3793797_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	39.6	3.7e-62
>prophage 308
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3797086	3804682	4271053		Staphylococcus_phage(33.33%)	7	NA	NA
WP_071883725.1|3797086_3797344_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	54.9	1.2e-16
WP_038629327.1|3797307_3797667_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003849659.1|3797684_3797825_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_038629329.1|3798421_3799825_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_038629331.1|3799829_3800930_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	33.9	9.0e-53
WP_038629334.1|3801170_3802256_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_038629337.1|3802273_3804682_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	7.4e-116
>prophage 309
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3808608	3809025	4271053		Synechococcus_phage(100.0%)	1	NA	NA
WP_038629345.1|3808608_3809025_+	heat shock chaperone IbpA	NA	A0A1Z1LWH0	Synechococcus_phage	38.6	4.2e-19
>prophage 310
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3817718	3822562	4271053		Enterobacteria_phage(33.33%)	6	NA	NA
WP_038629367.1|3817718_3818744_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.6	6.5e-13
WP_038629369.1|3818895_3819558_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_038629371.1|3819671_3820238_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_038629373.1|3820527_3821175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038629375.1|3821276_3821825_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	57.4	2.1e-26
WP_038629379.1|3821824_3822562_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	55.1	6.7e-68
>prophage 311
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3839519	3840302	4271053		Escherichia_phage(100.0%)	1	NA	NA
WP_081981867.1|3839519_3840302_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A2L1IV26	Escherichia_phage	88.5	5.0e-05
>prophage 312
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3843849	3845382	4271053		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038629412.1|3843849_3845382_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	3.5e-18
>prophage 313
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3849748	3850747	4271053		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_038630209.1|3849748_3850747_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.8	5.7e-14
>prophage 314
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3862159	3862777	4271053		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_038629439.1|3862159_3862777_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.4	4.3e-60
>prophage 315
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3873994	3874579	4271053		Pseudomonas_phage(100.0%)	1	NA	NA
WP_038629453.1|3873994_3874579_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	B3FJI5	Pseudomonas_phage	38.7	1.3e-21
>prophage 316
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3882328	3884309	4271053		Planktothrix_phage(50.0%)	2	NA	NA
WP_038629462.1|3882328_3883315_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	2.0e-14
WP_038629464.1|3883304_3884309_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	1.6e-16
>prophage 317
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3939628	3943579	4271053		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_038629522.1|3939628_3940006_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.7	4.8e-30
WP_038629528.1|3940089_3940905_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_038629530.1|3941020_3941635_-	phospholipase	NA	NA	NA	NA	NA
WP_038629533.1|3941746_3943579_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.4	5.8e-28
>prophage 318
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3947178	3948309	4271053	transposase	Phage_Gifsy-1(100.0%)	1	NA	NA
WP_038629543.1|3947178_3948309_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	87.5	1.5e-191
>prophage 319
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3951499	3956852	4271053		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_038629549.1|3951499_3953548_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.7	2.1e-26
WP_038629550.1|3953558_3954137_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_038629553.1|3954188_3956852_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	25.8	4.5e-13
>prophage 320
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3964883	3965897	4271053		Tupanvirus(100.0%)	1	NA	NA
WP_038629561.1|3964883_3965897_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.2	4.8e-24
>prophage 321
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	3979408	3980632	4271053		Caulobacter_virus(100.0%)	1	NA	NA
WP_038629578.1|3979408_3980632_-	RtcB family protein	NA	K4K356	Caulobacter_virus	60.9	1.0e-134
>prophage 322
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4002813	4003815	4271053		Mycobacterium_virus(100.0%)	1	NA	NA
WP_038629609.1|4002813_4003815_+	alpha/beta hydrolase	NA	K0GAH4	Mycobacterium_virus	27.5	2.6e-06
>prophage 323
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4010994	4011963	4271053		Pseudomonas_phage(100.0%)	1	NA	NA
WP_038629618.1|4010994_4011963_-	sensor domain-containing diguanylate cyclase	NA	I6XM43	Pseudomonas_phage	41.3	7.0e-09
>prophage 324
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4015131	4017906	4271053		Megavirus(50.0%)	2	NA	NA
WP_038629623.1|4015131_4016358_+	glutathione-dependent formaldehyde dehydrogenase	NA	K7Z7U2	Megavirus	26.2	1.3e-07
WP_038629624.1|4016400_4017906_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.7	1.3e-57
>prophage 325
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4036388	4038213	4271053		Dickeya_phage(66.67%)	3	NA	NA
WP_038629643.1|4036388_4037054_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	59.6	7.9e-60
WP_038629645.1|4037331_4037580_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	1.4e-09
WP_038629646.1|4037583_4038213_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	55.8	5.2e-29
>prophage 326
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4041500	4044262	4271053		Staphylococcus_phage(50.0%)	3	NA	NA
WP_038629651.1|4041500_4042157_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.7	6.4e-14
WP_038629652.1|4042158_4043145_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_038629653.1|4043404_4044262_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.2	1.9e-45
>prophage 327
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4048669	4050152	4271053		Bacillus_virus(50.0%)	2	NA	NA
WP_038629659.1|4048669_4049437_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	23.5	4.1e-12
WP_038629660.1|4049438_4050152_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	29.6	7.7e-13
>prophage 328
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4053519	4055327	4271053		Planktothrix_phage(50.0%)	2	NA	NA
WP_038629664.1|4053519_4054593_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.4	3.4e-20
WP_038629665.1|4054589_4055327_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	26.7	1.2e-13
>prophage 329
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4072319	4074767	4271053		Dickeya_phage(100.0%)	1	NA	NA
WP_038629680.1|4072319_4074767_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	85.7	2.5e-34
>prophage 330
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4081964	4084370	4271053		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_038629685.1|4081964_4084370_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	6.0e-17
>prophage 331
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4097556	4101317	4271053		Bacillus_phage(66.67%)	3	NA	NA
WP_141176431.1|4097556_4098282_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_038629698.1|4098278_4099643_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	1.6e-11
WP_038629699.1|4099697_4101317_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.7	5.8e-141
>prophage 332
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4116318	4117131	4271053		Vibrio_phage(100.0%)	1	NA	NA
WP_038629713.1|4116318_4117131_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.8	7.8e-70
>prophage 333
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4128488	4132592	4271053		Acinetobacter_phage(33.33%)	3	NA	NA
WP_038629725.1|4128488_4129076_+	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	2.5e-62
WP_038629726.1|4129163_4130387_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.3	7.8e-29
WP_038629727.1|4130516_4132592_-	membrane protein	NA	H9YQA8	environmental_Halophage	77.5	1.1e-59
>prophage 334
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4139117	4139885	4271053		Bacillus_virus(100.0%)	1	NA	NA
WP_038629734.1|4139117_4139885_+	taurine ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	36.7	5.4e-36
>prophage 335
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4144029	4145934	4271053		Tupanvirus(100.0%)	1	NA	NA
WP_038629737.1|4144029_4145934_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.5	1.6e-73
>prophage 336
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4151677	4157240	4271053		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_038629745.1|4151677_4152061_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	37.5	1.2e-15
WP_038629746.1|4152060_4152420_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_038629747.1|4152430_4152718_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003852912.1|4152842_4153217_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_038629748.1|4153313_4153784_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_038629749.1|4153877_4155986_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.2	8.0e-58
WP_038629750.1|4156055_4157240_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	26.9	5.2e-14
>prophage 337
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4177175	4178651	4271053	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_038629777.1|4177175_4178123_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.5	9.3e-06
WP_038629778.1|4178138_4178651_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	2.6e-18
>prophage 338
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4191128	4194439	4271053		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_038629786.1|4191128_4192079_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	5.1e-28
WP_038629787.1|4193254_4194439_+	elongation factor Tu	NA	A0A1V0SC62	Catovirus	27.7	8.1e-07
>prophage 339
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4198486	4206835	4271053		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_038629793.1|4198486_4202515_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	4.2e-23
WP_038629794.1|4202611_4206835_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.9	2.2e-67
>prophage 340
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4216498	4221950	4271053		Klosneuvirus(33.33%)	6	NA	NA
WP_038629803.1|4216498_4217164_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	30.3	9.1e-24
WP_038629804.1|4217226_4217817_+	YjaG family protein	NA	NA	NA	NA	NA
WP_038629805.1|4218005_4218278_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	7.2e-20
WP_038629806.1|4218362_4219007_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_038629807.1|4219061_4220342_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_038629808.1|4220360_4221950_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.1e-67
>prophage 341
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4229175	4232859	4271053		Dickeya_phage(100.0%)	1	NA	NA
WP_038629811.1|4229175_4232859_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	82.5	7.8e-24
>prophage 342
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4247174	4248311	4271053		Mycoplasma_phage(100.0%)	1	NA	NA
WP_038629822.1|4247174_4248311_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	49.4	2.2e-17
>prophage 343
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4255372	4255981	4271053		Lactococcus_phage(100.0%)	1	NA	NA
WP_038629828.1|4255372_4255981_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	37.0	5.6e-12
>prophage 344
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4260774	4261329	4271053		Escherichia_phage(100.0%)	1	NA	NA
WP_038629833.1|4260774_4261329_+	DUF2778 domain-containing protein	NA	A0A2L1IV26	Escherichia_phage	92.3	2.7e-05
>prophage 345
NZ_CP009866	Pantoea sp. PSNIH2, complete genome	4271053	4265096	4266503	4271053		Salmonella_phage(100.0%)	1	NA	NA
WP_038630256.1|4265096_4266503_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	77.9	1.4e-196
>prophage 1
NZ_CP009867	Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence	54000	0	9072	54000	transposase,integrase	Burkholderia_phage(40.0%)	9	2606:2623	9789:9806
WP_108742639.1|1118_1781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749988.1|2132_2702_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
2606:2623	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
WP_015344971.1|2841_3126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|3094_4108_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|4263_4737_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|4957_5224_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|5366_6131_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_024139167.1|6172_6385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|7638_9072_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
9789:9806	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
>prophage 2
NZ_CP009867	Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence	54000	16085	19683	54000	transposase	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000509966.1|16085_16691_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_040126169.1|16785_19683_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
>prophage 3
NZ_CP009867	Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence	54000	25786	26320	54000		Wolbachia_phage(100.0%)	1	NA	NA
WP_000792636.1|25786_26320_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
>prophage 4
NZ_CP009867	Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence	54000	30337	38191	54000	transposase	Staphylococcus_prophage(25.0%)	5	NA	NA
WP_004152397.1|30337_31657_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|31906_32788_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_001067855.1|33312_34017_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012561167.1|34589_34955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012561166.1|34954_38191_-	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
>prophage 5
NZ_CP009867	Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence	54000	49905	51599	54000		Morganella_phage(50.0%)	2	NA	NA
WP_000861760.1|49905_50346_+	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
WP_001749980.1|50333_51599_+	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
>prophage 1
NZ_CP009868	Pantoea sp. PSNIH2 plasmid pPSP-100, complete sequence	165878	30753	39489	165878	transposase	Acidithiobacillus_phage(33.33%)	13	NA	NA
WP_001207227.1|30753_31935_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_001151304.1|31938_32724_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_000338945.1|32897_33209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000058870.1|33190_33640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001050849.1|33653_34688_-	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.0e-05
WP_001274811.1|34932_36474_+|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
WP_000194038.1|36488_37244_+	ATPase AAA	NA	K4HZD4	Acidithiobacillus_phage	51.0	5.8e-59
WP_000098292.1|37303_37516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001258027.1|37508_37871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096362.1|37873_38116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337764.1|38115_38367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532167.1|38353_38551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268395.1|38550_39489_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
>prophage 2
NZ_CP009868	Pantoea sp. PSNIH2 plasmid pPSP-100, complete sequence	165878	95404	119714	165878	integrase,transposase	Escherichia_phage(33.33%)	29	101235:101251	119710:119726
WP_000543934.1|95404_96415_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|96417_96954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000932880.1|96946_97234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243801.1|97252_97573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|97795_98398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|98413_98866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243483.1|99032_99368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084845456.1|99398_99623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787563.1|99627_99900_-	MafI family immunity protein	NA	NA	NA	NA	NA
101235:101251	attL	AAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_001166628.1|101246_101702_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294656.1|101773_102139_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|102154_102430_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|102457_102883_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_015063453.1|102921_104616_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|104633_104996_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|104992_105229_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|105225_105933_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935451.1|105971_107687_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000344784.1|107689_108550_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001324342.1|110267_111791_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_001163403.1|111780_112563_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_000376623.1|112738_113239_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|113257_113437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000946487.1|113366_114218_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.1e-11
WP_004163135.1|114319_115279_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|115169_115874_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_103790973.1|115898_116144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001162012.1|116181_116739_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|116741_119714_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
119710:119726	attR	CTTAGCGTGCTTTATTT	NA	NA	NA	NA
>prophage 1
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	0	4262	378808		Salmonella_phage(100.0%)	2	NA	NA
WP_022652146.1|1165_2320_+	hypothetical protein	NA	A0A060D5B2	Salmonella_phage	27.8	6.9e-19
WP_015063091.1|2585_4262_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	31.0	3.4e-67
>prophage 2
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	11556	17354	378808	transposase	Wolbachia_phage(50.0%)	5	NA	NA
WP_004883035.1|11556_12624_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	32.9	3.7e-35
WP_052134032.1|12863_13790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113301.1|13932_14964_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_040113300.1|14969_15266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040126180.1|15554_17354_-	ATP-dependent helicase	NA	S5M596	Bacillus_phage	23.5	1.0e-29
>prophage 3
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	21942	30592	378808		Cronobacter_phage(25.0%)	10	NA	NA
WP_004883049.1|21942_22773_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	39.6	8.4e-43
WP_004883050.1|22853_24920_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.8	2.4e-22
WP_004883051.1|25730_26045_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_064717570.1|26347_26641_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_028699139.1|26960_27311_+	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	45.1	1.3e-18
WP_004883055.1|27654_28422_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_004883058.1|28534_28819_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004883059.1|28845_29688_+	RepA replication protein	NA	NA	NA	NA	NA
WP_071526700.1|29702_29957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883061.1|29953_30592_+	AAA family ATPase	NA	B0ZSI1	Halomonas_phage	40.1	1.1e-31
>prophage 4
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	57846	61317	378808		Escherichia_phage(50.0%)	4	NA	NA
WP_022652139.1|57846_58239_-	hypothetical protein	NA	Q71TH9	Escherichia_phage	62.6	1.0e-43
WP_022652138.1|58231_58504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072209339.1|59344_59848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063085.1|60435_61317_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.3	5.0e-54
>prophage 5
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	65805	67586	378808		Cronobacter_phage(33.33%)	4	NA	NA
WP_015063081.1|65805_66510_-	hypothetical protein	NA	M1EZB9	Cronobacter_phage	27.9	1.8e-17
WP_032610385.1|66588_66888_-	hypothetical protein	NA	A0A2P1JU39	Erwinia_phage	60.0	9.4e-05
WP_022652133.1|66923_67178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072209337.1|67229_67586_-	hypothetical protein	NA	A0A076YMQ7	Citrobacter_phage	42.3	2.4e-07
>prophage 6
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	71443	76013	378808		Caulobacter_phage(66.67%)	7	NA	NA
WP_015063076.1|71443_71740_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	36.2	8.4e-06
WP_022652127.1|71748_72930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063074.1|73320_73698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063073.1|73833_74268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077258061.1|74268_74589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652125.1|74704_75340_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	40.4	1.4e-26
WP_022652124.1|75401_76013_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	40.3	5.2e-26
>prophage 7
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	84023	164214	378808	transposase,integrase	Escherichia_phage(41.38%)	81	130938:130997	135141:135279
WP_007897923.1|84023_85271_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_040113334.1|85257_87024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040126182.1|87011_89129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384060.1|89132_89561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023314856.1|90886_91216_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023279877.1|91290_92415_-	alkene reductase	NA	NA	NA	NA	NA
WP_049866819.1|92633_93608_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017384065.1|93690_94566_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_023279882.1|94672_95524_+	DMT family transporter	NA	NA	NA	NA	NA
WP_023279881.1|95599_96436_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007897903.1|96730_97390_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032607902.1|98093_98327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022649401.1|98475_98802_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_022651297.1|99233_100367_+	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	28.8	9.7e-10
WP_012561117.1|101307_103959_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.1	5.4e-152
WP_032190484.1|105253_105625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189111.1|105933_107442_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_101743360.1|108144_109125_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_040113343.1|110424_111354_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	1.4e-75
WP_001118645.1|111557_112481_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_040113342.1|112687_113485_+	(S)-acetoin forming diacetyl reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.9	5.1e-13
WP_040113332.1|113746_114670_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
WP_023205627.1|114813_116205_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_040113331.1|117040_118063_-|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|118225_118930_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002210516.1|119641_120262_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_011117368.1|120254_121520_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	4.6e-234
WP_002210514.1|121531_122434_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
WP_002210513.1|122694_123456_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_011117369.1|123476_124337_-	class A extended-spectrum beta-lactamase SHV-5	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_001620096.1|124634_124895_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_001620097.1|124981_126070_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_001067855.1|127042_127747_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067858.1|128450_129155_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_074423300.1|129145_129577_+	recombinase family protein	NA	F1BUU6	Erwinia_phage	48.6	2.3e-20
WP_000845048.1|129923_130937_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
130938:130997	attL	GGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCG	NA	NA	NA	NA
WP_000777555.1|131093_131567_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_001206317.1|131659_132451_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001067855.1|133280_133985_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_124103214.1|133930_134161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845054.1|134126_135140_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_032488579.1|135300_135855_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
135141:135279	attR	GGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTA	NA	NA	NA	NA
WP_002089484.1|135930_136395_+	AAC(3)-I family aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001102919.1|136513_137026_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000995519.1|137041_137347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001206316.1|137438_138230_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|138393_138741_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|138734_139574_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|139978_141520_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012579084.1|141852_142509_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_000259031.1|142708_143548_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|143477_143657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|143675_144176_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001297012.1|144481_144595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|144682_145447_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_014839880.1|145488_145665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|145684_145897_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|145859_145979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|145962_146199_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|146195_146561_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|146578_148264_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|148302_148728_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|148755_149031_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|149046_149412_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|149483_149939_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_040115233.1|150514_150967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113341.1|151004_151670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062955.1|152170_152983_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_024191726.1|154259_154463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113328.1|154476_155796_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_079911680.1|155819_155990_-	hypothetical protein	NA	A0A1P7WFU2	Pectobacterium_phage	56.4	2.3e-08
WP_015062959.1|156115_157543_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	49.4	9.5e-103
WP_015062960.1|157765_158281_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.9	3.2e-08
WP_079911677.1|158277_159225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071685286.1|159246_159477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016246547.1|159540_159840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016246546.1|159860_160154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024146422.1|160520_161084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004862033.1|161140_161977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023205302.1|162017_162809_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_077258062.1|162867_164214_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	177368	186299	378808	protease	Caulobacter_phage(33.33%)	10	NA	NA
WP_015062975.1|177368_177944_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.6	5.6e-30
WP_000116680.1|178012_178591_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|178639_179680_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007448.1|179702_180158_-	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
WP_040113326.1|180180_181338_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_040113325.1|181337_181919_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	2.2e-13
WP_040113324.1|182241_183300_+	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
WP_001282603.1|183309_184452_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	1.5e-29
WP_001040062.1|184444_185218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040113323.1|185219_186299_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.7	2.5e-39
>prophage 9
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	218098	220010	378808		Salinibacter_virus(50.0%)	2	NA	NA
WP_040113315.1|218098_219280_+	S49 family peptidase	NA	A0A2I6UG67	Salinibacter_virus	29.5	7.8e-10
WP_072209335.1|219296_220010_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	37.7	3.4e-08
>prophage 10
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	224165	228009	378808		Yersinia_phage(25.0%)	5	NA	NA
WP_032610476.1|224165_225371_-	DNA-binding protein	NA	A0A2P9HXK7	Yersinia_phage	29.7	9.1e-14
WP_050596975.1|226545_226929_+	hypothetical protein	NA	A0A0K1YAK5	Cronobacter_phage	45.2	4.4e-07
WP_032610479.1|226939_227194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040113313.1|227193_227610_+	hypothetical protein	NA	A0A2D2W6B4	Pectobacterium_phage	41.8	2.2e-12
WP_032610524.1|227727_228009_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	37.8	3.2e-07
>prophage 11
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	231209	263546	378808	transposase	Escherichia_phage(30.0%)	40	NA	NA
WP_000323025.1|231209_231497_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|231496_231736_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_100280317.1|231760_231955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000167917.1|231998_232922_-	cation transporter	NA	NA	NA	NA	NA
WP_001515348.1|233121_233694_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_045409647.1|233797_234010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000830285.1|234200_235361_+|transposase	IS30-like element ISCfr4 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	4.6e-39
WP_000589001.1|235559_236900_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_040113311.1|238175_238457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652347.1|238764_239118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113310.1|239347_239554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652349.1|239588_239813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040115201.1|240258_240552_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	35.6	2.4e-05
WP_040113309.1|240635_241127_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_040126184.1|241131_241443_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_015063021.1|241642_242023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652354.1|242107_242356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652355.1|242389_242626_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	1.1e-05
WP_103178130.1|242670_243368_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	99.1	2.8e-132
WP_040113308.1|243558_244167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113339.1|244197_244722_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	62.7	2.1e-44
WP_040113307.1|244755_245064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113306.1|245060_245792_-	hypothetical protein	NA	Q71T76	Escherichia_phage	56.0	1.6e-66
WP_022652360.1|245897_246122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144380586.1|246179_246368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425611.1|246398_247430_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_071883756.1|247445_247829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652361.1|248010_249471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140246.1|249570_249900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032415320.1|250104_252876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087855188.1|252943_254094_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.5	5.4e-48
WP_023280967.1|254138_254627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384073.1|255485_255782_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023280966.1|256205_256862_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023280857.1|256924_257908_-	oxidoreductase	NA	NA	NA	NA	NA
WP_017384071.1|259119_259395_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_017384070.1|259429_260539_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.3	4.9e-30
WP_012561111.1|260582_260981_+	VOC family protein	NA	NA	NA	NA	NA
WP_012561110.1|261045_261882_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000227969.1|262469_263546_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	274778	288455	378808		Wolbachia_phage(33.33%)	15	NA	NA
WP_016487843.1|274778_275843_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	31.3	7.7e-33
WP_016487841.1|276194_276704_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	34.8	2.2e-17
WP_022652190.1|276770_279074_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003092327.1|279619_280447_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	39.6	1.6e-46
WP_006379606.1|280527_282597_+	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	26.3	1.3e-20
WP_016487839.1|282658_282868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071536583.1|283224_283620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001273857.1|283638_283953_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_006379425.1|284265_284559_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016487838.1|284846_285194_+	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	46.8	6.6e-18
WP_006379424.1|285536_286307_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_001247107.1|286418_286703_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022652188.1|286729_287575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071536585.1|287589_287820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003092312.1|287816_288455_+	AAA family ATPase	NA	A0A2H4JGZ2	uncultured_Caudovirales_phage	40.0	3.5e-33
>prophage 13
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	294090	294879	378808		Pithovirus(100.0%)	1	NA	NA
WP_028689679.1|294090_294879_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	29.4	1.2e-09
>prophage 14
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	328488	329721	378808		Pseudomonas_phage(100.0%)	1	NA	NA
WP_032610499.1|328488_329721_-	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.3	4.6e-13
>prophage 15
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	337568	339377	378808		Bacillus_phage(100.0%)	1	NA	NA
WP_015063127.1|337568_339377_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	25.9	9.7e-20
>prophage 16
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	354265	355300	378808		Enterobacteria_phage(100.0%)	1	NA	NA
WP_015063116.1|354265_355300_-	ParM	NA	A0A0A7NPX4	Enterobacteria_phage	34.7	6.7e-42
>prophage 17
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	358547	359552	378808		Aeromonas_phage(100.0%)	1	NA	NA
WP_022652164.1|358547_359552_-	hypothetical protein	NA	A0A1I9KFW9	Aeromonas_phage	31.1	1.6e-11
>prophage 18
NZ_CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	378808	374261	376752	378808		Salmonella_phage(100.0%)	2	NA	NA
WP_015063098.1|374261_375137_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.8	1.0e-59
WP_022652149.1|375678_376752_+	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	34.1	2.9e-11
>prophage 1
NZ_CP009870	Pantoea sp. PSNIH2 plasmid pPSP-b98, complete sequence	23255	0	9896	23255	transposase	uncultured_archaeal_virus(50.0%)	6	NA	NA
WP_071882941.1|2649_3081_+	GtrA family protein	NA	NA	NA	NA	NA
WP_040126191.1|3994_4579_-	mobilization protein MobX	NA	NA	NA	NA	NA
WP_040113349.1|4591_5689_-	mobilization protein MobA	NA	NA	NA	NA	NA
WP_040126192.1|5853_6294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000509966.1|6298_6904_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_040126169.1|6998_9896_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
>prophage 2
NZ_CP009870	Pantoea sp. PSNIH2 plasmid pPSP-b98, complete sequence	23255	16113	18478	23255	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_001067855.1|16113_16818_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000609174.1|17750_18098_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|18094_18478_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
