The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009106	Escherichia coli strain 94-3024 chromosome, complete genome	4884464	1297767	1370493	4884464	tRNA,integrase,transposase,terminase,tail,protease,lysis	Enterobacteria_phage(36.11%)	74	1333791:1333837	1361967:1362013
WP_001157961.1|1297767_1298862_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1298930_1299857_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|1300086_1300569_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141276.1|1300646_1301462_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_021293187.1|1301551_1303333_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	1.2e-38
WP_000943556.1|1303345_1304122_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1304221_1305100_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_021293188.1|1305268_1306723_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000878014.1|1306925_1307945_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000006887.1|1308224_1309586_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001371630.1|1309642_1310944_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000706355.1|1310965_1312111_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
WP_000540949.1|1312338_1313124_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001377891.1|1313134_1314370_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703909.1|1314391_1315441_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580860.1|1315757_1317425_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495408.1|1317434_1318694_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_031314883.1|1318704_1319499_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_032317192.1|1319516_1320410_+	carbamate kinase	NA	NA	NA	NA	NA
WP_021292879.1|1320546_1321614_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1321610_1322120_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|1322237_1322960_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|1322962_1323457_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|1323630_1325016_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|1325051_1325573_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1325680_1325893_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1325894_1326761_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1327240_1327783_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|1328002_1328695_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_024199693.1|1328725_1331335_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_021292878.1|1331347_1332355_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255228.1|1332365_1332881_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_021292877.1|1332883_1333516_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1333791:1333837	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|1333850_1335014_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000206811.1|1335240_1335546_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	4.9e-49
WP_021292876.1|1335545_1335908_-	phage protein	NA	K7PH61	Enterobacteria_phage	97.4	1.9e-63
WP_000008165.1|1335898_1336435_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_000081287.1|1336562_1337387_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_001546523.1|1337452_1337815_-	hypothetical protein	NA	U5P4J6	Shigella_phage	99.2	3.3e-60
WP_000559922.1|1338284_1338800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|1339014_1339689_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|1339779_1339980_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515829.1|1340023_1340581_+	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_001250269.1|1340756_1340936_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001356227.1|1340925_1341867_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_001300314.1|1341863_1342358_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	3.6e-86
WP_001204780.1|1343092_1343476_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737283.1|1343665_1344763_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000670959.1|1345351_1345567_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001135281.1|1345566_1346064_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|1346280_1346463_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|1346553_1346847_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001403557.1|1347137_1347548_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	99.3	9.4e-72
WP_001031427.1|1347833_1348040_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1348204_1348399_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453576.1|1348787_1349333_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_021292874.1|1349307_1350852_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	1.6e-305
WP_000198149.1|1350805_1351012_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_000847355.1|1351952_1352282_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
WP_016230622.1|1352281_1352980_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	6.2e-132
WP_001441739.1|1352985_1353729_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090891.1|1353665_1354298_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000885616.1|1355346_1355922_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|1356017_1356608_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|1356924_1357158_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1357226_1357340_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|1357705_1358374_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226378.1|1358919_1360404_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|1360590_1361544_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177469.1|1362056_1362818_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1361967:1362013	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_021292871.1|1363000_1363891_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_032317189.1|1363891_1366864_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383951.1|1366850_1369088_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000394594.1|1369356_1370493_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP009106	Escherichia coli strain 94-3024 chromosome, complete genome	4884464	1969253	1983502	4884464	portal,integrase,capsid,terminase,head,tail,protease	uncultured_Caudovirales_phage(92.31%)	23	1969175:1969189	1970531:1970545
1969175:1969189	attL	TTGTTTCACGTTGTA	NA	NA	NA	NA
WP_032317082.1|1969253_1970483_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	3.4e-133
WP_000953271.1|1970857_1971046_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
1970531:1970545	attR	TACAACGTGAAACAA	NA	NA	NA	NA
WP_000182306.1|1971289_1971493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103621.1|1971550_1971730_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.5e-10
WP_000201463.1|1972235_1972415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001398590.1|1972607_1973171_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	40.0	8.0e-13
WP_032279725.1|1973157_1973358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728896.1|1973363_1973663_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833612.1|1973659_1975057_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.2	1.5e-113
WP_001288030.1|1975247_1975511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021293490.1|1975507_1975822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126663.1|1975831_1976242_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233314.1|1976252_1976501_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001142405.1|1976642_1976867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021293489.1|1977159_1978317_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	6.2e-137
WP_000504057.1|1978356_1978929_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_000267604.1|1978930_1980142_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	9.6e-189
WP_001020660.1|1980138_1980477_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000134113.1|1980473_1980770_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|1980769_1981210_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174068.1|1981193_1981376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|1981500_1981857_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_021292931.1|1981840_1983502_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.0	8.3e-276
>prophage 3
NZ_CP009106	Escherichia coli strain 94-3024 chromosome, complete genome	4884464	2093001	2160408	4884464	holin,integrase,capsid,terminase,head,tail,protease	Stx2-converting_phage(28.57%)	74	2092838:2092865	2146603:2146630
2092838:2092865	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_024199680.1|2093001_2094132_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.7	1.8e-104
WP_000113186.1|2094109_2094358_-	excisionase	NA	NA	NA	NA	NA
WP_021293386.1|2094422_2096894_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	2.0e-55
WP_000092782.1|2096989_2097178_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2097174_2097363_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_024199679.1|2098147_2098516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380317.1|2098527_2098680_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_021293150.1|2098844_2099252_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	53.1	2.9e-12
WP_021293151.1|2099335_2099566_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705131.1|2099549_2100071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032317158.1|2100051_2101017_+	phage O protein family	NA	U5P0A0	Shigella_phage	60.6	1.9e-54
WP_021293152.1|2101023_2101764_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.3	5.8e-112
WP_000450858.1|2101793_2102555_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	64.0	8.4e-74
WP_000215513.1|2102614_2102809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211993.1|2103150_2103702_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000882661.1|2103916_2104129_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	5.6e-28
WP_000042395.1|2104231_2104549_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001452497.1|2105137_2105365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024199763.1|2105418_2105688_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	1.2e-11
WP_021293154.1|2105689_2106739_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.5e-110
WP_000904136.1|2106751_2107114_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_021293385.1|2107106_2107772_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.6	4.6e-60
WP_000342737.1|2108025_2108739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|2108912_2109110_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_039259629.1|2109279_2110320_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	3.8e-202
WP_000271631.1|2110799_2111228_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000382065.1|2111923_2112649_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039259635.1|2114511_2116476_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	79.1	2.2e-296
WP_000142780.1|2116610_2116790_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_001290207.1|2116830_2117103_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	95.6	1.3e-21
WP_000284506.1|2117179_2117395_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001041945.1|2117398_2118190_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_001092875.1|2118701_2119235_+	lysozyme	NA	Q08J98	Stx2-converting_phage	95.5	1.1e-99
WP_000788411.1|2119427_2119574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071974579.1|2119942_2120149_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_000735655.1|2120213_2120438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021293099.1|2120782_2121109_+	TonB family protein	NA	H6WZK5	Escherichia_phage	97.2	3.2e-54
WP_000095744.1|2121240_2121441_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829191.1|2121482_2121848_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.0e-61
WP_000958387.1|2122136_2122700_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001376400.1|2122696_2124358_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.8	0.0e+00
WP_000172990.1|2124421_2126359_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|2126403_2126625_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125990.1|2129151_2129478_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001029274.1|2129487_2129838_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000573358.1|2129834_2130281_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
WP_000133383.1|2130277_2130622_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_001275432.1|2130688_2131405_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	6.2e-127
WP_000710934.1|2131419_2131794_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	7.8e-65
WP_122993267.1|2131889_2132099_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000212965.1|2132146_2135389_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.2	0.0e+00
WP_000343411.1|2135381_2135723_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
WP_032308176.1|2135722_2136421_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	3.4e-130
WP_032308177.1|2136431_2137175_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.4	1.9e-147
WP_000246333.1|2137072_2137717_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	73.9	1.3e-88
WP_039259655.1|2138627_2142323_+	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	84.3	0.0e+00
WP_001270056.1|2142391_2143015_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	2.0e-65
WP_000216448.1|2143164_2144433_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	99.1	6.5e-55
WP_001049910.1|2144501_2145173_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	82.5	8.1e-105
WP_001079509.1|2146780_2147287_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2146603:2146630	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|2147332_2147833_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2147918_2148098_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|2148478_2149285_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|2149284_2150478_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983908.1|2150489_2151851_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|2151851_2153447_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194590.1|2153446_2155009_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2155100_2155145_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|2155282_2156164_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2156160_2156781_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|2156881_2157754_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|2157793_2158384_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559280.1|2158380_2159139_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|2159358_2160408_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 4
NZ_CP009106	Escherichia coli strain 94-3024 chromosome, complete genome	4884464	3001094	3111422	4884464	holin,tRNA,portal,integrase,capsid,terminase,head,tail,lysis	Enterobacteria_phage(42.65%)	112	3018899:3018958	3027789:3027870
WP_000476011.1|3001094_3002456_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000716757.1|3002785_3003103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|3003517_3004417_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|3004498_3005278_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844200.1|3005377_3006418_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_021292845.1|3006465_3007821_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823272.1|3007824_3008109_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182904.1|3008139_3008592_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_021292846.1|3008601_3009864_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000289788.1|3009892_3010747_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|3011056_3012109_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858484.1|3012365_3013643_+	nucleoside permease	NA	NA	NA	NA	NA
WP_001585875.1|3013639_3014644_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.7	2.4e-12
WP_000012008.1|3014640_3015606_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|3015579_3016326_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297420.1|3016377_3017196_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000822274.1|3017260_3018061_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195605.1|3018057_3018846_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
3018899:3018958	attL	CCCTACGCTGGCATTATCCAGATCAGGTGATACGGGTATTTCTCAGCCTTCACGCAGAAG	NA	NA	NA	NA
WP_024199760.1|3019185_3019431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021293134.1|3019626_3020289_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000005468.1|3020343_3020514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001306377.1|3020533_3020722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065228.1|3022709_3023249_+	recombinase family protein	NA	Q2A092	Sodalis_phage	41.9	4.2e-27
WP_024190854.1|3023415_3023880_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000737404.1|3023990_3024338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021293132.1|3024726_3026298_-	DUF262 domain-containing protein	NA	E5E3X3	Burkholderia_phage	57.7	2.6e-178
WP_021293394.1|3026397_3027705_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000019944.1|3027958_3028231_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
3027789:3027870	attR	CCCTACGCTGGCATTATCCAGATCAGGTGATACGGGTATTTCTCAGCCTTCACGCAGAAGGGCACCCCGAGTCGTTTGGTTG	NA	NA	NA	NA
WP_000134569.1|3028351_3029176_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|3029394_3029733_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405711.1|3029814_3030849_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945409.1|3030864_3033345_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_021293131.1|3033360_3034035_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|3034115_3034658_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001447395.1|3034950_3035232_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|3035494_3036604_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|3036735_3038769_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_021293414.1|3038909_3042704_+	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_021293413.1|3042713_3046346_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636926.1|3046406_3046727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074859.1|3047909_3048998_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294395.1|3049008_3051288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292767.1|3051280_3052417_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
WP_001295429.1|3054552_3055014_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3055054_3055525_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3055571_3056291_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3056287_3057973_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001217533.1|3058487_3058736_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	86.6	1.0e-33
WP_001373129.1|3059005_3059680_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_000438829.1|3059691_3059904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024199706.1|3059913_3061626_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	51.7	7.7e-67
WP_000078853.1|3061770_3061911_-	type I toxin-antitoxin system Hok family toxin	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_039259876.1|3062109_3065796_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.9	0.0e+00
WP_122996641.1|3066706_3067339_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.6	2.4e-98
WP_000194792.1|3067284_3068028_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.0	1.8e-145
WP_001373202.1|3068038_3068737_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	1.2e-130
WP_000847280.1|3068736_3069066_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_000082508.1|3069062_3071642_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	79.8	0.0e+00
WP_000533452.1|3071622_3072036_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	84.8	1.9e-43
WP_001373378.1|3072062_3072494_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	8.2e-42
WP_000235126.1|3072509_3073259_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	1.6e-130
WP_000683075.1|3073266_3073662_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_000974993.1|3073658_3074234_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	2.9e-50
WP_001204531.1|3074249_3074603_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.8e-40
WP_001373367.1|3074595_3074979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522634.1|3075030_3076059_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.3e-114
WP_000256800.1|3076116_3076464_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_021293161.1|3076499_3078005_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_021293160.1|3077994_3079587_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.6	3.4e-186
WP_000259002.1|3079583_3079790_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_021293478.1|3079773_3081702_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.4	2.3e-261
WP_001102148.1|3081673_3082222_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.7	1.0e-57
WP_021293159.1|3082896_3083427_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	98.9	1.1e-96
WP_032209690.1|3083629_3084067_-|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	97.9	4.7e-69
WP_000443009.1|3084069_3084219_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.6	6.7e-12
WP_001056888.1|3084218_3084791_-	hypothetical protein	NA	A0A088CD55	Shigella_phage	88.4	9.0e-97
WP_001092876.1|3085065_3085599_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	6.9e-99
WP_024199769.1|3085733_3086021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001041949.1|3086109_3086901_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284490.1|3086904_3087120_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_021293493.1|3087614_3089579_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.8	8.5e-296
WP_021293268.1|3089822_3090146_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	98.1	1.0e-60
WP_000738072.1|3090443_3090713_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_001365055.1|3090724_3091684_-	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	100.0	1.6e-175
WP_039259884.1|3092066_3093125_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	92.3	1.6e-192
WP_000917741.1|3093275_3093473_-	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_021293442.1|3093707_3094325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204795.1|3094391_3094784_-	antitermination protein Q	NA	Q8W638	Enterobacteria_phage	57.6	2.7e-36
WP_021293223.1|3094801_3095791_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.9	5.8e-192
WP_001065352.1|3095843_3096101_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_000203855.1|3096097_3097498_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.2	6.4e-245
WP_021293224.1|3097494_3098373_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	3.5e-140
WP_039259893.1|3098383_3099376_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	90.1	1.3e-53
WP_021293441.1|3099372_3099699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618002.1|3099695_3099920_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	52.1	9.8e-15
WP_039259895.1|3099916_3100768_-	Rha family phage regulatory protein	NA	K7PLX4	Enterobacteria_phage	83.6	1.3e-123
WP_000794367.1|3100764_3101589_-	transporter	NA	Q8W644	Enterobacteria_phage	99.6	1.0e-157
WP_021293226.1|3101641_3102349_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	80.9	8.5e-105
WP_000944728.1|3102430_3102664_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_000800142.1|3102820_3103510_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	87.8	6.8e-115
WP_021293227.1|3103657_3104359_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	63.6	1.1e-38
WP_000147364.1|3104355_3104556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000553979.1|3104754_3104937_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	3.8e-09
WP_001365075.1|3104942_3105515_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
WP_021293439.1|3105884_3106712_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	99.3	2.1e-131
WP_024199692.1|3106752_3107124_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	8.8e-61
WP_001193439.1|3107315_3107570_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	98.8	1.1e-43
WP_021293230.1|3107603_3108890_+	DUF3596 domain-containing protein	NA	A0A0N7KZF5	Stx2-converting_phage	99.8	3.8e-252
WP_042101647.1|3108925_3109612_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
WP_001216963.1|3109671_3109779_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3109759_3110491_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|3110495_3111422_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 5
NZ_CP009106	Escherichia coli strain 94-3024 chromosome, complete genome	4884464	3311028	3356526	4884464	holin,tRNA,portal,plate,integrase,capsid,terminase,head,tail	Enterobacteria_phage(86.05%)	54	3314034:3314053	3350586:3350605
WP_001283581.1|3311028_3311841_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|3311840_3312854_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000004833.1|3312919_3314077_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
3314034:3314053	attL	TTTTCATCAACAAGGATTTT	NA	NA	NA	NA
WP_000023404.1|3314236_3315241_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	5.8e-99
WP_001390705.1|3315337_3315658_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_000004249.1|3315771_3316059_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_000200503.1|3316065_3316272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813360.1|3316524_3316866_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	1.1e-54
WP_000158965.1|3316876_3317164_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	6.0e-33
WP_000514277.1|3317175_3317418_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021652.1|3317414_3317528_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000985157.1|3317614_3317818_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153703.1|3317814_3318081_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	2.6e-30
WP_000104314.1|3318077_3318377_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	87.9	1.4e-40
WP_157839288.1|3318388_3319006_+	ash family protein	NA	S5MQL6	Escherichia_phage	45.7	9.0e-10
WP_000599381.1|3319002_3319368_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	3.9e-61
WP_014639488.1|3319374_3322182_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	95.9	0.0e+00
WP_021293096.1|3322258_3323218_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	5.8e-181
WP_000211289.1|3323222_3323534_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_001289967.1|3323597_3324188_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	51.3	3.6e-32
WP_000087812.1|3324678_3325725_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_021293368.1|3325724_3327476_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_001262688.1|3327630_3328467_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.5e-119
WP_021293094.1|3328490_3329543_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	96.6	9.5e-193
WP_021293093.1|3329588_3330389_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	98.9	2.1e-139
WP_000063103.1|3330490_3330985_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864901.1|3330984_3331185_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104344.1|3331187_3331511_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	92.5	4.8e-47
WP_000836746.1|3331565_3332111_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	86.6	2.4e-91
WP_000780595.1|3332107_3332515_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.8	6.1e-63
WP_000920594.1|3332652_3333120_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356343.1|3333112_3333748_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_077631957.1|3333759_3334326_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	1.1e-99
WP_001067548.1|3334343_3334673_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_021293092.1|3334676_3335573_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	6.0e-156
WP_021293091.1|3335565_3336096_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	5.1e-94
WP_021293090.1|3336098_3338210_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	98.1	5.7e-112
WP_000885631.1|3338209_3338809_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.7	2.7e-99
WP_001100987.1|3338903_3340082_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000979954.1|3340178_3340667_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000853443.1|3340679_3343487_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	89.7	0.0e+00
WP_000333495.1|3343473_3343629_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665308.1|3343637_3344003_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|3344057_3344570_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005451.1|3344569_3345754_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.1e-224
WP_021293088.1|3345911_3347021_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	5.3e-194
WP_021293365.1|3347141_3348164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001372884.1|3348355_3348616_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|3348806_3348947_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_001173927.1|3349208_3349541_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000789404.1|3349545_3350439_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000127781.1|3351697_3352876_-	MFS transporter	NA	NA	NA	NA	NA
3350586:3350605	attR	TTTTCATCAACAAGGATTTT	NA	NA	NA	NA
WP_000817178.1|3353140_3354361_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683796.1|3354519_3356526_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP009106	Escherichia coli strain 94-3024 chromosome, complete genome	4884464	3651739	3659503	4884464	integrase,transposase	Escherichia_phage(66.67%)	6	3649527:3649540	3656640:3656653
3649527:3649540	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|3651739_3652222_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|3652964_3654194_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|3654232_3654649_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|3654720_3656469_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000577254.1|3656470_3658189_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
3656640:3656653	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_087599250.1|3658340_3659503_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 7
NZ_CP009106	Escherichia coli strain 94-3024 chromosome, complete genome	4884464	3729398	3736538	4884464		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|3729398_3731960_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|3732065_3732722_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|3732772_3733540_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3733735_3734644_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3734640_3735903_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3735899_3736538_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
NZ_CP009107	Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence	161447	59307	114314	161447	protease,transposase,integrase	Enterobacteria_phage(15.38%)	50	73924:73983	125516:126022
WP_000878014.1|59307_60327_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077629773.1|60851_61754_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618108.1|62029_62278_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
WP_021293182.1|62274_62712_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	3.2e-25
WP_000587689.1|64161_64788_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_001245884.1|64784_65087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031322317.1|65475_65727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194574.1|65726_66317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142449.1|66336_66684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000762580.1|66802_67150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283354.1|67167_69048_-	colicin	NA	NA	NA	NA	NA
WP_000448923.1|69326_69992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024199761.1|70720_72694_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000977390.1|72712_73504_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
73924:73983	attL	GTAAGCGTAAACCGACCGCCGTATGTAGCCATTAGACAAGAATTGGTAATTTAGACGCCC	NA	NA	NA	NA
WP_021293190.1|74008_74434_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	3.4e-48
WP_000624677.1|74430_74781_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_040118371.1|74811_76404_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.0	3.6e-175
WP_001278818.1|76608_77025_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000688510.1|77017_77998_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_000030199.1|78412_78721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144036.1|78807_79452_-	ParA family protein	NA	NA	NA	NA	NA
WP_000016966.1|79632_80439_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	1.2e-54
WP_021293254.1|80439_80745_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813639.1|80746_80965_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000343102.1|81560_81821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021293255.1|81817_82408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033817147.1|82425_82773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021292998.1|82901_83237_+	colicin transporter	NA	NA	NA	NA	NA
WP_000850413.1|83673_84405_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_024199652.1|85575_86553_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	64.5	7.2e-102
WP_040118372.1|87219_87450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096780417.1|87499_88728_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	1.1e-171
WP_021293003.1|88903_89398_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021293303.1|89518_90958_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_072094473.1|90961_93082_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.4	9.3e-46
WP_021293304.1|93131_96128_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_001365635.1|96129_96645_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_040118373.1|97072_97876_-	OmpA family protein	NA	NA	NA	NA	NA
WP_024199654.1|97900_102229_-	YadA-like family protein	NA	NA	NA	NA	NA
WP_040118374.1|102245_102527_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_040118375.1|103622_105179_+	L-lactate permease	NA	NA	NA	NA	NA
WP_001102093.1|105229_105949_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000054160.1|105959_107375_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_021293086.1|107379_108078_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_077787444.1|108421_108886_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	60.1	1.7e-45
WP_000203483.1|109001_109313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000264906.1|109340_109532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001379349.1|109541_109907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000855713.1|110040_110250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118376.1|110411_114314_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.5	2.5e-238
125516:126022	attR	GTAAGCGTAAACCGACCGCCGTATGTAGCCATTAGACAAGAATTGGTAATTTAGACGCCCATCTGACACAGACGGACATCTAAGTATGGAATTACAGGACTGGCGAAAAGAACCTCGTAAAAAGTATTCGAATGAATTCAAACTTCGTATGGTGGAACTGGCATCACAACCCGGAGCTTGTGTTGCACAGATTGCACGTGAAAATGGCGTCAATGATAATGTTATTTTCAAATGGCTCAGGCTCTGGCAGAACGAAGGGCGTGTTTCGCGGCGTCTTCCGGTAACGACCTCTTCTGACACTGGCATTGAATTATTACCTGTAGAGATAACGCCGGGTGAACAGAAAGAACCTGTGGCGGCCATTGCGCCGTCTTTATCCACTTCCACTCAGACCAGAGTCAGTGCCAGCTCCTGCAAGGTGGAGTTCCGTCACGGTAACATGACGCTGGAAAATCCTTCACCAGAGCTGCTCACTGTATTGATTCGTGAACTGACCGGGAGGGGAAG	NA	NA	NA	NA
>prophage 2
NZ_CP009107	Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence	161447	118560	131991	161447	transposase	Acinetobacter_phage(22.22%)	10	NA	NA
WP_021293450.1|118560_119943_-	autoagglutinating adhesin Saa	NA	A0A2C9CZB7	Yersinia_phage	34.9	1.8e-05
WP_096780418.1|120352_121514_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	6.8e-51
WP_001223214.1|122346_124434_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	32.2	6.8e-09
WP_001212725.1|124694_125117_-	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_021293190.1|125600_126026_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	3.4e-48
WP_000624677.1|126022_126373_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_040118371.1|126403_127996_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.0	3.6e-175
WP_001373081.1|128686_129112_-	subtilase AB5 cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	45.2	2.1e-26
WP_000912970.1|129128_130172_-	subtilase AB5 cytotoxin subunit A	NA	A0A1B0T6A2	Bacillus_phage	28.3	3.5e-06
WP_021293235.1|131565_131991_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	9.5e-35
