The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006903	Clostridium botulinum 202F chromosome, complete genome	3874462	335987	408856	3874462	tail,transposase,integrase,tRNA	Bacillus_phage(41.67%)	56	389522:389540	416659:416677
WP_100433884.1|335987_337406_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_035787415.1|337408_338005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035787414.1|338023_338548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035787412.1|338563_338956_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_139015964.1|338990_341840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003371723.1|341849_343286_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_035787410.1|343454_344417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035791462.1|344826_346524_+	Hsp70 family protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	37.8	5.8e-83
WP_035791464.1|346533_349818_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_035791465.1|349996_350893_+	NUDIX domain-containing protein	NA	A0A1B0V161	Roseobacter_phage	36.1	2.7e-07
WP_035791466.1|351064_351868_+	ribose-phosphate pyrophosphokinase	NA	A0A218KC69	Bacillus_phage	42.1	1.1e-47
WP_039310021.1|351954_353424_+	nicotinate phosphoribosyltransferase	NA	A0A218KC49	Bacillus_phage	54.0	7.6e-140
WP_035791468.1|353602_354439_-	viral A-type inclusion protein	NA	NA	NA	NA	NA
WP_035791470.1|354610_356437_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_035791471.1|356423_358145_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_035791475.1|358304_359705_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_035787398.1|360014_362318_+	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
WP_035787397.1|362585_363095_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_035787396.1|363178_364534_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_035787395.1|364735_365047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035782790.1|365347_365992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035782794.1|366423_366963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017353194.1|366949_367348_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035782797.1|367331_368228_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	5.7e-21
WP_039307605.1|368208_369258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035791479.1|369543_369843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035782802.1|370201_370912_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_012424009.1|371085_371991_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039307609.1|372120_373419_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	37.1	3.2e-65
WP_012425770.1|373437_373716_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_035791485.1|374024_374717_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.9	1.0e-38
WP_039307616.1|374694_376935_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.1	5.2e-15
WP_035791488.1|377259_378225_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012424825.1|378465_378696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035782815.1|378960_379482_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_012424033.1|379682_379874_+	YwbE family protein	NA	NA	NA	NA	NA
WP_154563536.1|380724_380862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039307627.1|381046_382381_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_144313589.1|382393_384802_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_039307634.1|384791_386846_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_039307637.1|386827_387337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039310023.1|387371_389573_+	DNA topoisomerase III	NA	A0A0G2Y787	Acanthamoeba_polyphaga_mimivirus	25.1	5.3e-28
389522:389540	attL	TGATAATCCATTTGCTGCA	NA	NA	NA	NA
WP_080315384.1|389623_389836_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039307640.1|389993_390299_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_039307643.1|390556_390799_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_039307645.1|390845_391025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039307649.1|391520_391784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039307652.1|392220_392424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158380742.1|392452_392626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039307656.1|393802_395305_-	TULIP family P47-like protein	NA	NA	NA	NA	NA
WP_039307660.1|395759_398024_-	TULIP family P47-like protein	NA	NA	NA	NA	NA
WP_173405946.1|398037_398466_-	toxin	NA	NA	NA	NA	NA
WP_039307662.1|398759_400010_+	neurotoxin-associated TULIP family protein P47	NA	NA	NA	NA	NA
WP_039307664.1|400024_403522_+	non-toxic nonhemagglutinin NTNH	NA	Q332E1	Clostridium_botulinum_C_phage	57.8	0.0e+00
WP_039307669.1|403533_407361_+	botulinum neurotoxin type F	NA	Q332E0	Clostridium_botulinum_C_phage	33.3	2.0e-176
WP_039307672.1|408289_408856_+|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	45.1	6.7e-36
416659:416677	attR	TGATAATCCATTTGCTGCA	NA	NA	NA	NA
>prophage 2
NZ_CP006903	Clostridium botulinum 202F chromosome, complete genome	3874462	524143	602961	3874462	plate,tRNA,portal,tail,terminase,holin,head,protease	Faecalibacterium_phage(29.41%)	91	NA	NA
WP_035793475.1|524143_524656_+|holin	choline-binding protein	holin	NA	NA	NA	NA
WP_035782978.1|525006_525327_+	hypothetical protein	NA	A0A1V0SKV2	Klosneuvirus	50.6	3.3e-16
WP_154563533.1|525704_525881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035782979.1|526154_527297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039307802.1|527773_529420_+	family 14 glycosylhydrolase	NA	NA	NA	NA	NA
WP_035793484.1|529489_530146_-	DUF5105 domain-containing protein	NA	NA	NA	NA	NA
WP_035793488.1|530571_531213_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_035782988.1|531280_531667_-	colossin A	NA	NA	NA	NA	NA
WP_035782989.1|531838_532612_+	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_012423174.1|532698_533190_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_035782995.1|533419_534025_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_012424964.1|534332_534536_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_035793491.1|534992_536891_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_035782999.1|537300_538356_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_035793494.1|538517_539714_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_035793499.1|541415_542618_+	putative hydroxymethylpyrimidine transporter CytX	NA	NA	NA	NA	NA
WP_080288109.1|542789_543437_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_035783008.1|543531_543759_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_039307808.1|543901_545122_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_035793504.1|545218_545872_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_035793506.1|545900_547808_+	bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_035783018.1|547954_548812_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035783020.1|548856_549135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052134051.1|549707_551369_-	recombinase family protein	NA	A0A0A7RUB1	Clostridium_phage	60.3	3.9e-193
WP_052134052.1|551447_551954_-	helix-turn-helix transcriptional regulator	NA	Q0SPH9	Clostridium_phage	56.7	7.9e-12
WP_154563530.1|552197_552353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039307815.1|552434_552800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154563527.1|552917_553064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039307818.1|553086_553305_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	69.6	1.1e-15
WP_039307821.1|553737_554589_+	hypothetical protein	NA	Q0SPI6	Clostridium_phage	45.1	2.4e-45
WP_039307824.1|554594_554774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039307826.1|554818_555583_+	ParA family protein	NA	H7BUL8	unidentified_phage	38.9	6.3e-45
WP_039307828.1|555844_556087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039307831.1|556128_557094_+	ParB/RepB/Spo0J family partition protein	NA	H7BVD1	unidentified_phage	35.8	1.9e-30
WP_039307834.1|557219_557342_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_039307838.1|557367_557571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039307842.1|557710_558382_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_039307845.1|558918_559473_+	hypothetical protein	NA	A0A2H4J015	uncultured_Caudovirales_phage	31.9	3.5e-05
WP_035791616.1|559677_559884_+	hypothetical protein	NA	A0A1L2BY88	Clostridium_phage	44.1	6.3e-08
WP_039307850.1|560076_560592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039307854.1|560611_562456_+|terminase	phage terminase large subunit family protein	terminase	A0A2K9V301	Faecalibacterium_phage	59.4	6.7e-202
WP_039307857.1|562471_562696_+	hypothetical protein	NA	A0A2K9V311	Faecalibacterium_phage	62.0	1.7e-14
WP_039307860.1|562705_564190_+|portal	phage portal protein	portal	A0A2K9V303	Faecalibacterium_phage	65.0	2.0e-188
WP_052134053.1|564167_564815_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2K9V308	Faecalibacterium_phage	65.0	2.8e-62
WP_039307863.1|564816_566316_+	hypothetical protein	NA	A0A2K9V304	Faecalibacterium_phage	56.6	4.7e-161
WP_039307866.1|566328_566661_+	DUF2190 family protein	NA	A0A2K9V343	Faecalibacterium_phage	45.0	4.8e-18
WP_052134054.1|566669_566969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039310049.1|566974_567289_+	hypothetical protein	NA	A0A2K9V315	Faecalibacterium_phage	29.6	1.6e-07
WP_039307869.1|567288_567858_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_039307871.1|567870_568416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039307873.1|568428_569859_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2K9V2R6	Faecalibacterium_phage	35.0	1.6e-73
WP_039307875.1|569865_570396_+|tail	phage major tail tube protein	tail	A0A0C5AJ56	Bacteriophage	35.8	1.8e-19
WP_039307877.1|570458_570800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039307879.1|570963_573171_+	TMP repeat family protein	NA	A0A1U9WQS5	Geobacillus_phage	40.6	9.0e-44
WP_039307880.1|573163_573376_+|tail	tail protein X	tail	A0A2K9V2S8	Faecalibacterium_phage	44.6	2.0e-09
WP_039307882.1|573363_574293_+	hypothetical protein	NA	A0A2K9V2R4	Faecalibacterium_phage	32.9	4.7e-34
WP_039307885.1|574292_574529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039307887.1|574536_575091_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_039307889.1|575093_575411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039307891.1|575400_576555_+|plate	baseplate J/gp47 family protein	plate	A0A059WFM2	Vibrio_phage	33.5	1.7e-54
WP_052134055.1|576554_577214_+|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	33.9	1.3e-25
WP_039307894.1|577213_577867_+|tail	phage tail protein	tail	A0A2H4J039	uncultured_Caudovirales_phage	50.0	7.7e-52
WP_100433871.1|577878_578250_+	collagen-like protein	NA	NA	NA	NA	NA
WP_052134057.1|578263_579073_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_039307897.1|579091_579397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080288065.1|579400_579553_+	XkdX family protein	NA	NA	NA	NA	NA
WP_080315410.1|580075_581380_+	Vps62-related protein	NA	A0A1L2BYA9	Clostridium_phage	57.3	5.7e-54
WP_039307903.1|581425_582598_+	Ig-like domain-containing protein	NA	A0A1L2BYA9	Clostridium_phage	51.7	4.0e-51
WP_039307906.1|582881_583106_+	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_039307909.1|583107_583398_+|holin	phage holin family protein	holin	A0A0A8WF70	Clostridium_phage	46.2	1.4e-13
WP_144313592.1|583461_585336_+	glycoside hydrolase family protein	NA	A0A142EZW8	Stenotrophomonas_phage	34.2	5.9e-12
WP_039307912.1|585634_586693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100433874.1|587186_587588_+	DUF3862 domain-containing protein	NA	A0A1L2BYB5	Clostridium_phage	68.4	3.9e-46
WP_039307915.1|587685_588522_+	hypothetical protein	NA	A6M984	Geobacillus_virus	34.3	1.5e-28
WP_039307918.1|588720_588933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039307921.1|589101_589779_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	37.0	1.1e-05
WP_039307924.1|589804_590032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052134059.1|590211_591771_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_039307928.1|591745_592696_+	plasmid recombination protein	NA	M1NXP9	Cellulophaga_phage	26.8	3.0e-12
WP_158380744.1|592716_593232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158380745.1|593215_593383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039307934.1|593735_595100_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_035783024.1|595458_595938_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_035787337.1|596633_597623_+	tyrosine recombinase XerC	NA	A0A2R2ZHE2	Clostridioides_phage	29.8	7.4e-22
WP_035787247.1|597738_598272_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_035787245.1|598444_598936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012424814.1|599005_599437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035787244.1|599600_600206_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	54.7	3.8e-13
WP_035787243.1|600383_601673_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_035787242.1|601748_601982_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_035787241.1|602031_602961_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP006903	Clostridium botulinum 202F chromosome, complete genome	3874462	785608	836059	3874462	plate,tail,portal,holin,head,integrase	Clostridium_phage(48.57%)	88	808261:808277	827905:827921
WP_039308130.1|785608_786481_-	ParM/StbA family protein	NA	Q0SPH6	Clostridium_phage	29.1	8.0e-20
WP_039308134.1|786613_786817_-	helix-turn-helix domain-containing protein	NA	A0A2H4J765	uncultured_Caudovirales_phage	68.7	5.6e-17
WP_154563481.1|786819_786972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308137.1|787096_787342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039308140.1|787360_787765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039308143.1|787811_788156_-	recombinase family protein	NA	NA	NA	NA	NA
WP_052134061.1|788311_788521_-	hypothetical protein	NA	A0A0K2SU85	Clostridium_phage	41.9	2.2e-08
WP_039308146.1|788775_789843_-	hypothetical protein	NA	M9Q255	Clostridium_phage	53.4	1.6e-99
WP_039308149.1|789808_791047_-	hypothetical protein	NA	M9Q2I6	Clostridium_phage	40.3	1.6e-85
WP_039308152.1|791425_792217_-	glycoside hydrolase family protein	NA	B5WZU3	Pseudomonas_phage	38.5	1.6e-14
WP_035786889.1|792273_792534_-|holin	phage holin family protein	holin	A0A0A8WF70	Clostridium_phage	47.0	4.8e-13
WP_039308156.1|792535_792760_-	hemolysin XhlA	NA	NA	NA	NA	NA
WP_035786883.1|793022_793202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308159.1|793220_793487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308161.1|794649_795261_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	41.7	2.3e-42
WP_039308164.1|795250_796330_-|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	39.7	2.5e-55
WP_039308167.1|796336_796765_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_039308170.1|796779_797112_-	DUF2577 family protein	NA	NA	NA	NA	NA
WP_052134062.1|797123_799118_-	C40 family peptidase	NA	X5JAJ3	Clostridium_phage	28.3	3.8e-09
WP_052134063.1|799131_799758_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_052134064.1|799769_801608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017352107.1|801608_801764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052134065.1|801787_802171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017352105.1|802224_802650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308175.1|802665_803736_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	NA	NA	NA	NA
WP_039308178.1|803732_804200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052134066.1|804189_804597_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_039308182.1|804583_804940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052134067.1|804951_805281_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_039308185.1|805270_805510_-	Rho termination factor N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_039308188.1|805556_806507_-	hypothetical protein	NA	A0A1V0DZW0	Clostridioides_phage	56.1	4.2e-91
WP_039308191.1|806542_807130_-	DUF4355 domain-containing protein	NA	A0A1V0DZW6	Clostridioides_phage	37.9	2.3e-26
WP_039308193.1|807245_807692_-	hypothetical protein	NA	M9Q2I2	Clostridium_phage	57.3	5.5e-41
WP_039308195.1|807691_808078_-	hypothetical protein	NA	A0A2H4J4N9	uncultured_Caudovirales_phage	66.4	2.4e-37
WP_173405948.1|808222_808363_-	hypothetical protein	NA	A0A0A7RTU6	Clostridium_phage	57.1	1.8e-06
808261:808277	attL	TTCTTTTTGAAAAACAT	NA	NA	NA	NA
WP_173405949.1|808414_808588_-	hypothetical protein	NA	A0A0A8WI08	Clostridium_phage	55.6	2.3e-11
WP_039308197.1|808608_808953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308200.1|809092_809848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039308203.1|809821_810016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308206.1|810062_810965_-	alpha-dextrin endo-1, 6-alpha-glucosidase	NA	H7BWE7	unidentified_phage	26.7	2.7e-10
WP_039308210.1|810957_812286_-|portal	phage portal protein	portal	A0A1V0DZW8	Clostridioides_phage	41.9	1.5e-78
WP_039308213.1|812300_814067_-	hypothetical protein	NA	A0A1V0DZW7	Clostridioides_phage	36.7	2.3e-106
WP_039308216.1|814126_814792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308219.1|814882_815143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308222.1|815212_815431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308224.1|815475_816138_-	recombinase family protein	NA	NA	NA	NA	NA
WP_039308228.1|816382_816808_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039308231.1|817078_817759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173405950.1|817762_817933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308234.1|817988_818678_-	Rha family transcriptional regulator	NA	A0A0A7RVU3	Clostridium_phage	45.1	3.0e-38
WP_039308237.1|819168_819384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308239.1|819415_819601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308242.1|819714_820239_-	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	24.2	3.3e-05
WP_173405951.1|820263_820413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308245.1|820416_820833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308248.1|820836_821157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308251.1|821157_821409_-	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	49.3	1.1e-11
WP_039308255.1|821496_821691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308258.1|821702_822116_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	49.3	9.9e-29
WP_039308260.1|822136_822532_-	RusA family crossover junction endodeoxyribonuclease	NA	X2CXX1	Lactobacillus_phage	35.5	2.5e-13
WP_039308262.1|822553_823594_-	nucleoid-associated protein	NA	Q24LD5	Clostridium_phage	31.4	3.5e-06
WP_039308265.1|823613_824621_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	27.3	3.2e-12
WP_039308268.1|824715_825012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308272.1|825050_825272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154563450.1|825316_825484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154563447.1|825501_825654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154563444.1|825720_825885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154563441.1|825907_826078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308275.1|826087_826429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052134102.1|826421_826988_-	hypothetical protein	NA	A0A2H4J8I2	uncultured_Caudovirales_phage	39.6	5.0e-31
WP_154563438.1|827036_827189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308281.1|827182_827506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308283.1|827524_827710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308286.1|827732_827921_-	hypothetical protein	NA	NA	NA	NA	NA
827905:827921	attR	TTCTTTTTGAAAAACAT	NA	NA	NA	NA
WP_039308288.1|827950_828286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154563435.1|828453_828603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052134068.1|828603_829347_-	hypothetical protein	NA	A0A0B5D175	Listeria_phage	60.6	5.9e-40
WP_052134069.1|829355_829934_-	ERF family protein	NA	Q9B0G3	Staphylococcus_virus	48.3	9.0e-36
WP_039308291.1|829946_830459_-	host-nuclease inhibitor Gam family protein	NA	A0A0A7S0G6	Clostridium_phage	47.1	1.4e-37
WP_039308293.1|830471_830885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154563432.1|831343_831496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308295.1|831596_831848_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	53.7	3.2e-14
WP_039308298.1|831926_832196_+	hypothetical protein	NA	A0A1W6JPU7	Staphylococcus_phage	43.2	3.9e-10
WP_035791181.1|832192_832609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308302.1|832640_833327_-	phage antirepressor KilAC domain-containing protein	NA	A0A2D1GQ65	Lysinibacillus_phage	51.1	7.4e-53
WP_039308305.1|833739_833970_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039308308.1|834233_834593_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	32.0	9.3e-07
WP_039308312.1|834592_836059_+	recombinase family protein	NA	A0A1L2BY67	Clostridium_phage	41.0	3.0e-80
>prophage 4
NZ_CP006903	Clostridium botulinum 202F chromosome, complete genome	3874462	849281	896346	3874462	capsid,coat,plate,tail,portal,terminase,holin,integrase	uncultured_Caudovirales_phage(41.03%)	68	866672:866688	905592:905608
WP_035786891.1|849281_850067_-	glycoside hydrolase family protein	NA	A0A0S2SYD0	Pseudomonas_phage	38.6	8.2e-16
WP_035786889.1|850122_850383_-|holin	phage holin family protein	holin	A0A0A8WF70	Clostridium_phage	47.0	4.8e-13
WP_035786887.1|850384_850609_-	hemolysin XhlA	NA	NA	NA	NA	NA
WP_035786884.1|850689_851925_-	Ig-like domain-containing protein	NA	A0A1L2BYA9	Clostridium_phage	53.3	1.1e-49
WP_035786883.1|852349_852529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035791879.1|852530_852815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308325.1|852828_853092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052134071.1|853066_853975_-|tail	phage tail protein	tail	A0A2H4J039	uncultured_Caudovirales_phage	58.7	7.2e-48
WP_051982703.1|853980_854631_-	YmfQ family protein	NA	A0A2H4J1P4	uncultured_Caudovirales_phage	47.4	5.9e-52
WP_035791880.1|854617_855739_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J7K8	uncultured_Caudovirales_phage	53.7	5.0e-107
WP_039308326.1|855747_856185_-	DUF2634 domain-containing protein	NA	A0A2H4J4Q8	uncultured_Caudovirales_phage	49.0	7.3e-30
WP_035786880.1|856177_856519_-	hypothetical protein	NA	A0A2H4J746	uncultured_Caudovirales_phage	51.0	3.1e-20
WP_035786878.1|856508_857528_-	hypothetical protein	NA	A0A2H4J063	uncultured_Caudovirales_phage	49.3	1.3e-82
WP_035786877.1|857535_858225_-	SH3 domain-containing protein	NA	A0A2H4J045	uncultured_Caudovirales_phage	41.7	1.8e-46
WP_035786876.1|858352_858943_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_035786874.1|858983_862043_-|tail	phage tail tape measure protein	tail	A0A2H4J055	uncultured_Caudovirales_phage	39.3	2.0e-89
WP_012423050.1|862252_862696_-	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	47.1	5.5e-25
WP_012422818.1|862751_863174_-|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	50.4	6.1e-34
WP_035786872.1|863189_864605_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4J1N7	uncultured_Caudovirales_phage	49.0	2.4e-122
WP_173405976.1|864605_864812_-	hypothetical protein	NA	B6SBT6	Clostridium_virus	46.0	6.9e-07
WP_039308332.1|864811_865639_-	hypothetical protein	NA	A0A2H4J4Q0	uncultured_Caudovirales_phage	55.8	2.3e-85
WP_035786869.1|865641_866067_-	hypothetical protein	NA	A0A0N7ACC6	Bacillus_phage	38.0	5.3e-17
WP_035786866.1|866464_866785_-	hypothetical protein	NA	A0A2H4J040	uncultured_Caudovirales_phage	54.5	2.3e-25
866672:866688	attL	AAGAATATTATTATCAT	NA	NA	NA	NA
WP_012424276.1|866787_866982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035786864.1|867040_868078_-|capsid	major capsid protein	capsid	A0A0A7RU11	Clostridium_phage	61.6	2.8e-120
WP_012425779.1|868091_868430_-	hypothetical protein	NA	A0A0A7RU46	Clostridium_phage	46.4	5.4e-17
WP_035786861.1|868443_869076_-	phage scaffolding protein	NA	A0A0K2CP96	Brevibacillus_phage	33.3	3.6e-14
WP_035786860.1|869211_869658_-	hypothetical protein	NA	M9Q2I2	Clostridium_phage	58.0	9.3e-41
WP_035786857.1|869730_870072_-	hypothetical protein	NA	A0A0A8WIH8	Clostridium_phage	48.6	1.0e-18
WP_035786855.1|870050_870371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052134072.1|870480_871152_-	hypothetical protein	NA	A0A0A7RVU3	Clostridium_phage	34.8	4.9e-25
WP_035786853.1|871373_872384_-	hypothetical protein	NA	A0A2H4J048	uncultured_Caudovirales_phage	40.5	5.7e-62
WP_035786852.1|872396_873908_-|portal	phage portal protein	portal	D9ZNC8	Clostridium_phage	53.1	3.9e-139
WP_039308340.1|873907_875221_-|terminase	PBSX family phage terminase large subunit	terminase	E5DV50	Deep-sea_thermophilic_phage	48.2	6.0e-104
WP_035786849.1|875210_876125_-|terminase	terminase small subunit	terminase	Q5YA77	Bacillus_phage	47.4	2.6e-45
WP_012423560.1|876162_876312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173405952.1|876317_876485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035786848.1|876552_877350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035786847.1|877633_878356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035786845.1|878442_878964_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_035786843.1|878981_879623_-	hypothetical protein	NA	A0A2K9VNW2	Shigella_phage	29.6	5.2e-08
WP_035786842.1|879622_879931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308344.1|880004_880505_-	Holliday junction resolvase RecU	NA	D9ZNH9	Clostridium_phage	34.6	1.5e-18
WP_173405953.1|880498_880648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035786839.1|880659_881424_-	ORF6C domain-containing protein	NA	A0A0A8WFN9	Clostridium_phage	53.7	1.1e-70
WP_035786835.1|882728_883136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035786834.1|883272_883521_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_035786833.1|883533_883719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035786832.1|883834_884506_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_035786829.1|884630_884834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035786828.1|884860_885115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035786827.1|885114_885354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035786826.1|885381_885813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100433869.1|885858_886020_-	mszf55-1	NA	NA	NA	NA	NA
WP_035786825.1|886056_886479_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	61.2	1.1e-27
WP_035787300.1|886471_886765_-	hypothetical protein	NA	Q0SPI4	Clostridium_phage	37.2	6.2e-09
WP_051982706.1|886863_887487_-	HNH endonuclease	NA	A0A2H4JEM6	uncultured_Caudovirales_phage	33.0	1.1e-23
WP_035786824.1|887490_887724_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	60.0	1.2e-15
WP_039310103.1|887736_888507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035792022.1|888499_888814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035786822.1|888785_889091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308353.1|890013_890724_-	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	45.6	9.9e-53
WP_035786819.1|890723_891467_-	hypothetical protein	NA	A0A2I7RZ22	Vibrio_phage	42.4	4.8e-42
WP_173405954.1|893710_893872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035786814.1|894030_894315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079991398.1|894348_894522_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035786812.1|894778_895135_+	helix-turn-helix transcriptional regulator	NA	I3VYY8	Thermoanaerobacterium_phage	30.5	9.2e-07
WP_035792024.1|895269_896346_+|integrase	site-specific integrase	integrase	Q24LF5	Clostridium_phage	25.6	5.4e-10
905592:905608	attR	ATGATAATAATATTCTT	NA	NA	NA	NA
>prophage 5
NZ_CP006903	Clostridium botulinum 202F chromosome, complete genome	3874462	1082819	1095725	3874462	tail,terminase,portal	Clostridium_phage(41.67%)	19	NA	NA
WP_039308529.1|1082819_1083899_-|tail	phage tail sheath protein	tail	A0A0A7S0D2	Clostridium_phage	31.2	2.3e-29
WP_039308532.1|1083955_1084399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308535.1|1084395_1084812_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_039308537.1|1084804_1085152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308540.1|1085154_1085439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100433904.1|1085450_1085690_-	Rho termination factor N-terminal domain-containing protein	NA	A0A090D801	Clostridium_phage	40.5	4.4e-05
WP_039308547.1|1085718_1086630_-	hypothetical protein	NA	A0A1V0DZW0	Clostridioides_phage	58.2	1.0e-97
WP_052134077.1|1086664_1087255_-	DUF4355 domain-containing protein	NA	A0A1V0DZW6	Clostridioides_phage	29.2	2.5e-17
WP_039308550.1|1087465_1087831_-	hypothetical protein	NA	A0A2H4J4N9	uncultured_Caudovirales_phage	62.8	2.6e-33
WP_173405959.1|1087974_1088115_-	hypothetical protein	NA	A0A0A7RTU6	Clostridium_phage	54.3	4.0e-06
WP_039308553.1|1088136_1088481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308556.1|1088524_1089424_-	alpha-dextrin endo-1, 6-alpha-glucosidase	NA	G8FUZ0	Pediococcus_virus	26.8	1.2e-07
WP_039308559.1|1089416_1090781_-|portal	phage portal protein	portal	A0A1V0DZW8	Clostridioides_phage	35.9	1.8e-58
WP_039308562.1|1090795_1092565_-|terminase	terminase	terminase	A0A1V0DZW7	Clostridioides_phage	36.1	1.7e-101
WP_052134078.1|1092596_1093157_-	HNH endonuclease	NA	X2KXT0	Enterococcus_phage	45.2	1.6e-18
WP_039308565.1|1093629_1094055_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039308567.1|1094421_1094862_-	xanthine dehydrogenase	NA	A0A090EUN5	Clostridium_phage	36.7	1.5e-11
WP_173405960.1|1094851_1095022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308569.1|1095443_1095725_-	DUF1599 domain-containing protein	NA	D9ZNJ8	Clostridium_phage	56.2	1.6e-17
>prophage 6
NZ_CP006903	Clostridium botulinum 202F chromosome, complete genome	3874462	1208652	1269642	3874462	capsid,tail,portal,terminase,holin,head,integrase,protease	Clostridium_phage(45.45%)	68	1265923:1265939	1274130:1274146
WP_035786546.1|1208652_1208904_-|holin	phage holin family protein	holin	A0A0A7RW97	Clostridium_phage	52.6	1.7e-15
WP_173405962.1|1209122_1209290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035792256.1|1209623_1210631_-|protease	serine protease	protease	NA	NA	NA	NA
WP_039308717.1|1211015_1214531_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_035786543.1|1214901_1216032_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.2	2.2e-46
WP_035792264.1|1216082_1217339_-	GntP family permease	NA	NA	NA	NA	NA
WP_035786541.1|1217504_1218569_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035786539.1|1218925_1219516_-	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_003372027.1|1219900_1220056_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_035786537.1|1220427_1221705_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_035786536.1|1221701_1222691_-	sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein	NA	NA	NA	NA	NA
WP_035792266.1|1223017_1223791_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_035786532.1|1224044_1224914_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_035786530.1|1225104_1225671_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_035786528.1|1225660_1226143_+	GerW family sporulation protein	NA	NA	NA	NA	NA
WP_035786526.1|1226325_1226919_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.0	4.6e-19
WP_035786524.1|1226902_1227658_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.4	3.3e-06
WP_035786522.1|1227899_1229090_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.6	8.9e-30
WP_039308722.1|1229816_1230575_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1L2BYB1	Clostridium_phage	71.9	6.6e-103
WP_039308726.1|1230637_1230814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308730.1|1230826_1231027_-	UviB-like protein	NA	A0A2H4JAI7	uncultured_Caudovirales_phage	66.2	9.3e-17
WP_039308733.1|1231100_1232108_-	Ig-like domain-containing protein	NA	A0A2H4J270	uncultured_Caudovirales_phage	33.2	9.6e-17
WP_039308736.1|1232151_1233339_-	Ig-like domain-containing protein	NA	A0A1L2BYA9	Clostridium_phage	54.8	1.5e-53
WP_039308739.1|1233633_1234338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308745.1|1234594_1234786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308748.1|1234786_1235131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308751.1|1236617_1238348_-|tail	phage tail protein	tail	A0A1L2BYA1	Clostridium_phage	31.2	1.2e-51
WP_012449476.1|1238344_1239019_-|tail	phage tail family protein	tail	Q938K2	Temperate_phage	29.7	1.4e-08
WP_039308755.1|1239034_1242499_-|tail	phage tail tape measure protein	tail	B6CXF2	Clostridium_phage	38.8	1.8e-75
WP_012423664.1|1242549_1242813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308760.1|1242815_1243139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308764.1|1243141_1243723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308767.1|1243725_1244046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308770.1|1244038_1244428_-	hypothetical protein	NA	A0A1S5SFC4	Streptococcus_phage	39.8	2.1e-12
WP_039308773.1|1244427_1244763_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_012449861.1|1244737_1245067_-	hypothetical protein	NA	Q8W603	Listeria_phage	42.9	1.4e-12
WP_012450618.1|1245081_1246278_-|capsid	phage major capsid protein	capsid	E2ELI5	Clostridium_phage	38.8	7.5e-69
WP_039308779.1|1246277_1247069_-|protease	Clp protease ClpP	protease	A0A0K2CXQ5	Paenibacillus_phage	44.8	1.6e-38
WP_039308782.1|1247070_1248219_-|portal	phage portal protein	portal	E2ELI3	Clostridium_phage	41.3	3.2e-69
WP_039308784.1|1248267_1249911_-|terminase	terminase large subunit	terminase	E2ELI2	Clostridium_phage	43.0	1.3e-127
WP_039308786.1|1249900_1250401_-	DNA-directed RNA polymerase sigma-70 factor	NA	E2ELI1	Clostridium_phage	44.5	1.3e-35
WP_039308788.1|1250557_1250884_-	HNH endonuclease	NA	A0A1S7FZ53	Listeria_phage	47.2	3.3e-19
WP_017353006.1|1250871_1251189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308792.1|1251392_1251935_-|integrase	site-specific integrase	integrase	E2ELN7	Clostridium_phage	48.9	2.4e-46
WP_017353008.1|1251931_1252168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173405963.1|1252422_1252572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308795.1|1252810_1254004_-	amidohydrolase	NA	NA	NA	NA	NA
WP_017353010.1|1254197_1254587_-	nitroreductase	NA	A0A0A7RTL7	Clostridium_phage	40.5	6.7e-19
WP_052134082.1|1254734_1254986_-	site-specific DNA-methyltransferase	NA	A0A2L0V041	Agrobacterium_phage	49.3	1.8e-12
WP_154563504.1|1255099_1255261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017353012.1|1255441_1256056_-	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_173405964.1|1256481_1256637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308799.1|1256626_1256818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308802.1|1256801_1258118_-	replicative DNA helicase	NA	Q1MVI0	Enterobacteria_phage	39.8	4.2e-73
WP_039308805.1|1258119_1258956_-	helix-turn-helix domain-containing protein	NA	A0A2H4IYS0	uncultured_Caudovirales_phage	38.3	4.8e-14
WP_039308808.1|1259070_1260201_-	ParB N-terminal domain-containing protein	NA	Q4ZC37	Staphylococcus_virus	27.0	4.2e-13
WP_039308812.1|1260185_1260941_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	30.1	9.7e-22
WP_039308815.1|1261163_1261412_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039308818.1|1261424_1261859_-	helix-turn-helix domain-containing protein	NA	A0A1L2BY71	Clostridium_phage	54.9	4.4e-35
WP_003373629.1|1261983_1262181_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039308824.1|1262334_1262679_+	helix-turn-helix transcriptional regulator	NA	A0A1L2BY72	Clostridium_phage	61.3	1.3e-29
WP_039308827.1|1262774_1263605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039308829.1|1263632_1264703_-	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	63.4	2.4e-90
WP_144313595.1|1265058_1265463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039310147.1|1265579_1266146_-	hypothetical protein	NA	NA	NA	NA	NA
1265923:1265939	attL	AAATTAATATCCTCATC	NA	NA	NA	NA
WP_039308832.1|1266910_1267399_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1L2BY64	Clostridium_phage	53.7	2.6e-44
WP_039308835.1|1267503_1268646_+|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	53.5	3.0e-107
WP_012423605.1|1268763_1269642_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	24.4	1.2e-12
1274130:1274146	attR	GATGAGGATATTAATTT	NA	NA	NA	NA
>prophage 7
NZ_CP006903	Clostridium botulinum 202F chromosome, complete genome	3874462	1612733	1656942	3874462	capsid,plate,transposase,tail,portal,holin	Clostridium_phage(50.0%)	57	NA	NA
WP_035785677.1|1612733_1613105_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_012424838.1|1613273_1613468_-	alpha/beta-type small acid-soluble spore protein	NA	G3MAF8	Bacillus_virus	51.0	1.9e-06
WP_035785675.1|1614233_1614434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012422880.1|1614417_1614567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035785673.1|1615094_1615412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080288112.1|1615544_1615739_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_100433893.1|1615923_1616130_-	DUF3990 domain-containing protein	NA	NA	NA	NA	NA
WP_035786015.1|1616603_1616816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035785667.1|1616919_1617723_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_035785665.1|1617937_1618456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035785662.1|1619207_1619939_-	1,4-beta-N-acetylmuramidase	NA	NA	NA	NA	NA
WP_035785659.1|1620128_1620371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100433896.1|1620761_1621028_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_035785657.1|1621620_1622124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035785654.1|1622232_1622679_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_035793796.1|1623310_1623523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035785649.1|1624179_1626015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035785646.1|1626004_1628014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035793799.1|1628030_1629377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035785642.1|1629377_1629629_-	TIGR04540 family protein	NA	NA	NA	NA	NA
WP_080288114.1|1630109_1630544_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035785640.1|1630473_1630761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039309027.1|1632061_1632346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039309028.1|1632505_1633174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039309030.1|1633201_1633621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039309034.1|1633738_1634815_-	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	58.9	6.1e-86
WP_039309038.1|1634842_1635085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039309041.1|1635143_1635950_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	Q332B9	Clostridium_botulinum_C_phage	45.3	1.7e-08
WP_039309044.1|1636833_1637649_-	glycoside hydrolase family protein	NA	D6QWN8	uncultured_phage	35.3	5.0e-16
WP_039309046.1|1637707_1637881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017353246.1|1637893_1638115_-	UviB-like protein	NA	A0A2H4JAI7	uncultured_Caudovirales_phage	78.4	3.6e-09
WP_039309050.1|1638191_1639199_-	Ig domain-containing protein	NA	A0A1L2BYA9	Clostridium_phage	32.1	4.4e-14
WP_035786883.1|1639438_1639618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039308159.1|1639636_1639903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039309053.1|1641066_1641678_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	42.2	6.1e-43
WP_039309056.1|1641667_1642747_-|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	41.1	2.8e-59
WP_052134084.1|1642753_1643182_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_039310163.1|1643195_1643528_-	DUF2577 family protein	NA	NA	NA	NA	NA
WP_052134086.1|1643538_1645530_-	C40 family peptidase	NA	X5JAJ3	Clostridium_phage	27.5	5.0e-09
WP_052134087.1|1645543_1646170_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_052134088.1|1646182_1648021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154563460.1|1648021_1648189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052134089.1|1648200_1648587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039309062.1|1648602_1649028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039309065.1|1649043_1650126_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A8WJR2	Clostridium_phage	35.3	8.1e-46
WP_039309070.1|1650125_1650575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052134090.1|1650564_1650972_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_039309073.1|1650958_1651309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039309075.1|1651311_1651599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039309078.1|1651613_1652549_-	hypothetical protein	NA	A0A090D825	Clostridium_phage	56.9	1.2e-98
WP_039309081.1|1652585_1653185_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_039309083.1|1653348_1653651_-	DUF4406 domain-containing protein	NA	NA	NA	NA	NA
WP_039309085.1|1653824_1654052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154563463.1|1654063_1654216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158380749.1|1654272_1654656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039309091.1|1654664_1655555_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_039309094.1|1655544_1656942_-|portal	phage portal protein	portal	A0A1V0DZW8	Clostridioides_phage	35.2	1.2e-57
>prophage 8
NZ_CP006903	Clostridium botulinum 202F chromosome, complete genome	3874462	1663449	1679631	3874462	integrase	Clostridium_phage(38.89%)	35	1675749:1675765	1686481:1686497
WP_039309118.1|1663449_1663974_-	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	23.6	8.8e-06
WP_012422880.1|1663998_1664148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039310177.1|1664151_1664415_-	hypothetical protein	NA	A0A0A7RUP4	Clostridium_phage	54.8	1.8e-15
WP_039309120.1|1664550_1664751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039310180.1|1664760_1665174_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	50.7	1.7e-28
WP_052134091.1|1665186_1665705_-	HNH endonuclease	NA	E5DV63	Deep-sea_thermophilic_phage	40.8	1.9e-24
WP_039309123.1|1665697_1666222_-	hypothetical protein	NA	A0A2K9V425	Faecalibacterium_phage	45.0	1.9e-29
WP_052134092.1|1666218_1666398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039309126.1|1666445_1667159_-	hypothetical protein	NA	A0A0A7RWW3	Clostridium_phage	59.6	3.1e-70
WP_039309129.1|1667228_1667630_-	hypothetical protein	NA	A0A0A7RUF3	Clostridium_phage	58.6	6.9e-35
WP_039309135.1|1667956_1668142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154563466.1|1668176_1668323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154563469.1|1668326_1668473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154563472.1|1668792_1668957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039309138.1|1669059_1669491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154563475.1|1669520_1669670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039309142.1|1669694_1670564_-	hypothetical protein	NA	A0A2H4JF78	uncultured_Caudovirales_phage	43.0	4.6e-52
WP_039309144.1|1670574_1671342_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0A7RUC1	Clostridium_phage	46.0	1.5e-59
WP_052134093.1|1671328_1672156_-	recombinase RecT	NA	H7BUU1	unidentified_phage	46.0	2.3e-56
WP_080315403.1|1672168_1672324_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_039309147.1|1672333_1672741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080315404.1|1672733_1673336_-	sigma-70 family RNA polymerase sigma factor	NA	M9Q2I8	Clostridium_phage	34.5	4.1e-15
WP_173405967.1|1673319_1673481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154563478.1|1673483_1673636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039309154.1|1673739_1673991_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	51.8	8.4e-15
WP_017354102.1|1674042_1674312_+	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	38.8	3.9e-10
WP_039309157.1|1674308_1674725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039309159.1|1674756_1675461_-	phage antirepressor KilAC domain-containing protein	NA	A0A2D1GQ65	Lysinibacillus_phage	42.7	2.5e-40
WP_173405968.1|1675597_1675759_-	hypothetical protein	NA	NA	NA	NA	NA
1675749:1675765	attL	TAATTAATCATTAAATA	NA	NA	NA	NA
WP_039309162.1|1675873_1676086_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039309165.1|1676091_1676889_-	ORF6N domain-containing protein	NA	X5JAW6	Clostridium_phage	44.1	7.5e-57
WP_039309167.1|1676911_1677127_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039309170.1|1677294_1677891_+	helix-turn-helix transcriptional regulator	NA	B6SBW8	Clostridium_virus	30.4	3.4e-14
WP_039309173.1|1677911_1678394_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A141VTQ3	Staphylococcus_phage	41.1	2.5e-23
WP_039310192.1|1678440_1679631_+|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	38.9	5.2e-70
1686481:1686497	attR	TATTTAATGATTAATTA	NA	NA	NA	NA
>prophage 9
NZ_CP006903	Clostridium botulinum 202F chromosome, complete genome	3874462	2455135	2462856	3874462	integrase	Clostridium_phage(33.33%)	8	2455524:2455539	2459996:2460011
WP_039309450.1|2455135_2455954_-	ATP-binding protein	NA	H7BV58	unidentified_phage	35.1	1.4e-18
2455524:2455539	attL	TTATTCATTAATTCAT	NA	NA	NA	NA
WP_100433897.1|2455913_2456237_-	hypothetical protein	NA	A0A218KCJ2	Bacillus_phage	40.8	1.2e-10
WP_039309456.1|2456686_2456980_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039309457.1|2457055_2457259_-	helix-turn-helix transcriptional regulator	NA	I2E8Y1	Clostridium_phage	40.8	1.7e-05
WP_052134096.1|2457403_2457856_+	helix-turn-helix transcriptional regulator	NA	I3VYY8	Thermoanaerobacterium_phage	37.9	6.2e-08
WP_039309459.1|2457856_2459005_+|integrase	site-specific integrase	integrase	A0A0A8WIF9	Clostridium_phage	31.0	6.3e-41
WP_035783423.1|2459805_2460462_-	hypothetical protein	NA	NA	NA	NA	NA
2459996:2460011	attR	TTATTCATTAATTCAT	NA	NA	NA	NA
WP_035783425.1|2460483_2462856_-	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	24.9	8.8e-37
>prophage 10
NZ_CP006903	Clostridium botulinum 202F chromosome, complete genome	3874462	2990419	3048136	3874462	tRNA,terminase,integrase,coat	Bacillus_phage(26.67%)	49	3006685:3006705	3053030:3053050
WP_003371286.1|2990419_2990713_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_012425007.1|2990731_2992189_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_035786282.1|2992209_2993640_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_035786284.1|2993702_2994002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039309621.1|2994262_2995744_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039309622.1|2995816_2997475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003373848.1|2997721_2998471_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_035786287.1|2998474_2999092_+	XTP/dITP diphosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	33.3	4.1e-10
WP_035786288.1|2999103_2999583_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_039309623.1|3001927_3003079_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	31.8	1.8e-27
WP_052134097.1|3003079_3003421_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	45.0	1.4e-07
WP_039309624.1|3003581_3003764_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039309625.1|3003797_3003980_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158380751.1|3004161_3006300_+	hypothetical protein	NA	A0A1U9ZA69	Proteus_phage	27.7	2.0e-24
WP_039309629.1|3006313_3006583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039309631.1|3006598_3007054_+	hypothetical protein	NA	A0A2H4J015	uncultured_Caudovirales_phage	34.9	3.9e-10
3006685:3006705	attL	TGATATAGAAATTTTAAAAAA	NA	NA	NA	NA
WP_039309633.1|3007439_3007685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039309635.1|3007976_3008465_+|terminase	terminase small subunit	terminase	U5PZD3	Bacillus_phage	40.3	1.8e-29
WP_039309637.1|3008606_3009176_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0WMK0	Flavobacterium_phage	30.2	1.7e-07
WP_039309639.1|3009308_3009485_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039309641.1|3010070_3010682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039309642.1|3010786_3011422_+	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	30.7	3.5e-17
WP_039309643.1|3011544_3011880_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_039309644.1|3011904_3012447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039309645.1|3012681_3013998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039309647.1|3014265_3015639_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_144313598.1|3015704_3016772_+	type II toxin-antitoxin system RnlA family toxin	NA	NA	NA	NA	NA
WP_039309651.1|3016802_3017192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035783448.1|3024361_3025309_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_035783450.1|3025410_3026100_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.7	1.7e-36
WP_035783451.1|3026104_3027502_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	32.4	2.7e-33
WP_035783453.1|3027498_3028953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035783454.1|3029243_3030626_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_035783456.1|3030629_3031973_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_035793403.1|3032326_3034177_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	27.2	1.9e-39
WP_035783459.1|3034359_3034938_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_035793401.1|3034968_3035925_+	FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	22.8	9.1e-09
WP_035783462.1|3035921_3036485_-	lipase	NA	NA	NA	NA	NA
WP_035783463.1|3036500_3037118_-	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_035784478.1|3037434_3038454_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.8	6.8e-63
WP_035783465.1|3038456_3039461_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035783466.1|3039624_3040812_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.5	5.6e-16
WP_035783468.1|3040975_3041395_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_035783470.1|3041722_3042805_+	ethanolamine utilization protein EutH	NA	NA	NA	NA	NA
WP_035783471.1|3042830_3043967_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_035783473.1|3043969_3045091_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	33.8	8.4e-06
WP_035783475.1|3045237_3046254_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_035783477.1|3046273_3046999_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_035783479.1|3047092_3048136_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
3053030:3053050	attR	TGATATAGAAATTTTAAAAAA	NA	NA	NA	NA
>prophage 11
NZ_CP006903	Clostridium botulinum 202F chromosome, complete genome	3874462	3500882	3514807	3874462	plate,tail	Clostridium_phage(92.31%)	15	NA	NA
WP_035784041.1|3500882_3501344_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTX7	Clostridium_phage	50.7	1.2e-35
WP_035791008.1|3501361_3501727_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SCV6	Paenibacillus_phage	49.2	1.8e-05
WP_035784044.1|3501981_3502491_+	helix-turn-helix domain-containing protein	NA	I2E8Y5	Clostridium_phage	45.3	3.1e-32
WP_039309871.1|3503071_3503488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012451514.1|3503477_3503633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035784047.1|3503633_3504944_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7S087	Clostridium_phage	54.6	1.4e-129
WP_012450094.1|3504962_3505430_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	72.4	5.2e-58
WP_035784049.1|3505727_3506141_+	phage XkdN-like protein	NA	A0A0A7RTN3	Clostridium_phage	63.0	4.4e-45
WP_035784050.1|3506336_3508286_+|tail	tail length tape measure protein	tail	A0A0A7S0K9	Clostridium_phage	30.4	2.1e-52
WP_035784051.1|3508285_3508948_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RW06	Clostridium_phage	56.3	1.9e-69
WP_035784052.1|3508959_3509931_+	hypothetical protein	NA	A0A0A7RTZ4	Clostridium_phage	55.6	9.0e-105
WP_080288048.1|3509934_3510264_+	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	53.8	1.1e-25
WP_035784053.1|3510256_3510664_+	DUF2634 domain-containing protein	NA	A0A0A7RTH1	Clostridium_phage	64.8	4.7e-39
WP_035791010.1|3510666_3511725_+|plate	baseplate J/gp47 family protein	plate	A0A0A7S0L4	Clostridium_phage	53.1	3.2e-95
WP_035784056.1|3514192_3514807_+	YmfQ family protein	NA	A0A0A7RTU9	Clostridium_phage	58.0	6.6e-61
>prophage 12
NZ_CP006903	Clostridium botulinum 202F chromosome, complete genome	3874462	3674959	3681212	3874462		Cyanophage(33.33%)	6	NA	NA
WP_035791046.1|3674959_3675439_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.9	1.1e-26
WP_035791047.1|3675438_3676146_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	45.2	5.6e-48
WP_012424148.1|3676517_3677945_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.3	2.8e-54
WP_035791049.1|3677954_3678956_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	46.9	8.2e-69
WP_035791050.1|3678943_3679558_+	phosphoribosylglycinamide formyltransferase	NA	R9S626	Prochlorococcus_phage	36.1	1.7e-21
WP_035784256.1|3679706_3681212_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	S4VT61	Pandoravirus	37.2	1.0e-46
>prophage 1
NZ_CP006904	Clostridium botulinum 202F plasmid pCBI, complete sequence	40142	0	17300	40142	terminase	Acinetobacter_phage(36.36%)	20	NA	NA
WP_040107827.1|85_445_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	38.1	1.6e-11
WP_052134104.1|434_1040_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	42.5	2.3e-34
WP_040107828.1|1050_3015_-	glucosaminidase domain-containing protein	NA	A0A0P0HSL6	Acinetobacter_phage	30.7	2.6e-26
WP_040107829.1|3007_3334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040107830.1|3346_3877_-	hypothetical protein	NA	L7TN02	Rhizobium_phage	29.9	6.1e-15
WP_040107831.1|3879_5649_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_040107870.1|5813_6284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040107832.1|6304_6733_-	DUF3277 family protein	NA	NA	NA	NA	NA
WP_040107833.1|6745_7876_-	DUF3383 family protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	37.1	1.4e-53
WP_040107836.1|8441_8804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040107837.1|9388_9868_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_040107838.1|9878_10106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040107839.1|10118_11132_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	34.6	2.2e-37
WP_040107840.1|11144_11675_-	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	31.9	2.9e-09
WP_040107841.1|11676_12924_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	31.2	2.4e-25
WP_040107842.1|12954_13143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040107843.1|13186_13666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040107844.1|13681_14530_-	hypothetical protein	NA	A0A0P0IKX5	Acinetobacter_phage	35.4	3.8e-27
WP_052134106.1|14531_15962_-	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	35.9	1.1e-74
WP_052134107.1|15983_17300_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J4X1	uncultured_Caudovirales_phage	56.9	1.9e-137
>prophage 2
NZ_CP006904	Clostridium botulinum 202F plasmid pCBI, complete sequence	40142	25057	28924	40142		Caldibacillus_phage(25.0%)	9	NA	NA
WP_040107856.1|25057_25477_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	49.3	1.5e-27
WP_040107857.1|26366_26666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173405981.1|26668_26815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080315418.1|26815_26950_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_154563491.1|26984_27131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040107858.1|27291_27636_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040107859.1|27908_28118_+	helix-turn-helix transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	42.0	3.8e-05
WP_040107860.1|28219_28513_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	62.6	1.3e-22
WP_080315420.1|28567_28924_-	hypothetical protein	NA	A0A2D1Q768	Geobacillus_phage	31.4	6.6e-05
>prophage 3
NZ_CP006904	Clostridium botulinum 202F plasmid pCBI, complete sequence	40142	33303	39026	40142	holin	Enterococcus_phage(20.0%)	8	NA	NA
WP_040107865.1|33303_34056_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.8	9.6e-14
WP_154563497.1|34136_34286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052134109.1|34420_35116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040107866.1|35349_36132_-	glycoside hydrolase family protein	NA	A0A142EZW8	Stenotrophomonas_phage	36.1	6.9e-15
WP_040107867.1|36168_36591_-|holin	phage holin family protein	holin	A0A0A7RTU1	Clostridium_phage	60.4	1.4e-41
WP_035791244.1|36690_36870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052134110.1|37168_38365_-	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	38.6	1.1e-19
WP_052134111.1|38351_39026_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	35.0	2.1e-20
