The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010089	Bacillus thuringiensis serovar galleriae strain 4G5 chromosome, complete genome	5701188	140165	207236	5701188	protease,tail,integrase,head,holin,terminase,tRNA,portal	Bacillus_phage(61.22%)	69	152341:152359	211697:211715
WP_000908523.1|140165_140738_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_000583417.1|140831_141191_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002100659.1|141347_142298_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_000390616.1|142415_143585_+	alanine racemase	NA	NA	NA	NA	NA
WP_000004570.1|143893_144181_+	antitoxin EndoAI	NA	NA	NA	NA	NA
WP_000635965.1|144185_144536_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	37.7	1.7e-13
WP_000426236.1|144603_146772_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_001143642.1|146830_146947_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_000344239.1|147142_147601_+	SprT family protein	NA	NA	NA	NA	NA
152341:152359	attL	CGAGGAGAGAATCCTAAGG	NA	NA	NA	NA
WP_000049649.1|154094_154568_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_000865756.1|154548_155241_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000367190.1|155254_155698_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000414585.1|155697_156714_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.4	1.9e-68
WP_001987845.1|157199_159179_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	2.8e-52
WP_000372699.1|159312_159942_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_001246200.1|159971_160163_-	YdiK family protein	NA	NA	NA	NA	NA
WP_000745326.1|160159_160909_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917311.1|161300_161585_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029993.1|161623_163258_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_000743906.1|163664_165203_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_021729274.1|165268_166336_-|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	100.0	1.5e-201
WP_021729275.1|166362_166803_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2MV59	Bacillus_phage	100.0	1.8e-81
WP_021729276.1|166816_167296_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVI1	Bacillus_phage	100.0	3.1e-82
WP_021729277.1|167481_167736_+	DUF739 family protein	NA	A0A0S2MVA3	Bacillus_phage	100.0	1.1e-38
WP_000383685.1|167749_167938_+	hypothetical protein	NA	A0A0S2MV91	Bacillus_phage	100.0	4.5e-29
WP_042991497.1|168162_168978_+	antirepressor	NA	A0A0S2MV65	Bacillus_phage	83.5	5.9e-126
WP_000665325.1|168990_169188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000073375.1|169601_170489_+	DnaD domain protein	NA	W8CYG5	Bacillus_phage	41.7	6.8e-43
WP_000235015.1|170427_171303_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	47.2	4.3e-66
WP_000337986.1|171318_171513_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	76.6	1.0e-20
WP_000805170.1|171538_171712_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	91.2	2.6e-23
WP_000811696.1|171726_171981_+	hypothetical protein	NA	A0A1B0T6B9	Bacillus_phage	88.1	1.4e-36
WP_002134040.1|171989_172454_+	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	35.4	4.4e-17
WP_000665841.1|172480_172693_+	hypothetical protein	NA	A0A1B0T6B5	Bacillus_phage	93.5	1.5e-25
WP_002134037.1|172737_172923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000387671.1|172974_173373_+	hypothetical protein	NA	A0A068ELY9	Bacillus_phage	79.1	2.8e-57
WP_000805074.1|173397_173820_+	hypothetical protein	NA	A0A1B1P7B4	Bacillus_phage	82.9	2.3e-65
WP_000397931.1|173995_174262_+	hypothetical protein	NA	D2XR50	Bacillus_phage	42.7	2.2e-13
WP_000404182.1|174299_174698_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	75.0	1.2e-52
WP_000365653.1|174984_175203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000234108.1|175389_175572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000525861.1|176070_176352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166182.1|176665_177148_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	1.9e-71
WP_001012113.1|177147_177690_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	92.2	1.3e-89
WP_000124642.1|178365_178626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000336221.1|178767_179172_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	75.0	2.7e-47
WP_000666403.1|179168_179504_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.9	1.0e-52
WP_000124848.1|179654_179990_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.2	2.3e-07
WP_000615714.1|179986_181645_+|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.3	1.0e-257
WP_044157418.1|181710_182817_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	89.9	2.4e-186
WP_000216402.1|182800_183577_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	2.5e-57
WP_000234863.1|183597_184761_+	hypothetical protein	NA	A0A2H4JH29	uncultured_Caudovirales_phage	96.9	1.7e-211
WP_001243199.1|184773_185070_+	hypothetical protein	NA	A0A2H4JF26	uncultured_Caudovirales_phage	87.8	1.6e-41
WP_001182260.1|185071_185446_+|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	90.3	1.1e-58
WP_000818829.1|185433_185871_+	hypothetical protein	NA	A0A2H4JBV5	uncultured_Caudovirales_phage	93.1	7.4e-75
WP_000793436.1|185867_186230_+	DUF3168 domain-containing protein	NA	A0A2H4JBW1	uncultured_Caudovirales_phage	85.0	1.4e-55
WP_001251821.1|186245_186830_+|tail	tail protein	tail	A0A2H4JET9	uncultured_Caudovirales_phage	93.3	2.9e-98
WP_015382157.1|186886_187261_+	hypothetical protein	NA	A0A2H4JBU8	uncultured_Caudovirales_phage	86.8	1.8e-53
WP_001173498.1|187425_192423_+|tail	phage tail protein	tail	A0A2H4JI37	uncultured_Caudovirales_phage	80.5	0.0e+00
WP_000093847.1|192462_193932_+|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	78.3	1.1e-231
WP_015382146.1|193928_199493_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	64.1	0.0e+00
WP_015382147.1|199509_199875_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	59.0	3.7e-35
WP_000390477.1|200001_200226_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	89.2	1.1e-26
WP_042991499.1|200301_200727_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	97.2	6.3e-71
WP_021729802.1|200726_201683_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	100.0	3.7e-188
WP_042596926.1|202084_203188_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	99.7	8.1e-195
WP_042596929.1|203367_204351_-	helix-turn-helix domain-containing protein	NA	A0A0S2MVF4	Bacillus_phage	100.0	4.6e-181
WP_000833096.1|205065_206391_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_000929880.1|206534_207236_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	9.5e-40
211697:211715	attR	CCTTAGGATTCTCTCCTCG	NA	NA	NA	NA
>prophage 2
NZ_CP010089	Bacillus thuringiensis serovar galleriae strain 4G5 chromosome, complete genome	5701188	254370	262746	5701188		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|254370_255678_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170544.1|255766_256486_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|256478_256733_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666789.1|256729_257413_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055562.1|257396_259616_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.6e-163
WP_000879025.1|259600_261016_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262439.1|261121_262162_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000088589.1|262158_262746_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 3
NZ_CP010089	Bacillus thuringiensis serovar galleriae strain 4G5 chromosome, complete genome	5701188	840564	895391	5701188	protease,tail,integrase,head,terminase,transposase,portal	Bacillus_phage(91.8%)	68	850312:850330	892757:892775
WP_001252962.1|840564_842964_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_000658667.1|843282_843624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964468.1|843645_844071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873276.1|843991_845146_-	MFS transporter	NA	NA	NA	NA	NA
WP_000645827.1|845371_846424_+	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
WP_000948209.1|846543_846888_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_087874946.1|846931_848091_-|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_000730997.1|848432_849284_+	phospholipase C	NA	NA	NA	NA	NA
WP_042991515.1|849360_850407_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	59.0	1.1e-87
850312:850330	attL	AATGATTACTCTGATCATT	NA	NA	NA	NA
WP_000262047.1|850345_851446_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	100.0	8.6e-205
WP_000466636.1|851963_853202_+	hypothetical protein	NA	I7J4K0	Bacillus_phage	100.0	8.2e-236
WP_000511082.1|853601_853946_-	helix-turn-helix transcriptional regulator	NA	I7J6V3	Bacillus_phage	100.0	4.2e-57
WP_000813892.1|854094_854331_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE0	Bacillus_phage	100.0	8.7e-38
WP_000549466.1|854363_854552_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE9	Bacillus_phage	100.0	3.2e-27
WP_015382175.1|854777_855557_+	phage regulatory protein	NA	A0A0S2GLP8	Bacillus_phage	100.0	1.6e-141
WP_000218620.1|855718_856033_+	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	100.0	1.1e-51
WP_000123128.1|856307_856955_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	100.0	1.8e-117
WP_015382176.1|857178_858195_+	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	100.0	2.8e-189
WP_002133989.1|858157_858970_+	ATP-binding protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_000436951.1|859011_859278_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_000817807.1|859349_859514_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_001025406.1|859531_859747_+	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000705118.1|859743_860043_-	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_000520932.1|860192_860447_+	hypothetical protein	NA	I7ILU4	Staphylococcus_phage	100.0	1.2e-40
WP_016090479.1|861052_861298_+	hypothetical protein	NA	A0A0S2MVC7	Bacillus_phage	100.0	8.4e-36
WP_016090480.1|861347_861572_+	hypothetical protein	NA	A0A0S2MVG0	Bacillus_phage	100.0	4.5e-36
WP_016090481.1|861613_861991_+	hypothetical protein	NA	A0A0S2MVH4	Bacillus_phage	100.0	1.1e-50
WP_016090449.1|862115_862298_+	hypothetical protein	NA	A0A0S2MVH2	Bacillus_phage	100.0	4.3e-29
WP_016049864.1|862328_862859_+	Holliday junction resolvase RecU	NA	A0A0S2MVB5	Bacillus_phage	100.0	1.2e-98
WP_016090448.1|862878_863202_+	hypothetical protein	NA	A0A0S2MV86	Bacillus_phage	100.0	3.3e-56
WP_016090447.1|863346_863847_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2MVE1	Bacillus_phage	100.0	1.2e-89
WP_016049869.1|864739_864982_+	hypothetical protein	NA	A0A0S2MVA9	Bacillus_phage	100.0	2.9e-36
WP_016049870.1|864974_865241_+	hypothetical protein	NA	A0A0S2MVC8	Bacillus_phage	100.0	2.3e-39
WP_016049871.1|865379_865622_+	DUF2829 domain-containing protein	NA	A0A0S2MV73	Bacillus_phage	100.0	8.6e-41
WP_016049872.1|865621_865885_+	DUF2829 domain-containing protein	NA	A0A0S2MVC6	Bacillus_phage	100.0	9.0e-44
WP_016049873.1|866144_866465_+	hypothetical protein	NA	A0A0S2MVH6	Bacillus_phage	100.0	4.8e-55
WP_016049874.1|866492_866876_+	hypothetical protein	NA	I7J6Y9	Bacillus_phage	100.0	2.2e-67
WP_016049845.1|866908_867238_+	hypothetical protein	NA	A0A0S2MVB8	Bacillus_phage	100.0	1.7e-52
WP_000762692.1|867224_867437_+	hypothetical protein	NA	A0A0S2MV92	Bacillus_phage	100.0	7.1e-31
WP_016049846.1|867587_868502_+|terminase	phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	100.0	2.5e-141
WP_016049847.1|868491_869766_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0S2MVC1	Bacillus_phage	100.0	2.4e-254
WP_016049848.1|869778_871212_+|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	100.0	8.5e-277
WP_016090413.1|871285_872053_+	hypothetical protein	NA	A0A0S2MVF0	Bacillus_phage	100.0	1.1e-142
WP_016049850.1|872052_872325_+	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	100.0	2.5e-49
WP_016049851.1|872404_873085_+	DUF4355 domain-containing protein	NA	A0A0S2MVA2	Bacillus_phage	100.0	9.7e-106
WP_016049852.1|873102_873945_+	hypothetical protein	NA	A0A0S2MVF8	Bacillus_phage	100.0	2.2e-155
WP_016049853.1|873995_874304_+	phage related protein gp15	NA	A0A0S2MVF2	Bacillus_phage	100.0	3.1e-51
WP_016049854.1|874300_874645_+|head,tail	head-tail adaptor protein	head,tail	A0A0S2MVD7	Bacillus_phage	100.0	6.7e-63
WP_016049855.1|874619_875027_+	HK97 gp10 family phage protein	NA	A0A0S2MVE4	Bacillus_phage	100.0	1.4e-67
WP_016049856.1|875032_875395_+	hypothetical protein	NA	A0A0S2MV90	Bacillus_phage	100.0	1.1e-63
WP_016049857.1|875409_876003_+	hypothetical protein	NA	A0A0S2MV81	Bacillus_phage	100.0	1.6e-109
WP_016049858.1|876049_876478_+	hypothetical protein	NA	A0A0S2MV94	Bacillus_phage	100.0	1.5e-72
WP_044129691.1|876582_876789_+	hypothetical protein	NA	A0A0S2MV68	Bacillus_phage	100.0	5.6e-33
WP_016049860.1|876789_879729_+|tail	phage tail tape measure protein	tail	A0A0S2MVC9	Bacillus_phage	100.0	0.0e+00
WP_016049861.1|879741_881220_+|tail	phage tail fiber protein	tail	A0A0S2MVB9	Bacillus_phage	100.0	9.9e-297
WP_016049862.1|881216_885926_+	phage minor structural protein	NA	I7ILV8	Bacillus_phage	100.0	0.0e+00
WP_016049863.1|886025_886985_+|integrase	site-specific integrase	integrase	I7IDI7	Bacillus_phage	100.0	3.6e-183
WP_000151530.1|886998_887280_+	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	100.0	9.1e-42
WP_001076454.1|887282_887495_+	hypothetical protein	NA	A0A0S2GM50	Bacillus_phage	100.0	1.4e-34
WP_000542506.1|887494_888313_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	100.0	3.2e-164
WP_000423300.1|888353_888683_-	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	100.0	2.4e-54
WP_000467327.1|888751_888973_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	100.0	2.9e-35
WP_000495118.1|889435_889756_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	100.0	1.9e-51
WP_000511371.1|889766_890933_+	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	100.0	9.4e-226
WP_000842173.1|890922_891531_+	hypothetical protein	NA	A0A0S2GLL8	Bacillus_phage	100.0	3.3e-113
WP_000730127.1|891535_892417_-	HTH domain-containing protein	NA	I7ILW0	Bacillus_phage	100.0	1.5e-159
WP_000373747.1|892914_894087_+	amino acid deaminase/aldolase	NA	NA	NA	NA	NA
892757:892775	attR	AATGATTACTCTGATCATT	NA	NA	NA	NA
WP_021727609.1|894074_895391_+	FAD-binding protein	NA	A0A2K9L0J9	Tupanvirus	22.3	1.2e-06
>prophage 4
NZ_CP010089	Bacillus thuringiensis serovar galleriae strain 4G5 chromosome, complete genome	5701188	1137803	1171924	5701188	transposase	Paenibacillus_phage(42.86%)	35	NA	NA
WP_087874946.1|1137803_1138962_+|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_087874946.1|1139024_1140184_-|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_087874946.1|1140359_1141518_+|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_003283401.1|1141571_1141784_+	DNA helicase	NA	D2XR44	Bacillus_phage	67.7	6.9e-18
WP_000384621.1|1141872_1142658_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_000348458.1|1142768_1143536_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_000776057.1|1143735_1144623_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001031767.1|1144791_1146825_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_000803241.1|1147152_1147911_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A2P9FI75	Pseudomonas_phage	37.5	2.2e-05
WP_000084624.1|1148213_1149644_+	YfcC family protein	NA	NA	NA	NA	NA
WP_000739725.1|1150029_1150575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000511932.1|1150577_1151237_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000999283.1|1151285_1151861_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001057545.1|1152002_1153478_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_001038824.1|1153609_1153810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000358637.1|1153996_1154557_+	PRK06770 family protein	NA	NA	NA	NA	NA
WP_074628568.1|1155005_1155065_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_021728256.1|1155197_1155743_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000502022.1|1156066_1156264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087942833.1|1156554_1157896_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_000968636.1|1157962_1158346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001288647.1|1158358_1159540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000728334.1|1159598_1159982_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000918604.1|1160114_1160411_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_021727880.1|1161621_1161873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021727881.1|1162132_1162696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465023.1|1163207_1163744_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_078405535.1|1163875_1164094_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_000796354.1|1164185_1164647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631593.1|1166178_1166565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001035256.1|1166660_1168043_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000516529.1|1168762_1169059_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_000446736.1|1169067_1169949_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.4	5.0e-46
WP_000540371.1|1170018_1170129_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_021729018.1|1170493_1171924_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP010089	Bacillus thuringiensis serovar galleriae strain 4G5 chromosome, complete genome	5701188	2052168	2060319	5701188		Bacillus_phage(66.67%)	7	NA	NA
WP_000755525.1|2052168_2053449_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
WP_001194306.1|2053548_2054313_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453861.1|2054553_2056314_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	2.4e-273
WP_000612414.1|2056399_2057077_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.1e-122
WP_001231621.1|2057073_2058147_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	98.0	6.1e-187
WP_000818979.1|2058436_2059156_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001258538.1|2059446_2060319_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	2.1e-65
>prophage 6
NZ_CP010089	Bacillus thuringiensis serovar galleriae strain 4G5 chromosome, complete genome	5701188	2099432	2148041	5701188	coat,protease,transposase	Bacillus_phage(44.44%)	51	NA	NA
WP_000099756.1|2099432_2100380_+|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	57.4	1.4e-94
WP_001259906.1|2100421_2100730_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000874082.1|2100836_2101772_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001082497.1|2101819_2102995_+	MFS transporter	NA	NA	NA	NA	NA
WP_001101741.1|2103043_2103250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198794.1|2103393_2103756_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000162602.1|2103955_2104180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426317.1|2104264_2104612_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_001073075.1|2105517_2106570_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_000517294.1|2106770_2108753_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.0	3.5e-23
WP_000539571.1|2108949_2109255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000965059.1|2109577_2109943_+	DUF3979 family protein	NA	NA	NA	NA	NA
WP_000370203.1|2109977_2111018_-	membrane protein	NA	NA	NA	NA	NA
WP_000105199.1|2111258_2111702_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	6.2e-45
WP_000488206.1|2111804_2112260_+	DUF3939 domain-containing protein	NA	NA	NA	NA	NA
WP_000798320.1|2112475_2113420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000594042.1|2113464_2114466_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000683357.1|2114570_2114762_-	DUF3896 family protein	NA	NA	NA	NA	NA
WP_021728399.1|2114939_2116403_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	22.1	1.7e-14
WP_001068749.1|2116487_2117072_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000376357.1|2117096_2117999_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_001040871.1|2118260_2119730_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	41.7	2.7e-68
WP_000613420.1|2119827_2120778_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001048676.1|2120890_2121361_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001126151.1|2121499_2122450_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001042736.1|2122979_2123639_+	oxidoreductase	NA	NA	NA	NA	NA
WP_001083648.1|2123668_2124706_-	NADPH dehydrogenase NamA	NA	NA	NA	NA	NA
WP_000283913.1|2124839_2125292_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.0	1.1e-25
WP_002098546.1|2125317_2126304_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000824281.1|2126388_2128050_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000943769.1|2128109_2128526_+	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	64.8	1.3e-39
WP_000858829.1|2129098_2129710_+	phosphoserine phosphatase 1	NA	NA	NA	NA	NA
WP_000817485.1|2129756_2130299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000937997.1|2130480_2131557_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_000153584.1|2131662_2132280_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_021728398.1|2132384_2132987_+	DedA family protein	NA	NA	NA	NA	NA
WP_000932389.1|2134797_2135739_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_000418716.1|2135937_2136834_+	permease	NA	NA	NA	NA	NA
WP_000488043.1|2136837_2137707_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_000141164.1|2137826_2138333_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000505094.1|2138458_2138545_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_002004934.1|2138705_2139890_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_000340535.1|2139921_2140380_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_001045960.1|2140605_2140785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861653.1|2140887_2141511_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000217338.1|2141535_2142018_-	DUF456 family protein	NA	NA	NA	NA	NA
WP_000353738.1|2142019_2143327_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000055257.1|2143535_2144405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001220524.1|2144661_2145309_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_087973070.1|2145386_2146716_+|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	75.1	2.3e-111
WP_155278149.1|2146710_2148041_-|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	75.3	2.0e-110
>prophage 7
NZ_CP010089	Bacillus thuringiensis serovar galleriae strain 4G5 chromosome, complete genome	5701188	4577977	4585663	5701188		Bacillus_phage(33.33%)	9	NA	NA
WP_000221066.1|4577977_4578901_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
WP_000609140.1|4579026_4579962_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	9.2e-22
WP_000018029.1|4579963_4580656_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	3.7e-36
WP_001014310.1|4580998_4581193_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255971.1|4581231_4582431_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	1.6e-71
WP_000587826.1|4582726_4583050_+	heme oxygenase	NA	NA	NA	NA	NA
WP_001086121.1|4583122_4583887_-	class B sortase	NA	NA	NA	NA	NA
WP_000403760.1|4583919_4584690_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	7.6e-14
WP_001036847.1|4584679_4585663_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.5e-17
>prophage 8
NZ_CP010089	Bacillus thuringiensis serovar galleriae strain 4G5 chromosome, complete genome	5701188	4933912	5021936	5701188	protease,capsid,tail,integrase,head,holin,terminase,coat,plate,tRNA,transposase,portal	Bacillus_phage(66.67%)	93	4928439:4928458	5009380:5009399
4928439:4928458	attL	TTTTGTCGGTAAATCGATAT	NA	NA	NA	NA
WP_000287147.1|4933912_4935289_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.9	5.8e-49
WP_087942833.1|4935402_4936744_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_001140612.1|4936799_4937183_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000810336.1|4937278_4938022_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_021728483.1|4938072_4938666_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002097988.1|4938711_4939599_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	7.0e-80
WP_021728482.1|4939706_4941431_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.3	2.0e-176
WP_000545253.1|4941574_4942180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000487942.1|4942354_4943839_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.9	8.7e-59
WP_000920098.1|4943998_4944625_-	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	42.1	6.1e-14
WP_000027016.1|4944711_4945029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000415321.1|4945025_4945532_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000856612.1|4945655_4946864_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000829788.1|4947325_4948315_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_021728481.1|4948427_4958426_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_021728480.1|4958896_4959376_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391942.1|4959541_4960789_+	MFS transporter	NA	NA	NA	NA	NA
WP_000535259.1|4960806_4961688_-	decarboxylase	NA	NA	NA	NA	NA
WP_000635484.1|4961767_4962229_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_000710530.1|4962551_4963379_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.5	1.8e-101
WP_031303563.1|4963388_4964009_-	hypothetical protein	NA	H0USY2	Bacillus_phage	94.2	1.6e-110
WP_021728516.1|4964528_4966469_-	maturase/reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	34.0	1.7e-22
WP_000170777.1|4967884_4968067_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.4e-22
WP_021728240.1|4968063_4968381_-	hypothetical protein	NA	H0USY0	Bacillus_phage	98.1	1.1e-51
WP_021728239.1|4968554_4968755_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	46.2	1.8e-07
WP_021728238.1|4968880_4969459_+	hypothetical protein	NA	H0USX9	Bacillus_phage	87.5	1.6e-93
WP_021728237.1|4969512_4969845_+	hypothetical protein	NA	A0A2H4J846	uncultured_Caudovirales_phage	72.7	4.1e-33
WP_021728236.1|4970374_4971076_-	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	91.1	5.3e-123
WP_021728235.1|4971075_4971501_-|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	96.5	4.1e-70
WP_021728234.1|4971550_4972726_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	73.8	5.0e-158
WP_021728233.1|4972740_4975083_-	phage endopeptidase	NA	A0A1C8E983	Bacillus_phage	93.8	0.0e+00
WP_042991580.1|4975079_4975763_-	hypothetical protein	NA	A0A1C8EA72	Bacillus_phage	98.2	3.1e-128
WP_042991581.1|4975764_4979286_-|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A1C8E982	Bacillus_phage	99.0	5.6e-290
WP_000383691.1|4979302_4979491_-	hypothetical protein	NA	A0A1B0T6A1	Bacillus_phage	100.0	1.6e-31
WP_042991582.1|4979529_4979916_-	hypothetical protein	NA	A0A1B1P7Q6	Bacillus_phage	97.7	2.3e-64
WP_000215488.1|4979927_4980563_-	hypothetical protein	NA	A0A1C8E980	Bacillus_phage	98.1	6.3e-115
WP_006929817.1|4980574_4980952_-	HK97 gp10 family phage protein	NA	A0A1B1P7P3	Bacillus_phage	98.4	1.5e-63
WP_021728173.1|4980951_4981281_-	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	94.5	1.9e-54
WP_042991583.1|4981270_4981606_-	hypothetical protein	NA	A0A1C8E986	Bacillus_phage	95.4	6.1e-53
WP_021728171.1|4981580_4981841_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	94.2	1.0e-39
WP_021728170.1|4981847_4983218_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	77.9	9.6e-153
WP_021728169.1|4983219_4983798_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	80.4	1.8e-84
WP_042991584.1|4983766_4984972_-|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	91.5	5.2e-211
WP_042991585.1|4984987_4986712_-|terminase	terminase large subunit	terminase	A0A1B0T685	Bacillus_phage	94.3	0.0e+00
WP_021727918.1|4986708_4987134_-|terminase	P27 family phage terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	94.3	2.0e-69
WP_021727917.1|4987217_4987610_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	95.4	1.4e-72
WP_021727916.1|4987606_4987921_-	phage protein	NA	A0A1B0T6C6	Bacillus_phage	91.3	3.6e-47
WP_021727915.1|4987917_4988136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052394.1|4988182_4988380_-	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	86.2	2.7e-24
WP_000930965.1|4988437_4988662_-	hypothetical protein	NA	H0USV5	Bacillus_phage	91.9	2.3e-32
WP_000895343.1|4988946_4989336_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	61.2	9.9e-39
WP_021727914.1|4989353_4989476_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_000847100.1|4989619_4989805_-	hypothetical protein	NA	Q3HKX5	Bacillus_phage	50.0	5.1e-09
WP_016099095.1|4989831_4990140_-	hypothetical protein	NA	A0A0S2MVI8	Bacillus_phage	92.9	6.6e-46
WP_000726817.1|4990365_4990764_-	hypothetical protein	NA	A0A1B0T6B6	Bacillus_phage	97.7	8.0e-68
WP_021727913.1|4990848_4991595_-	sigma-70 family RNA polymerase sigma factor	NA	Q2I8C6	Bacillus_phage	74.6	7.4e-99
WP_000002743.1|4991591_4991816_-	hypothetical protein	NA	C7DTL1	Bacillus_phage	72.6	4.0e-24
WP_021727912.1|4991815_4992697_-	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	33.3	1.1e-27
WP_021727911.1|4992708_4993482_-	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	47.4	8.3e-53
WP_021727910.1|4993613_4994495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021727909.1|4994518_4995193_-	antirepressor	NA	A0A288WFT2	Bacillus_phage	67.0	4.6e-84
WP_021727908.1|4995402_4995591_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	2.0e-21
WP_021727906.1|4995771_4995978_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021727905.1|4996135_4996477_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	33.3	1.0e-10
WP_080346158.1|4996889_4998056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237488.1|4999386_5000448_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.6	4.6e-171
WP_000833145.1|5000536_5000890_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	39.7	4.5e-14
WP_000834605.1|5001513_5002284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087942842.1|5002709_5004054_+|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
WP_000573825.1|5004136_5004490_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	3.7e-16
WP_000077397.1|5004531_5005398_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000595026.1|5005666_5005906_-	YuzB family protein	NA	NA	NA	NA	NA
WP_000682077.1|5006252_5007323_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001054089.1|5007556_5007730_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_021727534.1|5008428_5009226_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000212737.1|5009446_5009788_-	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
5009380:5009399	attR	ATATCGATTTACCGACAAAA	NA	NA	NA	NA
WP_000622258.1|5009947_5010229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003285671.1|5010298_5011096_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000607080.1|5011384_5011768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000383681.1|5011804_5012059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000843107.1|5012148_5012619_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_002101500.1|5012605_5013244_+	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_000049707.1|5013294_5013963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002101505.1|5014085_5014880_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_000248588.1|5014932_5015241_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|5015436_5015673_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_021727532.1|5015867_5016083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614218.1|5016144_5017146_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665094.1|5017266_5017758_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_021727531.1|5017781_5018261_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021727530.1|5018423_5019527_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000856300.1|5019471_5020818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000241505.1|5020823_5021936_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
>prophage 9
NZ_CP010089	Bacillus thuringiensis serovar galleriae strain 4G5 chromosome, complete genome	5701188	5030858	5077453	5701188	protease,capsid,tail,integrase,head,terminase,plate,transposase,portal	Bacillus_phage(40.48%)	59	5040093:5040109	5074373:5074389
WP_002101508.1|5030858_5031674_+|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000721050.1|5032273_5032828_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_000272747.1|5032902_5033382_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_000166372.1|5033402_5034299_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_000944665.1|5034488_5035472_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_000021802.1|5035545_5036277_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_000248466.1|5036331_5036634_-	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_071686394.1|5036699_5038091_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000446736.1|5038675_5039557_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.4	5.0e-46
WP_000516529.1|5039565_5039862_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
5040093:5040109	attL	ATAGAACCTTCCATCTC	NA	NA	NA	NA
WP_021728001.1|5040433_5041267_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	86.6	2.2e-128
WP_021728000.1|5041352_5042432_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	91.9	7.0e-183
WP_021727999.1|5042574_5042904_+	hypothetical protein	NA	A0A1C8E989	Bacillus_phage	78.9	1.2e-37
WP_042991587.1|5043084_5044137_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1C8E990	Bacillus_phage	97.7	2.0e-198
WP_021728058.1|5044426_5045707_-|plate	BppU family phage baseplate upper protein	plate	A0A1C8E978	Bacillus_phage	76.1	4.2e-187
WP_021728057.1|5045721_5048064_-	phage endopeptidase	NA	A0A1C8E983	Bacillus_phage	96.5	0.0e+00
WP_021728056.1|5048060_5048744_-	hypothetical protein	NA	A0A1C8EA72	Bacillus_phage	99.6	1.6e-129
WP_042991588.1|5048745_5052624_-|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A1B1P7P9	Bacillus_phage	70.0	2.7e-237
WP_006927278.1|5052640_5052829_-	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	98.4	8.2e-31
WP_000113340.1|5052867_5053254_-	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	99.2	3.6e-65
WP_042991589.1|5053265_5053901_-|tail	phi13 family phage major tail protein	tail	A0A1B1P7Q4	Bacillus_phage	99.5	2.5e-116
WP_021727769.1|5053912_5054290_-	HK97 gp10 family phage protein	NA	A0A1B1P7P3	Bacillus_phage	97.6	5.6e-63
WP_021727768.1|5054289_5054619_-	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	96.3	4.9e-55
WP_001126094.1|5054608_5054941_-	hypothetical protein	NA	A0A2H4JG72	uncultured_Caudovirales_phage	99.1	8.4e-55
WP_000343863.1|5054918_5055179_-	hypothetical protein	NA	A0A1B2APX3	Phage_Wrath	97.7	6.4e-42
WP_021727767.1|5055180_5056509_-|capsid	phage major capsid protein	capsid	A0A2H4JFZ3	uncultured_Caudovirales_phage	65.2	1.3e-127
WP_001140506.1|5056510_5057089_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	82.0	2.1e-85
WP_021727766.1|5057057_5058263_-|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	95.5	5.2e-219
WP_021727765.1|5058367_5060092_-|terminase	terminase large subunit	terminase	A0A1B2AQ28	Phage_Wrath	95.1	0.0e+00
WP_021727764.1|5060088_5060523_-	hypothetical protein	NA	A0A1B2APW6	Phage_Wrath	97.2	3.2e-70
WP_021727763.1|5060642_5061008_-	HNH endonuclease	NA	A0A2H4JA38	uncultured_Caudovirales_phage	63.6	6.9e-42
WP_021727762.1|5061004_5061286_-	hypothetical protein	NA	A0A1C8EAA0	Bacillus_phage	69.5	9.7e-28
WP_000460730.1|5061414_5061810_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	88.5	2.2e-57
WP_021727761.1|5061989_5062280_-	hypothetical protein	NA	A0A2H4J820	uncultured_Caudovirales_phage	76.0	4.6e-33
WP_021727760.1|5062339_5062777_-	hypothetical protein	NA	A0A2H4JBP0	uncultured_Caudovirales_phage	93.1	1.9e-70
WP_021727759.1|5062849_5063389_-	hypothetical protein	NA	A0A0S2SXQ1	Bacillus_phage	55.9	2.4e-51
WP_023901218.1|5063385_5063748_-	hypothetical protein	NA	A0A0A7RWK2	Clostridium_phage	41.6	1.5e-12
WP_021727757.1|5063750_5064179_-	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	82.4	7.3e-67
WP_021727756.1|5064166_5064406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021727755.1|5064683_5067038_-	hypothetical protein	NA	A0A1B2AQ05	Phage_Wrath	86.7	0.0e+00
WP_021727754.1|5067057_5067570_-	helix-turn-helix domain-containing protein	NA	A0A2H4JC02	uncultured_Caudovirales_phage	54.2	5.0e-06
WP_021727753.1|5067642_5068101_-	DUF669 domain-containing protein	NA	A0A1B2AQ07	Phage_Wrath	90.1	1.9e-76
WP_021727752.1|5068129_5068801_-	AAA family ATPase	NA	A0A1B2AQ06	Phage_Wrath	94.6	2.9e-118
WP_021727751.1|5068806_5068998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021727750.1|5068999_5069185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021727749.1|5069162_5069465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021727748.1|5069464_5069815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001262629.1|5069811_5070009_-	hypothetical protein	NA	A0A1B1P7L7	Bacillus_phage	100.0	5.6e-30
WP_016097904.1|5070243_5070888_-	sigma-70 family RNA polymerase sigma factor	NA	W8CYN8	Bacillus_phage	79.8	3.0e-88
WP_021727746.1|5070912_5071263_-	hypothetical protein	NA	A0A2H4JGP5	uncultured_Caudovirales_phage	81.9	8.4e-45
WP_021727745.1|5071281_5071509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021727744.1|5071509_5071737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021727743.1|5071901_5072105_-	hypothetical protein	NA	R9TQ08	Paenibacillus_phage	62.1	1.2e-16
WP_021727742.1|5072131_5072377_-	helix-turn-helix transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	70.7	2.6e-21
WP_021727741.1|5072541_5073168_+	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	61.8	1.6e-70
WP_021727740.1|5073255_5074299_+|integrase	site-specific integrase	integrase	A0A1J0MF14	Staphylococcus_phage	47.9	1.3e-93
WP_001118827.1|5074365_5075763_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
5074373:5074389	attR	ATAGAACCTTCCATCTC	NA	NA	NA	NA
WP_000009523.1|5075811_5076243_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A0K1LS29	Mycobacterium_phage	37.6	1.5e-14
WP_021727830.1|5076232_5077453_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.8	1.1e-118
>prophage 10
NZ_CP010089	Bacillus thuringiensis serovar galleriae strain 4G5 chromosome, complete genome	5701188	5158757	5244240	5701188	protease,capsid,tail,integrase,head,holin,terminase,tRNA,transposase,portal	Bacillus_phage(46.43%)	96	5203406:5203426	5244375:5244395
WP_001021098.1|5158757_5160017_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.4	9.0e-89
WP_001057102.1|5160386_5161304_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000573649.1|5161686_5162082_-	SET domain-containing protein	NA	NA	NA	NA	NA
WP_000455078.1|5162290_5163793_-	DUF4077 domain-containing protein	NA	NA	NA	NA	NA
WP_000714051.1|5163825_5164884_-	endonuclease	NA	NA	NA	NA	NA
WP_001986875.1|5165200_5165635_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000568580.1|5165631_5165988_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000980954.1|5166016_5166256_-	DUF3947 family protein	NA	NA	NA	NA	NA
WP_000792610.1|5166322_5166535_-	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_001293750.1|5166715_5167909_-	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	32.6	2.0e-42
WP_021727828.1|5167914_5169462_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.4	4.0e-54
WP_001071092.1|5169899_5170415_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000834708.1|5170557_5170962_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000635745.1|5171011_5171974_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_001036620.1|5172435_5173401_+	DUF4822 domain-containing protein	NA	NA	NA	NA	NA
WP_000576729.1|5173607_5175146_-	anthrolysin O/cereolysin O family cholesterol-dependent cytolysin	NA	NA	NA	NA	NA
WP_000590071.1|5175594_5176347_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000631245.1|5176343_5177408_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000042063.1|5177404_5178421_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.1	6.0e-59
WP_000749436.1|5178440_5179457_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000815809.1|5179784_5180462_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002101540.1|5181712_5182033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042991529.1|5182204_5183641_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000727409.1|5184037_5185180_-	toxin	NA	NA	NA	NA	NA
WP_000915084.1|5185880_5186813_+|holin	choline-binding protein A	holin	NA	NA	NA	NA
WP_001123919.1|5187620_5188088_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.2	5.4e-47
WP_000391096.1|5188214_5190641_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.6	1.7e-91
WP_000761976.1|5190783_5191524_-	carboxylesterase	NA	NA	NA	NA	NA
WP_000557264.1|5191685_5191919_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000078304.1|5192013_5192706_-	LrgB family protein	NA	NA	NA	NA	NA
WP_000673222.1|5192702_5193071_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_001125064.1|5193423_5194374_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000103951.1|5194425_5195721_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	75.4	1.1e-182
WP_001231158.1|5195751_5197281_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001231038.1|5197277_5198033_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001036350.1|5198065_5199250_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000161236.1|5199389_5200394_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001258185.1|5200420_5201449_-	gapA transcriptional regulator CggR	NA	NA	NA	NA	NA
WP_000869730.1|5201584_5201830_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_000647955.1|5201839_5203147_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
5203406:5203426	attL	CGCGCCCAGAGGGATTCGAAC	NA	NA	NA	NA
WP_042991590.1|5203709_5204537_+	cytosolic protein	NA	A0A1C8EA76	Bacillus_phage	92.0	5.2e-138
WP_042991591.1|5204553_5204844_-	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	91.8	4.2e-42
WP_001016121.1|5204868_5205087_-	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	93.1	7.3e-31
WP_000742864.1|5205230_5205797_+	hypothetical protein	NA	A6XML2	Bacillus_virus	45.7	4.8e-26
WP_000734384.1|5205975_5206194_-	hypothetical protein	NA	A0A2H4JBB8	uncultured_Caudovirales_phage	73.8	1.7e-16
WP_000993515.1|5206193_5207309_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	54.9	4.0e-109
WP_000405783.1|5207512_5208448_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	82.3	1.8e-155
WP_000532576.1|5208447_5208873_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	97.9	8.3e-71
WP_000499524.1|5209167_5210361_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	1.2e-23
WP_015382502.1|5210870_5215253_-	phage minor structural protein	NA	A0A0S2MVB4	Bacillus_phage	58.4	0.0e+00
WP_015382503.1|5215249_5216719_-	hypothetical protein	NA	A0A0S2MV63	Bacillus_phage	80.2	2.6e-236
WP_002133928.1|5216760_5219142_-	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	44.1	3.7e-43
WP_000897021.1|5219419_5220655_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	73.1	3.6e-151
WP_000415931.1|5220885_5221248_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	71.7	1.4e-42
WP_001004920.1|5221254_5221848_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	91.8	3.7e-101
WP_000219080.1|5221848_5222184_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	94.5	3.2e-54
WP_000997537.1|5222180_5222525_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	80.5	1.7e-45
WP_001247297.1|5222526_5222877_-|head	phage head closure protein	head	D2XR20	Bacillus_phage	87.9	3.7e-53
WP_000361981.1|5222878_5223172_-	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	76.3	2.7e-36
WP_000245092.1|5223184_5224351_-|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	77.7	9.6e-162
WP_000791073.1|5224377_5225103_-|protease	Clp protease ClpP	protease	A0A2H4J8Y7	uncultured_Caudovirales_phage	53.2	1.7e-44
WP_000118683.1|5225092_5226244_-|portal	phage portal protein	portal	A8AT96	Listeria_phage	51.1	1.8e-104
WP_000595321.1|5226264_5227950_-|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	85.7	5.5e-275
WP_000301150.1|5227946_5228258_-|terminase	terminase	terminase	D2XR14	Bacillus_phage	86.3	4.7e-39
WP_000666398.1|5228382_5228718_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.0	1.6e-53
WP_001177571.1|5228683_5229058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000378699.1|5229048_5229306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001177575.1|5229312_5229522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002014.1|5229590_5230025_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	61.5	9.8e-19
WP_000343502.1|5230030_5230234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000650576.1|5230247_5230472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071686389.1|5230651_5230834_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	64.9	3.9e-14
WP_000711194.1|5230885_5231305_+	HicB family protein	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	4.5e-61
WP_015382504.1|5231688_5232090_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	98.5	1.4e-67
WP_015670520.1|5232127_5232454_-	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	98.1	4.7e-58
WP_000540086.1|5232450_5232978_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	97.7	4.1e-96
WP_000590881.1|5233013_5233325_-	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	84.5	1.0e-41
WP_000858114.1|5233369_5234065_-	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	81.5	3.2e-112
WP_000520932.1|5234100_5234355_-	hypothetical protein	NA	I7ILU4	Staphylococcus_phage	100.0	1.2e-40
WP_001268031.1|5235377_5235668_-	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	93.8	2.5e-50
WP_000775809.1|5235726_5236161_-	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	89.6	2.2e-71
WP_001245738.1|5236199_5236757_-	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	70.8	2.0e-64
WP_000139235.1|5236780_5237011_-	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_000933908.1|5237003_5237483_-	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	97.5	4.3e-84
WP_000510889.1|5237494_5238448_-	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.2	8.4e-148
WP_002133909.1|5238541_5238883_-	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	97.3	9.9e-51
WP_000355713.1|5238812_5239028_-	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	98.6	1.1e-31
WP_015382506.1|5239027_5239741_-	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	98.3	1.4e-126
WP_000453495.1|5239758_5240202_-	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	90.5	9.8e-67
WP_001187283.1|5240228_5240417_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	62.9	2.6e-13
WP_001016247.1|5240428_5241184_-	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	83.4	1.9e-110
WP_000410023.1|5241538_5241772_-	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	43.5	5.6e-05
WP_000216290.1|5241807_5242038_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002133807.1|5242202_5242595_+	helix-turn-helix transcriptional regulator	NA	A0A1Q1PVX8	Staphylococcus_phage	58.5	3.2e-13
WP_001037137.1|5242605_5243073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021727786.1|5243103_5244240_+|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	47.7	1.5e-95
5244375:5244395	attR	CGCGCCCAGAGGGATTCGAAC	NA	NA	NA	NA
>prophage 1
NZ_CP010092	Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB126, complete sequence	126898	82516	119398	126898	transposase,integrase	Lactococcus_phage(55.56%)	29	84106:84165	106757:108938
WP_021728073.1|82516_83746_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	1.0e-84
84106:84165	attL	TGTAAATGTCAAGATAAACATGTACATTTTCGCTTGTTTAAGCATGTACAAAATCAATCA	NA	NA	NA	NA
WP_000798699.1|84158_84911_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|84900_86196_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000876891.1|87801_88353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000217374.1|88433_88748_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003272553.1|88939_89206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038273.1|89233_89416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856972.1|89565_90210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000433841.1|90319_91018_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000438659.1|91806_93339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000137768.1|94022_94376_+	hypothetical protein	NA	A0A1B1P774	Bacillus_phage	84.6	2.0e-54
WP_000291036.1|94445_94811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165986.1|95214_95508_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001200537.1|95523_95943_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000230190.1|96168_97440_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_000072992.1|97500_98067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000412868.1|98472_98892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681129.1|99823_100204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003272683.1|100200_102114_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000169371.1|103068_104376_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.0	1.3e-26
WP_001100112.1|104549_104729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000240401.1|106045_106264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000798699.1|106809_107562_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|107551_108847_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_031303061.1|109383_109635_+	hypothetical protein	NA	NA	NA	NA	NA
106757:108938	attR	TGTAAATGTCAAGATAAACATGTACATTTTCGCTTGTTTAAGCATGTACAAAATCAATCATTTTCTTTGCTAAAATGATCTTTAATTCGATAGGATTGTCCTACAATACTGACCACCGTGGCATGATGTAAGACACGATCTAGTATGGCATTGGCGAGTTTAGGGTCCTGGAATACTTCGTCCCAAGACTTGAAGTTGATATTGGTCGTTAGGATGGTACTACGCTTTTCATAACGCATATCGATTAATTGAAAGAATAATTTTGCATCCTCCGGATCAATAGGCAAGTACCCAATTTCATCAATAATAAGTAATTTGTATTTTGTATAGTGCTTTAAACGAGATTCTAGGCGATTCTCAATCTTGGCACGTTTTAAATTTTGAAGTAAATCATGACATTTAATAAAATAAGTACTTGTTCGCTTTTTAGCTGCTGCTATACCAATAGACGTGGCCAAATGGGTCTTACCAACACCACTAGGTCCTAAAAATACTATGTTTTCTTGTTGCTCTAAGAAACGTAGAGAAATAAAATCTAAGATTTGTTGTTTATTAATACTCGGCTGGAATTCGAAATCAAACTCATCAACCTCCTTTCTATGAGGAAATGCGCCCATTTTCACCATAGAATGAATCATATTTTGTTCTCGTACATCAATCTCATAGTTTGTCAGTTTAACAAGTGTCTCTACGAAGGATAATTCATTATTAATGCTAAAATCGACTACGTCACCTAAATGTTGTGCCATTTGTTTTAATTTTAAATACTCTAGGTTTGTTGTTAATTGTTGATAGCTATTCTTCATTTCTATATACCTCACCAATTACTGATAAATTTTGTTTCGCCAAATTGTCAATGTTCGGATATTTAGGTAGTGACTTAGCCAATGCTTTTTTATAATGTTCTTCTTTATAATTGAGCTTAGATTGGCTGATTTTATGTTGTACAATTAACTTCATGTTATGATAAACATATATTTGATTATCATATACTTGTAAACCGACGGTTTTACCTTGATATTCAGCTGGAACTGAGTATTGATTCGATTTGTAAGATATCATGCCTGATGTATTAACTTTTACAAGTTTATGCTTAATCATATAGGAATCTCTTATCGCGCTCTTCGGGAGTGGTTGTAGGAGATTCTTTTCCTGTTTTAGGGCAAACACTGGAATCTTACCAGTCCCTTGATGAAATGTTTGATTAATTCTTGCACATAATTTTTGCACAAATTCATGTAATTCTTCAAAAGTGAATCTTCCTTGATAAGCATGAATTTCGTCTAGAAGTTTCATTGGCGCTTCTACTTTCCCTTTGGTATTTGGTCGCCCTGCGATACAAGGTTGTACCTTAAATCCAAAATCTTGAGCGAATTGGGCAAACTTATTGTTAATCGTTCCTGTAAAGTGTTCTGTTCGAGCTTCATCCATTACCGTCTTCATATTATCCGTGACAATTACCTTCGGTACACCACCAAACATTTCAAATGCCTCTGTCATAAATGACATTAAAACACTTTGTGATTTTGAAATATTCAAATGAAAAACTTTAAATCTCGAGTAGGACAATAAAAGTACAGCTACATTCACATATACGATTTCGCCACTTTTGGTTTCAAATCGTATGCTTTCTTTCCAATCTAATTGAGCTTGTTCTCCTGGAGGTGTCTCATAACGGACACCCACTGAATGACCTGATAAAATACGCTTCCCCTCATCAAAATATGTTCTAAATTCAGGCTTTCTATTAATATAAGCACGAAATGCAGACTGTGAACATTTTAAACCGTGATTGTCTGTTAGATACTGCCATAACACTCGTTTGTAGTAGAAGATTTGTTTAGAATCACTAGATAAAAGAGCTGCAATCACTTCATAATATGTATCGATTTTCGATGTTTTATTTTTTGTCCCTTTTGGTGTAAAACCATTCAAATACTTATCTATGGTACGCCGATCCACATTCAATTCTCTGGCTAATTGACTTTTATTTATCTTCATTTTTAAGTTCCCCATTAGTTTTTTAAAATTTGGTAAGTCTGAAAGACTTTTAACCTCAAATTCTGTTTGAATATCTAGCTTAATATACATACTAACCACCTCAGAGTCAGTATGGAGAATCCAATTGAAAATGTACATATTTATTCAAGCGTTAATGTACATATTTAAGTTAGCATTTATA	NA	NA	NA	NA
WP_000369821.1|110258_113795_-	pesticidal crystal protein cry1Ac	NA	NA	NA	NA	NA
WP_016097379.1|114084_115041_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	39.8	1.4e-49
WP_001053956.1|116458_117895_+|transposase	IS4-like element IS231B family transposase	transposase	NA	NA	NA	NA
WP_000275580.1|118102_119398_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
>prophage 1
NZ_CP010091	Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB267, complete sequence	267359	119776	204242	267359	transposase,integrase	Pseudomonas_phage(23.08%)	60	112736:112795	163164:165805
112736:112795	attL	AAAGTGCGCCCATAAGGGCCTTGTAAACTCTGATTTAGTAAATCAGCGGGTGAAGTGAAA	NA	NA	NA	NA
WP_000041871.1|119776_120724_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000520262.1|121950_123660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000372779.1|124346_125816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000372481.1|125851_127576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000459233.1|127957_128767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000724860.1|130564_130957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000610947.1|131049_131832_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000373088.1|131846_132764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000335059.1|133173_134976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728789.1|136069_138499_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_003319726.1|138673_139393_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_021728790.1|139393_141313_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_000853368.1|141315_142176_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_130055909.1|142466_142631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071686409.1|142682_142916_+	CRISPR-associated protein Csd2	NA	NA	NA	NA	NA
WP_000710696.1|145375_145801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001219637.1|146064_147156_+	methyltransferase	NA	NA	NA	NA	NA
WP_000114815.1|147171_147399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654328.1|149125_150991_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.9	2.4e-37
WP_023901368.1|151265_153671_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_000494364.1|153687_154401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728513.1|154737_155367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728512.1|155366_156002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023901906.1|156052_156667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021728510.1|156650_157235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048549447.1|157360_157744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728509.1|157760_158399_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	35.1	2.8e-22
WP_021728508.1|158763_159957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023901905.1|160330_161296_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.8	2.0e-19
WP_021728505.1|161309_162062_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.6	7.8e-40
WP_023901371.1|162069_163221_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021728516.1|163746_165687_+	maturase/reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	29.0	5.2e-27
WP_131256230.1|165894_166377_+	hypothetical protein	NA	NA	NA	NA	NA
163164:165805	attR	AAAGTGCGCCCATAAGGGCCTTGTAAACTCTGATTTAGTAAATCAGCGGGTGAAGTGAAACAAGATAACAACCCGACACCGGTAGCCTTATCCGTAATCGAAAGTGAGCGGGGAGTGTAGCATGGCTGCAACGGGATAAGTCACTCTAATGTCATGAGTGCGACTGAATTTCTAGGTGTACCGTGGTAAACAAGGTTGAATGCTAAACTGCGTGAAGGATAAATCAAGGGGTCTTATCGACGACCATATCGAAATAGACATTGAAACGATATGTCTCTAGTTCAGCTCATCTATTTTTTGTGGAGAGAGGTGTGTTTCACACTAGAGAACCAACTAAAGTACATTAGTAAAGATTGAAAGTCCCAACCGACATTACTACAAACTATTTACAAGGTACTAAATGGGGATTACCTAAGTGGAAGCGCCATTTATGGCTATAGAGGATGATTTCAAGGTAAAAACCAAGAAATGTGGCTCTTGAATATTCCATATGGTAACGGAGCCTTCGTAGTAGTCAGAGATAGGGAAAGCCTATCACACTAACGTATGACAAATTACGTTAGGTCATGGTTGTGAAATCAGGATGGCGAAGGAAGGTAGTCAATTAGTTCATGATGATAATAAACAGGAAGGAAGCGAGATGCTGATGAGAAATCCAGTTTATGTATTGAACACCTTGTCGAAGAATACTATTAAAGAAAACTATAAGTTCAAAAGATTATATAGAAATCTTTATAATCCAGAATTCTACTATAAAGGTTATCAAGAAATATATGCCAATCCAGGTAATATGACCAGAGGAACCATAAATAAAACTGTTGATGGCTTCTCAAAAAATAGAGTATCTAAAATCATCAACAACATTAAAAATGGTAACTATAAACCTACTCCTGTTAAGCGAGTATATATTGATAAAAAAGGGAGTAAGAAAAAACGTCCTCTTGGGGTACCGACATTTGACGATAAACTTGTCCAATTAGTAATAAAGTATATCTTAGAAGCAATTTATGAACCAAACTTCTCTGAGAACTCACATGGATTCAGGAAAAATAGGGGTTGTCATACAGCTTTGAAACAAATTAAAAAGAGTGGTAATGGAACTAAATGGTTTATTGAAGGTGATATTCAAGGTTTCTTTGACAATATCGACCACCATATCCTAATTAACCTACTAAGAAAACGTATCAATGACGAAACACTCATCGGATTAATATGGAAGTTCCTAAGAGCTGGGTACATGGAGGATTGGCAATTCCACAAAACATTCAGTGGAACACCACAAGGAGGGATTCTCAGTCCTCTTCTTGCCAACATATATCTAAACGAACTAGATATATACATGGAAAAATACGCTGAAAAGTTCGGAAAAGGTCAACCAAAAGACAGAGAAGTTGATAAAAGATATCAATACTTACACCTCAAAATAAAAAGAGGGCGTAAGAAAGCAGACTTACTAAGAGAACAAGGTAAACACAATGAAGCTCAGGAATTAATCGAGCAAGTCAACGAATGGGTTAAGGAAAGGGGACAACGTCCCTACTACAATCCAATGTCGGATAAATTTAAGTCACTAAAATATGTTAGATATGCTGATGACTTTATTGTAATGATAATCGGCAGTAAAGATGATGCCAAAGCCATTAAATCTGATATAGCTCAATTTCTCAATGAAGAATTAAAATTAACTTTATCAGAAGAAAAAACACTTATCACCCACTCTAGCAAGAAAGCAACATTTCTTGGGTACAACGTCAATATCACTAGAAACGAGTTATTTACCAAATACTCGGTGAAAGGTGCAAAAAGAAGACATCACAATCTAAAAGTAAGACTTGAAATCCCCCATGAAACATGGCGAAATAAATTACTTGCCCTGAATGTTTTAGAAATGAAGTATGTGAATGGGAAAGAAACTTGGAAACCAAAGCATAGACCGGAAATGGCACACCTAGATGATTTGGAAATACTACATAATTATGTATTACAGATCAGAGGGATGTACAACTACTACAAATATGCAGTTAATTCAACGGTACTCCAAAAATTCAGTTACGTTCTAGAATACAGCATGTATAAAACATTCGCCAATAAATATAAAAGCTCAATCGGAAAAATTAAGGGGAAATATTGCAAAAACGGTGTATTCATAGTCAATTACAAAGATAAAAAAGGCAAACAACACTCTCATTCTTTCTACAGGGAAGGATTTAGAACGGTTGATATAACTAAGATGAAAACACAAGAAAATAACATCGACAACTTGTTAGCCTCAAGAGTTCATATGTCAACAACTAGTCTTATGGATAGGTTGTCAGCCAACAAATGTGAACATTGTGGTAAAACCGATTCTAACTTAGTAATGCACCATGTCCGAAAAATGAAAGATGTTGAGAAAGGCAAAGCCAAATGGCAAAAATTAATGATTGCCCGTAGACGCAAAACATTAGCCGTATGTGAGGATTGCCATAATGAAATTCACTATGATATGAGAGTAGAACTTATAGCGAAAAACAGAAAAAAATAACTTTGACAAGCAATTGATGGAGAGCCGTATACTCTGAGAGGAGTACGTACGGTTCGGTGAGGGGTTTTGAGAAACCTATCATAGCAATATGACAAGGCGCTCGCTTCCTACTCTACAA	NA	NA	NA	NA
WP_085959128.1|166410_167765_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	85.5	7.3e-129
WP_021728447.1|167805_168639_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021728448.1|168816_169377_-	recombinase family protein	NA	A0A219YB42	Aeromonas_phage	41.0	6.0e-29
WP_021728449.1|169997_172814_+	S-layer protein	NA	NA	NA	NA	NA
WP_021728450.1|172869_173193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728451.1|173287_174190_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_021728452.1|174643_174964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728453.1|175032_175635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042991674.1|176319_177441_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.2	1.5e-172
WP_021728471.1|178159_178804_+	thermonuclease family protein	NA	A0A2P1JU10	Anoxybacillus_phage	33.6	1.3e-06
WP_021728470.1|178863_179064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728469.1|179139_179376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728468.1|180161_182069_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.7e-28
WP_021728467.1|182290_183046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728466.1|183079_183517_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_021728465.1|183590_183884_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021728464.1|184073_185165_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	45.8	1.6e-89
WP_031303369.1|185479_185797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728460.1|186215_186722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042991675.1|188249_188552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021728496.1|191553_192369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071699974.1|192549_192678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087973166.1|192961_194523_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	57.6	1.8e-67
WP_021728501.1|196565_196862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000701098.1|200346_201420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369347.1|201531_202443_+	DMT family transporter	NA	NA	NA	NA	NA
WP_033679397.1|203120_204242_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.4	1.9e-170
>prophage 1
NZ_CP010090	Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB426, complete sequence	426282	153	107925	426282	transposase,integrase	Tupanvirus(23.81%)	59	605:619	27328:27342
WP_000861877.1|153_1272_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2MV79	Bacillus_phage	25.0	3.2e-05
605:619	attL	CCTTTAAGAATAAAA	NA	NA	NA	NA
WP_003272683.1|1364_3278_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000681129.1|3274_3655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728614.1|3820_4180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728615.1|4549_5113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728616.1|6652_8077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021728617.1|9853_19864_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	35.2	7.9e-63
WP_021728618.1|19890_25614_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.5	1.2e-169
WP_021728619.1|25930_28582_+	plipastatin synthetase	NA	NA	NA	NA	NA
27328:27342	attR	TTTTATTCTTAAAGG	NA	NA	NA	NA
WP_000368639.1|28614_28878_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_021728620.1|28874_30023_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000638851.1|30019_31147_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001028177.1|31166_32384_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_000473347.1|32424_33273_+	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001152970.1|33303_33549_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_016090574.1|33548_34742_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_002099041.1|34738_36316_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	32.1	5.8e-69
WP_021728621.1|36290_43979_+	hybrid non-ribosomal peptide synthetase/type I polyketide synthase	NA	A0A2K9KZV5	Tupanvirus	26.2	4.6e-95
WP_000608549.1|43997_45074_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021728622.1|45089_48173_+	cyclic peptide export ABC transporter	NA	A0A2P1JQM9	Mycobacterium_phage	28.5	2.8e-11
WP_000031545.1|48169_49249_+	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_021728623.1|49230_53727_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.6	5.0e-81
WP_021728624.1|53770_54502_+	thioesterase	NA	NA	NA	NA	NA
WP_021728625.1|54743_61280_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.7	3.1e-185
WP_021728626.1|61528_62227_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_001007708.1|63015_63948_+	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	27.8	2.7e-18
WP_000914207.1|64068_65046_+	2,3-diaminopropionate biosynthesis protein SbnA	NA	C3U2M1	Lactococcus_phage	28.9	3.8e-26
WP_021728937.1|65073_66042_+	2,3-diaminopropionate biosynthesis protein SbnB	NA	NA	NA	NA	NA
WP_001289608.1|66173_66947_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000947505.1|67086_67338_+	DUF2164 family protein	NA	NA	NA	NA	NA
WP_016090584.1|67944_68112_+	type A2 lantipeptide	NA	NA	NA	NA	NA
WP_021728628.1|68203_71032_+	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
WP_016090586.1|71046_73149_+	ATP-binding cassette domain-containing protein	NA	A0A076FI99	Aureococcus_anophage	23.1	5.4e-14
WP_021728629.1|73221_74130_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	42.7	1.4e-43
WP_021728630.1|74129_74855_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_021728631.1|74870_75569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728632.1|75817_76492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021728634.1|77281_77440_-	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_021728635.1|77439_78540_-	transcriptional regulator	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	44.2	1.2e-81
WP_021728636.1|78766_79063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021728638.1|80442_80835_-	thiol-disulfide oxidoreductase DCC family protein	NA	NA	NA	NA	NA
WP_042991616.1|81277_82366_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	77.7	1.7e-160
WP_021728307.1|83944_85603_-	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_031303240.1|86855_88457_+	SH3 domain-containing protein	NA	A0A1J0MS59	Bacillus_phage	54.3	4.2e-43
WP_042991618.1|89456_89858_+|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	69.7	4.2e-48
WP_042991619.1|89863_90943_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0A8WI33	Clostridium_phage	31.8	6.4e-19
WP_021728276.1|91400_92327_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_021728275.1|93672_94305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728274.1|94301_94937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728273.1|95399_95783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728272.1|95799_96438_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	35.6	9.6e-23
WP_016090597.1|96729_97473_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000906771.1|99866_100514_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_021728268.1|100503_101370_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	2.7e-20
WP_000706800.1|101366_101750_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033679607.1|102804_104193_+	radical SAM/SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_021728754.1|104396_106106_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	30.1	6.0e-19
WP_021728755.1|106140_106428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087942833.1|106582_107925_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
>prophage 2
NZ_CP010090	Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB426, complete sequence	426282	153527	270649	426282	holin,tail,protease,terminase,portal,transposase,head,integrase	Bacillus_phage(47.27%)	99	213068:213084	251264:251280
WP_076612201.1|153527_154316_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.5	1.0e-26
WP_021728246.1|154282_154483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021728245.1|155405_155936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042991627.1|156311_159809_-	pesticidal crystal protein cry1Da	NA	NA	NA	NA	NA
WP_031303311.1|162993_163245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000889412.1|163570_163993_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	77.4	9.1e-54
WP_021728800.1|165893_166298_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_042991628.1|167008_168058_+	Fic family protein	NA	NA	NA	NA	NA
WP_021728278.1|168315_169158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021728284.1|175927_176608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728285.1|176628_176901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042991629.1|178225_178678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044129470.1|179238_179586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140161410.1|179534_179744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021728289.1|179993_180230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021728290.1|180679_181174_+	DUF3902 family protein	NA	NA	NA	NA	NA
WP_021728291.1|181383_182700_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_021728292.1|183013_183823_-	YitT family protein	NA	NA	NA	NA	NA
WP_021728293.1|184223_185099_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021728294.1|186096_186279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023901704.1|186743_187256_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000798699.1|187377_188130_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|188119_189415_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_021728067.1|189929_191207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021728516.1|191852_193793_-	maturase/reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	29.0	5.2e-27
WP_021727891.1|195039_195384_-	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	32.6	2.0e-06
WP_021727892.1|195822_196968_+	hypothetical protein	NA	H0UST6	Bacillus_phage	31.4	1.8e-56
WP_023901278.1|196969_197104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021727893.1|197246_197429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016125848.1|197425_197782_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	39.6	5.0e-13
WP_000935436.1|197949_198144_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	45.2	1.2e-05
WP_000284333.1|198252_198453_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021727896.1|198885_199737_+	hypothetical protein	NA	V5UQV4	Oenococcus_phage	37.8	5.9e-36
WP_021727897.1|199751_200666_+	AAA family ATPase	NA	A0A0U3U1U1	Bacillus_phage	97.7	2.4e-168
WP_021727623.1|200678_200873_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	90.6	3.3e-27
WP_042991630.1|200889_201168_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	61.0	1.3e-13
WP_023522897.1|201160_201520_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	52.5	3.2e-31
WP_000717826.1|201538_201706_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.4e-13
WP_042991632.1|201731_201983_+	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	50.0	2.6e-16
WP_021728086.1|202002_202458_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	48.6	6.4e-21
WP_016090376.1|202628_203036_+	hypothetical protein	NA	A0A0S2MVF6	Bacillus_phage	100.0	6.9e-75
WP_021727817.1|203394_203727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023901329.1|203760_204072_+	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	85.4	1.2e-42
WP_000540090.1|204107_204635_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	97.1	9.2e-96
WP_021727815.1|204631_204958_+	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	98.1	6.1e-58
WP_003308641.1|204995_205397_+	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	99.2	1.1e-67
WP_000711195.1|205779_206199_-	HicB family protein	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.1	1.7e-60
WP_071686481.1|206250_206433_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	67.2	9.4e-16
WP_021727814.1|206610_206832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023901328.1|206844_207279_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	59.4	3.1e-17
WP_016099128.1|207346_207556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021727812.1|207562_207820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001177569.1|207810_208185_+	hypothetical protein	NA	A0A2H4J3C8	uncultured_Caudovirales_phage	39.1	7.4e-07
WP_021727811.1|208150_208486_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.0	1.4e-52
WP_000763337.1|208638_208995_+	hypothetical protein	NA	A0A2H4JBV9	uncultured_Caudovirales_phage	99.2	1.4e-58
WP_021727810.1|208991_210647_+|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	96.2	0.0e+00
WP_044129476.1|210712_211819_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	89.0	7.7e-185
WP_021727808.1|211802_212579_+|protease	Clp protease ClpP	protease	R9TLM7	Paenibacillus_phage	52.8	2.5e-57
WP_021727807.1|212598_213762_+	hypothetical protein	NA	A0A2H4JH29	uncultured_Caudovirales_phage	95.1	1.5e-207
213068:213084	attL	AAGAAAAGATTGGCCAA	NA	NA	NA	NA
WP_021727806.1|213774_214071_+	hypothetical protein	NA	D2XR19	Bacillus_phage	91.7	1.0e-43
WP_021727805.1|214072_214426_+|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	95.7	3.0e-58
WP_023901327.1|214427_214772_+	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	79.6	1.7e-45
WP_021727803.1|214768_215098_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	94.5	1.6e-53
WP_021727802.1|215098_215692_+	hypothetical protein	NA	A0A2H4JDV4	uncultured_Caudovirales_phage	91.3	1.8e-100
WP_021727801.1|215698_216061_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	3.1e-42
WP_021727800.1|216291_217527_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	72.8	2.3e-150
WP_021729404.1|217804_220186_+	prophage LambdaBa01, membrane protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	52.6	1.5e-39
WP_021727798.1|220227_221697_+|tail	phage tail fiber protein	tail	A0A0S2MV63	Bacillus_phage	78.3	3.9e-229
WP_021727797.1|221693_227234_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	57.5	0.0e+00
WP_021727796.1|227249_227624_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	94.4	3.9e-64
WP_042991634.1|227661_228060_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	100.0	6.3e-65
WP_000861877.1|228198_229317_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2MV79	Bacillus_phage	25.0	3.2e-05
WP_003272683.1|229409_231323_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000681129.1|231319_231700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031303061.1|232116_232368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021727887.1|233005_233629_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	1.3e-11
WP_021729420.1|233880_236952_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	22.0	4.3e-44
WP_000681129.1|237067_237448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003272683.1|237444_239358_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000861877.1|239450_240569_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2MV79	Bacillus_phage	25.0	3.2e-05
WP_021728613.1|240981_241530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021728612.1|241809_242163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021728611.1|242178_242415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021728610.1|250580_251507_+	aldo/keto reductase	NA	NA	NA	NA	NA
251264:251280	attR	AAGAAAAGATTGGCCAA	NA	NA	NA	NA
WP_021728609.1|251991_253644_+	aspartate aminotransferase family protein	NA	M1HWX9	Paramecium_bursaria_Chlorella_virus	30.5	4.7e-05
WP_021728608.1|253747_254392_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021729712.1|255237_255648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021728607.1|255774_255993_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021728606.1|256138_256465_+	helix-turn-helix transcriptional regulator	NA	X5JA02	Clostridium_phage	40.0	2.5e-11
WP_021728605.1|257161_257728_-	acyltransferase	NA	NA	NA	NA	NA
WP_021728604.1|257720_258851_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_021728603.1|258870_261429_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	1.5e-10
WP_021728602.1|261601_262393_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_021728601.1|263013_263226_-	hypothetical protein	NA	A0A1Z1LZP5	Bacillus_phage	65.7	2.0e-17
WP_021728600.1|263770_264439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021727480.1|265299_266022_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	42.9	2.3e-36
WP_021727481.1|266018_267521_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	24.2	1.4e-08
WP_021728824.1|268371_269112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087942842.1|269303_270649_-|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
>prophage 3
NZ_CP010090	Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB426, complete sequence	426282	296227	304483	426282		Bacillus_phage(100.0%)	11	NA	NA
WP_021728082.1|296227_297283_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6C8	Bacillus_phage	70.7	1.2e-150
WP_000570185.1|297279_297519_-	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	75.9	2.7e-26
WP_021728083.1|297518_297755_-	XpaF1 protein	NA	A0A288WG97	Bacillus_phage	88.9	6.1e-15
WP_042991635.1|298446_299331_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	52.7	6.5e-78
WP_042991636.1|299603_300425_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	43.8	2.0e-28
WP_042991637.1|300566_301535_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	42.3	3.5e-32
WP_000460733.1|301772_302159_-	hypothetical protein	NA	A0A288WG73	Bacillus_phage	69.8	2.6e-47
WP_021728781.1|302261_303158_-	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	62.5	3.3e-77
WP_021728780.1|303230_303467_-	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	60.0	9.7e-13
WP_000579788.1|303603_304032_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	51.4	9.3e-30
WP_000673778.1|304054_304483_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	55.1	7.3e-35
>prophage 4
NZ_CP010090	Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB426, complete sequence	426282	317910	371884	426282	transposase,protease	Pseudomonas_phage(29.41%)	35	NA	NA
WP_042991619.1|317910_318990_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0A8WI33	Clostridium_phage	31.8	6.4e-19
WP_042991618.1|318995_319397_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	69.7	4.2e-48
WP_021727989.1|319694_320618_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_021727990.1|321054_321801_-	AAA family ATPase	NA	A0A2H4J4U1	uncultured_Caudovirales_phage	39.8	1.3e-34
WP_021727991.1|322268_322652_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_021727992.1|323006_324005_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_087942833.1|324124_325466_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_021728814.1|325586_325802_-|protease	neutral protease (bacillolysin)	protease	NA	NA	NA	NA
WP_001100598.1|326100_327195_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	46.6	2.5e-87
WP_021728813.1|327191_327320_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_000733519.1|328052_328469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167047.1|328541_328757_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	68.7	3.7e-19
WP_021728516.1|329699_331640_-	maturase/reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	29.0	5.2e-27
WP_000787540.1|335391_335805_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000577229.1|335794_336202_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_021728140.1|337966_338314_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	37.0	3.5e-11
WP_021728139.1|338524_340174_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	24.1	2.0e-08
WP_000237072.1|340528_340996_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016090252.1|341157_342855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042991640.1|344455_346165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021728808.1|348051_348420_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_021728809.1|349784_350552_-	hypothetical protein	NA	I3VYV9	Thermoanaerobacterium_phage	27.9	5.0e-10
WP_087942833.1|350762_352105_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_021727959.1|352218_352503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042991642.1|353332_353620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042991644.1|353835_354768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000228955.1|354771_355755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042991646.1|357687_359562_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.9	6.9e-37
WP_021728010.1|360541_362359_-	Group II intron-encoded protein LtrA	NA	A0A0U4J920	Pseudomonas_phage	28.2	1.3e-24
WP_031303046.1|362950_363220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021728816.1|363285_365076_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.8	8.1e-35
WP_001245659.1|366042_367866_-	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	28.4	1.7e-24
WP_042991647.1|368466_369612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000798699.1|369846_370599_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|370588_371884_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
>prophage 1
NZ_CP010095	Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB47, complete sequence	46979	0	46732	46979	holin,tail,portal,integrase,head,terminase	Bacillus_phage(100.0%)	64	4132:4148	27749:27765
WP_016049858.1|407_836_+	hypothetical protein	NA	A0A0S2MV94	Bacillus_phage	100.0	1.5e-72
WP_044129691.1|940_1147_+	hypothetical protein	NA	A0A0S2MV68	Bacillus_phage	100.0	5.6e-33
WP_016049860.1|1147_4087_+|tail	phage tail tape measure protein	tail	A0A0S2MVC9	Bacillus_phage	100.0	0.0e+00
WP_016049861.1|4099_5578_+|tail	phage tail fiber protein	tail	A0A0S2MVB9	Bacillus_phage	100.0	9.9e-297
4132:4148	attL	GAAAAGAAATTCAAATG	NA	NA	NA	NA
WP_016049862.1|5574_10284_+	phage minor structural protein	NA	I7ILV8	Bacillus_phage	100.0	0.0e+00
WP_016090410.1|10383_11343_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A068EP13	Bacillus_phage	100.0	4.8e-183
WP_016090409.1|11358_11598_+	hypothetical protein	NA	A0A0S2MVH5	Bacillus_phage	100.0	4.8e-36
WP_016090408.1|11640_11871_+|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	100.0	1.1e-34
WP_016090407.1|11887_12823_+	L-alanyl-D-glutamate peptidase	NA	A0A0S2MVR5	Bacillus_phage	100.0	5.7e-189
WP_016090406.1|13117_13402_-	hypothetical protein	NA	A0A0S2MVK9	Bacillus_phage	100.0	2.7e-49
WP_000539769.1|13836_14070_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	100.0	7.3e-37
WP_016090405.1|14155_14686_-	hypothetical protein	NA	A0A0S2MVP2	Bacillus_phage	100.0	7.1e-96
WP_031303572.1|14697_15078_-	hypothetical protein	NA	A0A0S2MVE7	Bacillus_phage	100.0	2.8e-62
WP_016090403.1|15195_15528_-	hypothetical protein	NA	A0A0S2MVL6	Bacillus_phage	99.1	4.6e-53
WP_016090402.1|15487_16519_-	ParM/StbA family protein	NA	A0A0S2MVG2	Bacillus_phage	100.0	1.1e-196
WP_016090401.1|16801_17464_-	hypothetical protein	NA	A0A0S2MVD6	Bacillus_phage	100.0	5.3e-125
WP_016090400.1|17487_18591_-	hypothetical protein	NA	A0A0S2MVK1	Bacillus_phage	100.0	1.5e-172
WP_016090399.1|19190_19535_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	100.0	5.3e-52
WP_016090398.1|19554_20082_-	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	100.0	2.0e-90
WP_016090397.1|20692_21010_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	100.0	5.8e-53
WP_016090396.1|21574_22762_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVK2	Bacillus_phage	100.0	4.6e-220
WP_016090393.1|23249_23600_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVD3	Bacillus_phage	100.0	4.7e-56
WP_016090392.1|23813_24011_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVJ7	Bacillus_phage	100.0	1.4e-28
WP_016090391.1|24077_24806_+	rha family phage regulatory protein	NA	A0A0S2MVD8	Bacillus_phage	100.0	2.6e-133
WP_016090390.1|24817_25192_+	hypothetical protein	NA	A0A0S2MVH3	Bacillus_phage	100.0	5.6e-63
WP_016090389.1|25215_25923_+	hypothetical protein	NA	A0A0S2MVI5	Bacillus_phage	100.0	1.0e-129
WP_016090388.1|25922_26102_+	hypothetical protein	NA	A0A0S2MVI7	Bacillus_phage	100.0	5.4e-24
WP_016090387.1|26091_26421_+	hypothetical protein	NA	A0A0S2MVM3	Bacillus_phage	100.0	8.1e-50
WP_016090386.1|26566_27070_+	hypothetical protein	NA	A0A0S2MVD2	Bacillus_phage	100.0	8.5e-91
WP_016090385.1|27038_27422_+	hypothetical protein	NA	A0A0S2MVI0	Bacillus_phage	100.0	1.1e-69
WP_016090384.1|27441_27798_+	hypothetical protein	NA	A0A0S2MVL2	Bacillus_phage	100.0	5.1e-66
27749:27765	attR	GAAAAGAAATTCAAATG	NA	NA	NA	NA
WP_016090383.1|27821_28289_+	hypothetical protein	NA	A0A0S2MVF1	Bacillus_phage	100.0	1.3e-85
WP_016090382.1|28402_28840_+	hypothetical protein	NA	A0A0S2MVD9	Bacillus_phage	100.0	1.0e-76
WP_016090381.1|28839_29292_+	hypothetical protein	NA	A0A0S2MVJ1	Bacillus_phage	100.0	7.9e-88
WP_016090380.1|29288_29870_+	hypothetical protein	NA	A0A0S2MVD0	Bacillus_phage	100.0	3.0e-108
WP_016090379.1|29891_30374_+	hypothetical protein	NA	A0A0S2MVE6	Bacillus_phage	100.0	2.5e-87
WP_016090378.1|30507_30807_+	hypothetical protein	NA	A0A0S2MVI8	Bacillus_phage	100.0	1.1e-50
WP_016090376.1|31035_31443_+	hypothetical protein	NA	A0A0S2MVF6	Bacillus_phage	100.0	6.9e-75
WP_002134061.1|32041_32407_+	hypothetical protein	NA	I7J6W4	Bacillus_phage	100.0	3.6e-59
WP_000351065.1|32652_32850_+	hypothetical protein	NA	I7IDJ9	Bacillus_phage	100.0	5.6e-30
WP_000873130.1|32846_33125_+	hypothetical protein	NA	I7J4K9	Bacillus_phage	100.0	8.1e-43
WP_001226456.1|33244_33631_+	hypothetical protein	NA	I7I4E2	Bacillus_phage	100.0	5.2e-72
WP_016049864.1|33661_34192_+	Holliday junction resolvase RecU	NA	A0A0S2MVB5	Bacillus_phage	100.0	1.2e-98
WP_016090448.1|34211_34535_+	hypothetical protein	NA	A0A0S2MV86	Bacillus_phage	100.0	3.3e-56
WP_016090447.1|34682_35183_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2MVE1	Bacillus_phage	100.0	1.2e-89
WP_016049869.1|36076_36319_+	hypothetical protein	NA	A0A0S2MVA9	Bacillus_phage	100.0	2.9e-36
WP_016049870.1|36311_36578_+	hypothetical protein	NA	A0A0S2MVC8	Bacillus_phage	100.0	2.3e-39
WP_016049871.1|36716_36959_+	DUF2829 domain-containing protein	NA	A0A0S2MV73	Bacillus_phage	100.0	8.6e-41
WP_016049872.1|36958_37222_+	DUF2829 domain-containing protein	NA	A0A0S2MVC6	Bacillus_phage	100.0	9.0e-44
WP_016049873.1|37481_37802_+	hypothetical protein	NA	A0A0S2MVH6	Bacillus_phage	100.0	4.8e-55
WP_016049874.1|37829_38213_+	hypothetical protein	NA	I7J6Y9	Bacillus_phage	100.0	2.2e-67
WP_016049845.1|38245_38575_+	hypothetical protein	NA	A0A0S2MVB8	Bacillus_phage	100.0	1.7e-52
WP_000762692.1|38561_38774_+	hypothetical protein	NA	A0A0S2MV92	Bacillus_phage	100.0	7.1e-31
WP_016049846.1|38924_39839_+|terminase	phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	100.0	2.5e-141
WP_016049847.1|39828_41103_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0S2MVC1	Bacillus_phage	100.0	2.4e-254
WP_016049848.1|41115_42549_+|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	100.0	8.5e-277
WP_016090413.1|42622_43390_+	hypothetical protein	NA	A0A0S2MVF0	Bacillus_phage	100.0	1.1e-142
WP_016049850.1|43389_43662_+	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	100.0	2.5e-49
WP_016049851.1|43741_44422_+	DUF4355 domain-containing protein	NA	A0A0S2MVA2	Bacillus_phage	100.0	9.7e-106
WP_016049852.1|44439_45282_+	hypothetical protein	NA	A0A0S2MVF8	Bacillus_phage	100.0	2.2e-155
WP_016049853.1|45332_45641_+	phage related protein gp15	NA	A0A0S2MVF2	Bacillus_phage	100.0	3.1e-51
WP_016049854.1|45637_45982_+|head,tail	head-tail adaptor protein	head,tail	A0A0S2MVD7	Bacillus_phage	100.0	6.7e-63
WP_016049855.1|45956_46364_+	HK97 gp10 family phage protein	NA	A0A0S2MVE4	Bacillus_phage	100.0	1.4e-67
WP_016049856.1|46369_46732_+	hypothetical protein	NA	A0A0S2MV90	Bacillus_phage	100.0	1.1e-63
>prophage 1
NZ_CP010096	Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMBLin15, complete sequence	14749	350	14749	14749		Bacillus_phage(100.0%)	23	NA	NA
WP_015976754.1|350_527_+	helix-turn-helix domain-containing protein	NA	Q5ILD1	Bacillus_phage	100.0	1.2e-23
WP_015976755.1|542_1043_+	hypothetical protein	NA	Q5ILD0	Bacillus_phage	100.0	2.6e-84
WP_042991710.1|1114_1339_+	hypothetical protein	NA	Q5ILC9	Bacillus_phage	98.6	2.0e-31
WP_016090431.1|1397_2135_+	hypothetical protein	NA	Q5ILC8	Bacillus_phage	99.6	2.2e-132
WP_016090430.1|2121_4326_+	hypothetical protein	NA	A0A160LKS5	Bacillus_phage	98.9	0.0e+00
WP_000957403.1|4342_4543_+	LexA repressor	NA	A0A161ISH4	Bacillus_phage	100.0	1.9e-30
WP_015976760.1|4826_5081_+	hypothetical protein	NA	Q5ILC4	Bacillus_phage	100.0	2.2e-39
WP_042991711.1|5055_5424_+	hypothetical protein	NA	Q5ILC3	Bacillus_phage	97.5	3.6e-14
WP_042991712.1|5411_5996_+	hypothetical protein	NA	Q5ILC2	Bacillus_phage	93.2	6.2e-61
WP_042991713.1|6052_6361_+	hypothetical protein	NA	Q5ILC0	Bacillus_phage	96.1	4.6e-55
WP_016090421.1|6341_6980_+	hypothetical protein	NA	Q5ILB9	Bacillus_phage	99.5	1.9e-124
WP_042991715.1|7412_7682_+	hypothetical protein	NA	Q5ILB5	Bacillus_phage	89.9	3.8e-37
WP_042991716.1|7681_8752_+	hypothetical protein	NA	A0A160LKS4	Bacillus_phage	93.3	6.3e-192
WP_042991717.1|8793_9024_+	hypothetical protein	NA	Q5ILB3	Bacillus_phage	96.1	8.8e-35
WP_000339993.1|9027_9234_+	hypothetical protein	NA	A0A160LKQ4	Bacillus_phage	100.0	2.5e-12
WP_042991718.1|9307_9775_+	hypothetical protein	NA	Q5ILB0	Bacillus_phage	97.9	2.3e-18
WP_042991719.1|10102_10378_+	hypothetical protein	NA	A0A169E435	Bacillus_phage	97.8	6.3e-48
WP_042991720.1|10381_10996_+	hypothetical protein	NA	A0A160LKP5	Bacillus_phage	97.5	2.7e-75
WP_042991722.1|10995_11748_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5ILA5	Bacillus_phage	95.2	4.0e-129
WP_042991724.1|11695_12208_+	membrane protein	NA	A0A160LKQ7	Bacillus_phage	98.2	6.6e-91
WP_042991725.1|12220_13114_+	hypothetical protein	NA	Q5ILA3	Bacillus_phage	95.6	3.0e-147
WP_042991727.1|13117_13999_+	hypothetical protein	NA	A0A160LKP6	Bacillus_phage	96.2	1.4e-165
WP_042991729.1|14015_14749_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5ILA1	Bacillus_phage	97.8	3.1e-126
