The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_HG813240	Mycobacterium tuberculosis 49-02	4412379	2936618	2974891	4412379	head,integrase,capsid,terminase,tRNA,protease	Mycobacterium_phage(30.0%)	47	2965419:2965446	2975044:2975071
WP_003413486.1|2936618_2938697_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2938805_2939033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009940032.1|2939029_2940415_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2940759_2941260_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2941276_2941717_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2941863_2942541_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2942525_2942879_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2942891_2943317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2943313_2943988_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2944065_2944887_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2945022_2945916_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2945918_2946737_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2946751_2947933_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2947991_2948423_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2948936_2950178_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2950487_2950850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2951196_2952321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2952322_2952862_+	archease	NA	NA	NA	NA	NA
WP_003413616.1|2953001_2954300_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2954338_2954620_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2954764_2955250_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2955276_2955531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025096392.1|2955534_2957871_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2957899_2958142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2958142_2958820_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2959015_2959672_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2959834_2960281_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2960455_2960788_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2960907_2961267_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2961368_2961827_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2961962_2962343_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2962339_2963836_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2964070_2964262_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2965419:2965446	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2965552_2965984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2965980_2966979_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2966992_2967457_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2967444_2967696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2967866_2969306_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2969313_2969847_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2969999_2970626_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2970658_2970982_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2971061_2971307_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2971303_2972731_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2972732_2973125_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2973121_2973382_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2973398_2973761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2973763_2974891_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2975044:2975071	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 2
NZ_HG813240	Mycobacterium tuberculosis 49-02	4412379	3705661	3752435	4412379	protease,tRNA,transposase	Burkholderia_virus(25.0%)	23	NA	NA
WP_087902221.1|3705661_3706923_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009937401.1|3707216_3707378_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003902445.1|3707399_3708929_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003417413.1|3708861_3709800_-	sigma-70 family RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
WP_003902446.1|3709808_3711176_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
WP_003417415.1|3711244_3712462_+	D-alanyl-D-alanine carboxypeptidase DacB1	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_078802176.1|3712557_3714066_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417418.1|3714062_3715214_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417421.1|3715404_3716250_-|protease	PDZ-interacting protease regulator Ppr1	protease	NA	NA	NA	NA
WP_003900026.1|3716724_3717165_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417435.1|3717198_3718068_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003417440.1|3718088_3719099_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003905041.1|3719371_3720016_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003417452.1|3720082_3721312_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003900028.1|3721594_3722944_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417458.1|3722955_3724095_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003417461.1|3724091_3724823_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_038438875.1|3724831_3734173_-	PPE family protein	NA	NA	NA	NA	NA
WP_049960778.1|3734221_3735211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417619.1|3740599_3740857_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003901612.1|3741112_3750586_-	PPE family protein	NA	NA	NA	NA	NA
WP_049961743.1|3751211_3751658_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003911006.1|3751694_3752435_-|transposase	transposase	transposase	NA	NA	NA	NA
