The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009644	Escherichia coli ER2796 strain K-12 ER2796 chromosome, complete genome	4558663	271162	320645	4558663	integrase,transposase	Acinetobacter_phage(28.57%)	41	273755:273769	300919:300933
WP_001254938.1|271162_272314_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
273755:273769	attL	ATGGCGATGGAGCCG	NA	NA	NA	NA
WP_010723085.1|274660_275677_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|275884_277288_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|277274_278207_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|278315_279362_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_001030800.1|280944_281295_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|281388_282543_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|282837_283746_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|283760_285728_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|285954_287337_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|287348_288959_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|288963_289722_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|289860_290865_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|292059_292791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|292881_293508_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|293779_294478_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|294504_295359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|295477_295702_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|295698_296139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|296255_297656_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_001111342.1|297940_298351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121359.1|298329_299286_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|299295_301494_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
300919:300933	attR	CGGCTCCATCGCCAT	NA	NA	NA	NA
WP_000643333.1|301490_302447_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070700.1|302443_303133_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|303550_304165_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|304412_304742_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001350485.1|305054_305765_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_038432483.1|305733_307377_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|307366_309892_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716398.1|309917_310586_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|310643_311231_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|311305_311848_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|312671_312899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|312933_313074_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|313073_313337_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|313700_313802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|315850_317012_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001299021.1|318285_318879_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|318890_319127_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_006250222.1|319436_320645_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	3.0e-235
>prophage 2
NZ_CP009644	Escherichia coli ER2796 strain K-12 ER2796 chromosome, complete genome	4558663	564267	576500	4558663	integrase,transposase	Enterobacteria_phage(53.33%)	20	564208:564254	582889:582935
564208:564254	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|564267_565431_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|565550_565814_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|566136_566232_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|566294_567456_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|567767_568100_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|568147_568297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|568354_569881_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|570345_570897_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|570906_571704_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|571820_571922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|571918_572374_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|572373_572544_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|572536_572827_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|572823_573186_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|573182_573323_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|573408_573792_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|574189_575206_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000079503.1|575238_575649_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|575934_576141_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|576305_576500_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
582889:582935	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP009644	Escherichia coli ER2796 strain K-12 ER2796 chromosome, complete genome	4558663	1386992	1450938	4558663	tRNA,tail,transposase,lysis	Escherichia_phage(40.62%)	60	NA	NA
WP_000628058.1|1386992_1388225_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1388479_1389463_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1389940_1391314_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1391442_1392378_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1392429_1393665_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1393666_1393882_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1393960_1394170_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1394162_1394357_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1394413_1395223_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1395215_1397816_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1397917_1398193_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1398267_1398438_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1398437_1398659_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1399100_1399589_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1399585_1399741_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1400194_1400671_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1400794_1401091_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1401113_1401536_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1401548_1402406_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1402412_1403159_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1403181_1403742_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1403829_1404015_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1404211_1405669_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1405805_1406069_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1406049_1406409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1408174_1409155_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_071842875.1|1409477_1412840_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	6.2e-12
WP_001698950.1|1412839_1413415_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1413512_1414103_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1414419_1414653_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1414721_1414835_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1415613_1416048_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1416188_1417322_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_000628244.1|1417688_1421213_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|1421486_1421753_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|1421749_1422172_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762236.1|1422282_1423272_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_046377550.1|1423479_1426059_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|1426115_1426301_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001300734.1|1426308_1426635_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067514.1|1426806_1427712_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|1427947_1429447_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535469.1|1429504_1431778_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186469.1|1432025_1434071_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191077.1|1434355_1435285_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|1435296_1435584_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072837.1|1435592_1436339_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189201.1|1436353_1436851_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206388.1|1436858_1437929_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292353.1|1437925_1438693_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969784.1|1438692_1439481_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973360.1|1439482_1440910_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|1440899_1441322_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206197.1|1441321_1442527_+	bifunctional 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632280.1|1442553_1443867_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039887.1|1443967_1444918_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123464.1|1444899_1445490_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_010723099.1|1445593_1445659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|1448349_1449578_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001254932.1|1449786_1450938_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 4
NZ_CP009644	Escherichia coli ER2796 strain K-12 ER2796 chromosome, complete genome	4558663	1609880	1654547	4558663	protease,tail,transposase,lysis	Enterobacteria_phage(30.0%)	59	NA	NA
WP_000527743.1|1609880_1611341_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_120795384.1|1613317_1613431_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|1613499_1613733_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000078177.1|1614049_1614640_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1614737_1615313_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1615312_1616275_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1616225_1616795_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1617183_1617417_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_001339197.1|1617460_1618669_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000373090.1|1618812_1619223_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1619374_1619548_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1619719_1619875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1619953_1620019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1620021_1620210_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1620220_1620433_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1620795_1621293_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1621289_1621823_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1621819_1622131_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1622135_1622351_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1623104_1623320_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1623620_1623833_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1623887_1623977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047135.1|1624254_1625007_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1625020_1626070_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1626071_1626350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1626416_1626668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1626884_1627040_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1627111_1627399_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1627398_1627638_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1627662_1627968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1628170_1628503_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1628939_1629089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1629385_1629616_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1629699_1630107_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1630273_1630429_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_038432574.1|1630588_1630807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1631374_1631563_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_038432577.1|1631559_1631751_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001360138.1|1634493_1634604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|1634661_1635681_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1635692_1636907_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1637112_1637439_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1637573_1637915_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1637949_1638510_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1638512_1639223_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1639330_1639636_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|1639834_1642261_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001340362.1|1642321_1644745_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|1644755_1645373_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|1645374_1646229_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1646271_1646886_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071592181.1|1647044_1648337_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|1648289_1648985_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225262.1|1649109_1650330_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019525.1|1650464_1651358_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|1651464_1652718_+	MFS transporter	NA	NA	NA	NA	NA
WP_038432580.1|1653114_1653450_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233093.1|1653542_1653626_+	stationary phase-induced protein	NA	NA	NA	NA	NA
WP_001260865.1|1653725_1654547_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP009644	Escherichia coli ER2796 strain K-12 ER2796 chromosome, complete genome	4558663	2456182	2467393	4558663	integrase,tail	Enterobacteria_phage(53.33%)	16	2454157:2454173	2471068:2471084
2454157:2454173	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2456182_2457115_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2457426_2458584_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2458736_2459099_+	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2459095_2460016_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2460012_2461344_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2461378_2461660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2461958_2462399_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2462425_2462944_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2462993_2463269_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2463268_2463763_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000135673.1|2464486_2464849_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2464914_2465739_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2465866_2466403_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2466393_2466756_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2466755_2467061_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2467192_2467393_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2471068:2471084	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 6
NZ_CP009644	Escherichia coli ER2796 strain K-12 ER2796 chromosome, complete genome	4558663	2841192	2848331	4558663		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2841192_2843754_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2843859_2844516_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2844566_2845334_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2845529_2846438_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2846434_2847601_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2847692_2848331_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
