The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012162	Enterobacter roggenkampii strain 35734 chromosome 1, complete sequence	5017289	84613	94269	5017289	integrase	Enterobacteria_phage(100.0%)	10	76895:76908	95213:95226
76895:76908	attL	GGCGGCGTGATCAC	NA	NA	NA	NA
WP_044597383.1|84613_86947_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.4	0.0e+00
WP_044597382.1|86961_87282_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_017692848.1|87278_87506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044597381.1|87502_88060_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	65.2	7.1e-30
WP_044597380.1|88056_88323_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	75.0	8.0e-32
WP_044597379.1|88860_89604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044597378.1|89606_89825_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	65.2	8.6e-16
WP_044597377.1|89853_90417_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.7	1.1e-59
WP_050009967.1|90696_93072_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_044597376.1|93090_94269_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	86.0	1.6e-196
95213:95226	attR	GGCGGCGTGATCAC	NA	NA	NA	NA
>prophage 2
NZ_CP012162	Enterobacter roggenkampii strain 35734 chromosome 1, complete sequence	5017289	417911	469776	5017289	transposase,protease,tRNA,integrase	Stx2-converting_phage(16.67%)	47	408744:408759	466198:466213
408744:408759	attL	AGCAGGCGGTGCTGGT	NA	NA	NA	NA
WP_044596437.1|417911_419504_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	5.1e-174
WP_088569370.1|419715_420989_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.4	6.2e-146
WP_016946740.1|421217_421625_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	37.8	6.1e-15
WP_044597283.1|422435_423665_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_044597282.1|424669_425932_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.8	4.2e-78
WP_021240733.1|426330_426906_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_044597281.1|426955_428647_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_008502950.1|428622_428946_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_008502949.1|429059_430361_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_003855923.1|430476_431913_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_023616652.1|432247_432712_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_025911862.1|432748_433969_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_003855929.1|434148_434442_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
WP_008502946.1|434473_436117_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.3	6.9e-190
WP_044597280.1|436182_437346_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_023293466.1|437356_437818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044597279.1|437798_438464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008502942.1|438698_439052_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_008502941.1|439117_440146_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_008502940.1|440186_440753_+	elongation factor P	NA	NA	NA	NA	NA
WP_024907352.1|440811_440943_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_003025482.1|441051_441198_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_021240725.1|441235_441835_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_008502938.1|442096_442414_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_021240724.1|442410_442941_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.8	1.4e-46
WP_044597278.1|443071_444217_-	cephalosporin-hydrolyzing class C beta-lactamase MIR-20	NA	NA	NA	NA	NA
WP_044597277.1|444349_445225_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008502934.1|445254_445614_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_008502933.1|445624_446020_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_003855955.1|446030_446765_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_044597276.1|446757_448548_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_008502931.1|448858_449836_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	30.0	2.6e-27
WP_023616171.1|450013_451513_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_008502929.1|451550_454874_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_023293460.1|454893_455862_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_111986440.1|455959_457045_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_008502926.1|457119_457665_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	5.3e-30
WP_023345299.1|458431_459571_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_044597274.1|459569_461093_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_044597273.1|461085_461547_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_021240715.1|461563_462904_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_039265371.1|462913_464758_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.2	1.3e-59
WP_008502920.1|464750_465701_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_008502919.1|465786_466098_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_008502918.1|466172_467453_+	GTPase HflX	NA	NA	NA	NA	NA
466198:466213	attR	AGCAGGCGGTGCTGGT	NA	NA	NA	NA
WP_044597272.1|467509_468769_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.1	8.0e-05
WP_008502916.1|468771_469776_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 3
NZ_CP012162	Enterobacter roggenkampii strain 35734 chromosome 1, complete sequence	5017289	1635798	1716084	5017289	integrase,terminase,protease,head,portal,plate,capsid,transposase,holin,tail,tRNA	Shigella_phage(24.53%)	83	1630880:1630896	1686915:1686931
1630880:1630896	attL	AGCGCGGTATATGCCCG	NA	NA	NA	NA
WP_008499956.1|1635798_1636578_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_044596891.1|1636581_1637904_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_008499954.1|1637884_1638589_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_044596890.1|1638588_1643040_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_044596889.1|1643218_1645042_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_084831940.1|1645207_1645768_+	YcbK family protein	NA	NA	NA	NA	NA
WP_008499950.1|1645788_1646436_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_008499949.1|1646484_1647675_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_010675355.1|1648832_1650332_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.5	5.8e-18
WP_010675356.1|1650318_1651059_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.9	3.5e-32
WP_021240867.1|1651929_1653330_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.7	4.2e-79
WP_044596887.1|1653496_1654699_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.9	1.3e-44
WP_044596886.1|1654883_1656176_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	94.2	1.1e-238
WP_013097283.1|1656220_1656478_-	excisionase family protein	NA	S4TND0	Salmonella_phage	90.0	1.8e-36
WP_044596885.1|1656461_1656833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044596884.1|1656847_1657426_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	67.7	8.3e-74
WP_044596883.1|1657425_1657848_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	64.0	2.7e-45
WP_044596882.1|1658037_1658445_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	87.5	2.7e-47
WP_044596881.1|1658437_1658659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044596880.1|1658765_1659152_-	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	62.4	3.1e-40
WP_044596879.1|1659214_1659433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044596878.1|1659447_1659633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126325666.1|1659629_1660019_-	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	55.4	8.2e-09
WP_102046745.1|1660185_1660956_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	78.9	5.3e-100
WP_044596875.1|1661012_1661282_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	57.3	1.6e-19
WP_044596874.1|1661302_1661596_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	82.5	1.8e-29
WP_044596873.1|1662021_1663641_+	DEAD/DEAH box helicase	NA	F1C598	Cronobacter_phage	87.0	2.7e-279
WP_044596872.1|1663637_1664606_+	DNA primase	NA	F1C597	Cronobacter_phage	81.5	1.3e-156
WP_044596871.1|1664605_1665466_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	83.5	2.3e-136
WP_044596870.1|1665462_1666245_+	antitermination protein	NA	F1C595	Cronobacter_phage	75.6	1.2e-107
WP_045347645.1|1666439_1666634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126325667.1|1667049_1667316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022648767.1|1667878_1668274_+	phage membrane protein	NA	K7PHB9	Enterobacterial_phage	99.2	9.1e-64
WP_032675093.1|1668260_1668566_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	91.4	1.7e-41
WP_032675092.1|1668543_1669086_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	73.2	5.2e-78
WP_032675091.1|1669082_1669352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044596868.1|1669308_1669503_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	91.8	2.0e-19
WP_032675089.1|1669694_1670219_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	77.6	1.2e-71
WP_032675087.1|1670410_1670674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032675086.1|1670654_1671023_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	72.2	5.2e-45
WP_032675084.1|1671110_1671605_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.1	1.1e-82
WP_032675083.1|1671601_1673335_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	94.5	0.0e+00
WP_032675081.1|1673482_1674709_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	91.4	1.2e-223
WP_032675079.1|1674701_1675301_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	78.5	3.0e-87
WP_032675078.1|1675310_1676531_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	74.4	9.7e-165
WP_032675077.1|1676604_1676928_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	67.9	4.5e-37
WP_032675076.1|1676924_1677338_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	69.3	1.2e-47
WP_032675074.1|1677814_1678375_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	79.0	3.9e-84
WP_032675073.1|1678383_1678566_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	71.1	7.0e-11
WP_032675072.1|1678562_1680059_+|tail	tail sheath protein	tail	U5P0H3	Shigella_phage	75.1	2.4e-213
WP_032675071.1|1680058_1680415_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	78.8	2.8e-48
WP_044596867.1|1680414_1680702_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	59.8	2.8e-22
WP_032675069.1|1680819_1682601_+|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	57.7	3.5e-115
WP_032675068.1|1682669_1683086_+	PH domain-containing protein	NA	A0A249Y2R5	Serratia_phage	40.9	1.4e-19
WP_065365761.1|1683134_1684556_+	DNA circularization protein	NA	M1FPN5	Enterobacteria_phage	67.7	2.2e-168
WP_032675067.1|1684564_1686088_+	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	31.0	5.5e-24
WP_032675066.1|1686087_1686372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032675065.1|1686374_1687445_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	79.1	2.0e-166
1686915:1686931	attR	CGGGCATATACCGCGCT	NA	NA	NA	NA
WP_032675064.1|1687444_1687987_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	72.8	4.7e-71
WP_032675063.1|1687989_1688409_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	79.1	4.2e-59
WP_032675061.1|1689449_1690031_+	YmfQ family protein	NA	O22003	Shigella_phage	78.8	2.2e-90
WP_084832606.1|1690869_1691214_+	hypothetical protein	NA	U5P083	Shigella_phage	54.5	2.5e-09
WP_044596866.1|1691872_1693330_-	hypothetical protein	NA	A8CG94	Salmonella_phage	25.9	1.4e-24
WP_032675059.1|1693326_1694250_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	88.8	4.0e-155
WP_032675058.1|1694246_1694609_-	GtrA family protein	NA	U5P0S6	Shigella_phage	76.7	3.0e-45
WP_032675057.1|1694999_1695239_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	94.9	9.1e-35
WP_032651183.1|1695663_1698276_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.0	9.1e-19
WP_008499944.1|1698326_1699097_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	1.3e-29
WP_008499943.1|1699093_1699885_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_044596865.1|1699894_1701040_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_021240863.1|1701036_1701999_-	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008499940.1|1701991_1702567_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_008499939.1|1702815_1703826_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_021240861.1|1703992_1704535_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_044596864.1|1704531_1705641_-	MOSC domain-containing protein	NA	V5UTY8	Synechococcus_phage	36.2	9.2e-05
WP_044596863.1|1705739_1707848_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_044596862.1|1707860_1709768_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	7.3e-50
WP_008499934.1|1709781_1711035_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_044596861.1|1711039_1712680_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_008499932.1|1712676_1713243_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_013097261.1|1713498_1713666_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_008499931.1|1713736_1714255_-	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA	NA	NA	NA	NA	NA
WP_044596860.1|1714323_1716084_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 4
NZ_CP012162	Enterobacter roggenkampii strain 35734 chromosome 1, complete sequence	5017289	2190109	2196403	5017289		Enterobacteria_phage(50.0%)	6	NA	NA
WP_044596700.1|2190109_2191501_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	1.8e-18
WP_044596699.1|2191677_2192574_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	1.5e-42
WP_044596698.1|2192928_2194011_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	4.1e-98
WP_032652661.1|2194013_2194913_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.9	2.0e-29
WP_032655542.1|2194963_2195842_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	6.0e-108
WP_032652659.1|2195845_2196403_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.0	3.3e-51
>prophage 5
NZ_CP012162	Enterobacter roggenkampii strain 35734 chromosome 1, complete sequence	5017289	2681322	2695221	5017289	tRNA	Escherichia_phage(30.0%)	13	NA	NA
WP_065365757.1|2681322_2682465_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.3	8.9e-11
WP_023292275.1|2682620_2683604_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_023327603.1|2684087_2685461_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.3	1.8e-50
WP_023344312.1|2685503_2686439_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.7	4.0e-142
WP_044596545.1|2686488_2687727_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	69.3	1.4e-166
WP_014884030.1|2687728_2687941_-	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	64.8	4.3e-20
WP_020882485.1|2688005_2688248_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	1.3e-33
WP_044596544.1|2688286_2689372_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	64.2	1.3e-125
WP_044596543.1|2689381_2692519_-	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	64.1	0.0e+00
WP_162230875.1|2692762_2693089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044596540.1|2693488_2694376_-	serine dehydrogenasease	NA	NA	NA	NA	NA
WP_074147907.1|2694507_2694921_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	76.9	8.9e-46
WP_044596538.1|2694993_2695221_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.9	1.1e-21
>prophage 6
NZ_CP012162	Enterobacter roggenkampii strain 35734 chromosome 1, complete sequence	5017289	3103050	3113127	5017289		Klosneuvirus(16.67%)	9	NA	NA
WP_044596339.1|3103050_3105084_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.6	1.4e-19
WP_021241307.1|3105226_3105973_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_008502405.1|3106064_3106751_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044596338.1|3106786_3107218_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	34.5	1.4e-17
WP_014883679.1|3107505_3107709_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	58.2	3.4e-14
WP_044596337.1|3107752_3109216_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.7	2.3e-43
WP_008502410.1|3109437_3110805_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_044596336.1|3110878_3111898_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	27.7	4.6e-19
WP_023292552.1|3111912_3113127_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.4	8.2e-47
>prophage 7
NZ_CP012162	Enterobacter roggenkampii strain 35734 chromosome 1, complete sequence	5017289	3375591	3429856	5017289	transposase,tRNA,protease	Stx2-converting_phage(23.08%)	52	NA	NA
WP_021241572.1|3375591_3376404_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_023325776.1|3376403_3377417_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_023294134.1|3377484_3378621_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.9	5.2e-19
WP_008502603.1|3378734_3379739_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_044597868.1|3379829_3381008_-	MFS transporter	NA	NA	NA	NA	NA
WP_008502605.1|3381215_3382433_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_044597867.1|3382591_3384589_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_008502607.1|3384686_3384962_-	YfcL family protein	NA	NA	NA	NA	NA
WP_044597866.1|3384975_3385521_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_044597865.1|3385520_3386330_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_008502610.1|3386329_3387154_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_023325780.1|3387156_3388242_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.9	1.5e-87
WP_008502612.1|3388302_3389235_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_014884683.1|3389978_3390464_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_044597864.1|3390673_3392821_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_044597863.1|3392820_3394131_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_023294142.1|3394407_3394692_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_008502618.1|3395064_3396348_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_008502619.1|3396392_3397145_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_023325783.1|3397460_3398390_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	85.4	3.3e-141
WP_007851504.1|3400058_3400349_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	93.2	2.2e-30
WP_007851507.1|3400516_3401599_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
WP_015386474.1|3401720_3404795_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_003846917.1|3404846_3406100_+	lactose permease	NA	NA	NA	NA	NA
WP_003846919.1|3406156_3406327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|3407263_3407527_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015386469.1|3407541_3407805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|3408048_3408330_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152117.1|3408364_3408934_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|3409039_3411835_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|3411834_3412032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023312611.1|3412269_3413019_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|3413005_3413968_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_087451024.1|3415861_3416982_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_013098166.1|3417623_3417815_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007869711.1|3417831_3419043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007869714.1|3419039_3419999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007869717.1|3420080_3420965_+	NgrB	NA	NA	NA	NA	NA
WP_013098169.1|3421225_3421963_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_044597862.1|3422019_3422292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007869721.1|3422371_3422632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007869723.1|3422758_3423580_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	1.5e-44
WP_007869725.1|3423603_3423843_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_013098170.1|3423946_3424405_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.4	1.9e-12
WP_013098171.1|3424420_3424897_+	RadC family protein	NA	NA	NA	NA	NA
WP_013098172.1|3424905_3425133_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_007869729.1|3425146_3425464_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_007869731.1|3425484_3425811_+	YkfI toxin protein	NA	NA	NA	NA	NA
WP_044597861.1|3426045_3427377_-	membrane protein	NA	NA	NA	NA	NA
WP_044597860.1|3427478_3429071_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	1.1e-173
WP_044596438.1|3429101_3429452_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.3e-41
WP_016946740.1|3429448_3429856_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	37.8	6.1e-15
>prophage 8
NZ_CP012162	Enterobacter roggenkampii strain 35734 chromosome 1, complete sequence	5017289	3763075	3771582	5017289	transposase	Escherichia_phage(16.67%)	9	NA	NA
WP_086538201.1|3763075_3764092_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.5	5.4e-185
WP_023294397.1|3764759_3765209_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_008502568.1|3765241_3765586_-	YgaC family protein	NA	NA	NA	NA	NA
WP_008502569.1|3765746_3766073_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_008502570.1|3766316_3766556_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.9	3.2e-11
WP_044597751.1|3766552_3766963_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.4	3.9e-17
WP_044597750.1|3766935_3769080_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	49.1	7.3e-200
WP_044597749.1|3769089_3770049_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	74.3	6.3e-135
WP_008502574.1|3770379_3771582_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.3	1.9e-27
>prophage 9
NZ_CP012162	Enterobacter roggenkampii strain 35734 chromosome 1, complete sequence	5017289	4022462	4079985	5017289	transposase,tRNA,integrase	uncultured_Caudovirales_phage(23.08%)	55	4062646:4062664	4086750:4086768
WP_025912470.1|4022462_4023182_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_044597665.1|4023320_4024379_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_008499765.1|4024405_4024678_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_021242082.1|4024802_4025879_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_008499767.1|4026097_4027354_+	nucleoside permease	NA	NA	NA	NA	NA
WP_044597664.1|4027433_4028237_-	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
WP_032664362.1|4028214_4028754_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_044597663.1|4028750_4030274_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_032655004.1|4030284_4031160_-	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_032653346.1|4031156_4031450_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_044597662.1|4031466_4032489_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_021242089.1|4032502_4033366_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_044597661.1|4033383_4034745_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_044597660.1|4035089_4036715_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_044597659.1|4036704_4037397_+	response regulator	NA	NA	NA	NA	NA
WP_044597658.1|4037485_4039621_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_008499781.1|4039803_4040517_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_004115409.1|4040883_4041915_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_044597657.1|4041974_4043594_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004115414.1|4043660_4045136_-	AAA family ATPase	NA	A0A075DXT4	Acinetobacter_phage	31.5	2.6e-47
WP_004115417.1|4045296_4046682_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_025760278.1|4047538_4047790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032742914.1|4047864_4049298_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.5	1.1e-103
WP_025760317.1|4049339_4050539_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	39.1	1.1e-32
WP_077254457.1|4050674_4051271_-	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	26.6	2.8e-08
WP_053287147.1|4051266_4051494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053287146.1|4051510_4052236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032742913.1|4052326_4053259_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_025760314.1|4053255_4053774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025760313.1|4053781_4054747_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001515173.1|4054929_4055253_+	helix-turn-helix transcriptional regulator	NA	F8TVE5	EBPR_siphovirus	41.7	7.5e-08
WP_025760312.1|4055255_4056122_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000427623.1|4056615_4057620_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_031591996.1|4058219_4058573_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	49.1	6.9e-23
WP_031591995.1|4058620_4058983_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_031591994.1|4058999_4060751_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_031591992.1|4060797_4062087_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	3.5e-173
WP_031591991.1|4062099_4062525_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	6.1e-50
4062646:4062664	attL	AGGGAAGGTGCGAACAAGT	NA	NA	NA	NA
WP_032742911.1|4062715_4063696_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	2.0e-184
WP_004729618.1|4064236_4065010_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.0	7.3e-09
WP_001194072.1|4065075_4065777_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_023287189.1|4065842_4066949_-	alkene reductase	NA	NA	NA	NA	NA
WP_008502229.1|4067162_4067492_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000888080.1|4067521_4067860_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000210409.1|4067864_4068446_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000108589.1|4068587_4069145_-	OsmC family protein	NA	NA	NA	NA	NA
WP_012695450.1|4069331_4069916_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	35.5	9.7e-22
WP_032742905.1|4070075_4073060_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.1	9.9e-304
WP_000427623.1|4073138_4074143_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_032742903.1|4074754_4075687_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_032742901.1|4075792_4076779_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.9	3.8e-50
WP_032742899.1|4076879_4077527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032742894.1|4077608_4077974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118087.1|4078069_4078429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032742891.1|4079085_4079985_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4086750:4086768	attR	ACTTGTTCGCACCTTCCCT	NA	NA	NA	NA
>prophage 10
NZ_CP012162	Enterobacter roggenkampii strain 35734 chromosome 1, complete sequence	5017289	4383530	4486697	5017289	protease,terminase,integrase,head,portal,capsid,transposase,tail,tRNA	uncultured_Caudovirales_phage(42.86%)	93	4412014:4412030	4465029:4465045
WP_044597578.1|4383530_4386386_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	7.9e-141
WP_008502817.1|4386509_4387013_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021242270.1|4387096_4388116_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	31.0	1.1e-44
WP_044597577.1|4388159_4389800_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_044597576.1|4389937_4391440_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	2.6e-82
WP_100122167.1|4391419_4392361_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.4	8.9e-17
WP_044597575.1|4393048_4397509_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_021242274.1|4397518_4398937_+	glutamate synthase subunit GltD	NA	NA	NA	NA	NA
WP_023294675.1|4399118_4399679_-	outer membrane protein	NA	NA	NA	NA	NA
WP_023326178.1|4399675_4402090_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_008502827.1|4402105_4402810_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_008502828.1|4402930_4403608_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_025912562.1|4404058_4404556_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	1.1e-26
WP_008502830.1|4404561_4405200_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_003860436.1|4405508_4405901_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003860434.1|4405916_4406345_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_044597574.1|4406644_4407769_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_008502832.1|4407958_4408357_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_021242281.1|4408528_4409896_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.1	1.3e-21
WP_008502834.1|4409987_4411055_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_008502835.1|4411111_4412050_-	malate dehydrogenase	NA	NA	NA	NA	NA
4412014:4412030	attL	CGATACCACCAGCAGCG	NA	NA	NA	NA
WP_008502836.1|4412447_4412918_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_008502837.1|4413293_4413557_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_008502838.1|4413667_4413934_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_044597573.1|4413995_4414268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044597572.1|4414313_4415768_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_008502841.1|4415858_4417826_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_021242282.1|4417831_4418764_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_003860416.1|4418771_4418975_-	AaeX family protein	NA	NA	NA	NA	NA
WP_044597571.1|4419154_4420081_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_008502844.1|4420300_4420915_+	YagU family protein	NA	NA	NA	NA	NA
WP_021242283.1|4420961_4422407_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_044597570.1|4422491_4426289_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_008502847.1|4426330_4427800_-	ribonuclease G	NA	NA	NA	NA	NA
WP_021242285.1|4427789_4428383_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_008502849.1|4428392_4428881_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_008502850.1|4428880_4429897_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|4429959_4431003_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_162230876.1|4430971_4431205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025912568.1|4431285_4433226_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_023294684.1|4433408_4434383_+	oxidoreductase	NA	NA	NA	NA	NA
WP_008502853.1|4434460_4435462_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_008502854.1|4435462_4436062_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_008502855.1|4436296_4436749_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_008502856.1|4436770_4437235_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003860388.1|4437245_4438595_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_021242290.1|4438703_4438946_+	YhdT family protein	NA	NA	NA	NA	NA
WP_044597569.1|4438935_4440387_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_044597568.1|4440398_4441280_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_021242291.1|4441407_4442148_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_008502861.1|4442478_4443444_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4443467_4443764_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_040215040.1|4444112_4444451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044597567.1|4444459_4445062_-|tail	tail assembly protein	tail	K7P6M0	Enterobacteria_phage	65.5	1.8e-63
WP_044597566.1|4445075_4446737_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.2	0.0e+00
WP_023326190.1|4446720_4447077_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	95.8	4.6e-59
WP_001547822.1|4447205_4447358_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	84.0	1.3e-15
WP_021538170.1|4447350_4447794_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	93.9	2.3e-79
WP_001547824.1|4447793_4448093_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|4448089_4448425_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_044597565.1|4448421_4449672_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	95.6	4.8e-228
WP_000848270.1|4449673_4450234_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	98.4	7.7e-101
WP_044597564.1|4450285_4451452_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	97.2	5.6e-210
WP_039671529.1|4451728_4452199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023293261.1|4452245_4452581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044597563.1|4452923_4455059_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.3	1.4e-206
WP_001549749.1|4455058_4455424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040194363.1|4455420_4455789_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	5.7e-52
WP_004218267.1|4455887_4456016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044597561.1|4456092_4456281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157263200.1|4456273_4456492_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_044597560.1|4457042_4457822_-	ROK family transcriptional regulator	NA	Q8HA02	Enterobacteria_phage	52.0	4.8e-40
WP_049007531.1|4457833_4458118_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_044597559.1|4458299_4459241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044597558.1|4459333_4460560_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.4	1.2e-151
WP_008502862.1|4460925_4461090_+	DUF2556 family protein	NA	NA	NA	NA	NA
WP_044597557.1|4461228_4463310_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	35.9	1.7e-23
WP_008502864.1|4463225_4463945_-	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
WP_023294691.1|4465484_4468598_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
4465029:4465045	attR	CGATACCACCAGCAGCG	NA	NA	NA	NA
WP_008502867.1|4468902_4469124_+	lipoprotein	NA	NA	NA	NA	NA
WP_044597556.1|4470690_4471872_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_023326203.1|4471881_4472985_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014171880.1|4472992_4473751_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	2.0e-19
WP_087451024.1|4473861_4474981_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_044597555.1|4480773_4481328_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_023345007.1|4481303_4481552_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_044597554.1|4481548_4482367_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_008503475.1|4482371_4482944_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.1	4.9e-10
WP_023294698.1|4482936_4483491_-	DNA topoisomerase type IA Zn finger domain-containing protein	NA	NA	NA	NA	NA
WP_008503477.1|4483517_4483991_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_044598020.1|4483962_4485087_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_008503479.1|4485214_4485724_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	3.9e-19
WP_008503480.1|4485749_4486697_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.3	4.9e-07
>prophage 11
NZ_CP012162	Enterobacter roggenkampii strain 35734 chromosome 1, complete sequence	5017289	4631973	4673847	5017289	transposase,integrase	Bacillus_phage(30.77%)	37	4631900:4631917	4678057:4678074
4631900:4631917	attL	CTGTAGGCCCGGTAAGCG	NA	NA	NA	NA
WP_044597507.1|4631973_4633131_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_008503109.1|4633234_4634260_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.1	7.8e-75
WP_008503110.1|4634423_4634822_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_032653809.1|4635137_4636475_+	MFS transporter	NA	NA	NA	NA	NA
WP_039267175.1|4636509_4637247_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044597506.1|4637416_4638109_+	diguanylate cyclase	NA	E3T536	Cafeteria_roenbergensis_virus	35.3	4.3e-08
WP_008503114.1|4638108_4639047_+	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	31.5	4.3e-27
WP_016946740.1|4639414_4639822_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	37.8	6.1e-15
WP_044596438.1|4639818_4640169_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.3e-41
WP_044596437.1|4640199_4641792_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	5.1e-174
WP_000723069.1|4641919_4642354_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_001211180.1|4642571_4643972_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_001188930.1|4643968_4644649_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_000998778.1|4644703_4645633_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|4645637_4646018_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001242438.1|4646057_4646954_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925240.1|4646953_4648771_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|4649005_4649455_+	copper resistance protein	NA	NA	NA	NA	NA
WP_000287501.1|4649743_4650481_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
WP_000843494.1|4650514_4650712_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001353604.1|4650752_4653200_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.3	1.3e-83
WP_000758225.1|4653326_4653767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000574029.1|4653853_4657000_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_000157620.1|4657010_4658303_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246155.1|4658416_4658770_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475506.1|4658797_4660183_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697968.1|4660372_4661053_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000555736.1|4661045_4662527_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000790485.1|4662771_4663203_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000647571.1|4663350_4663701_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
WP_001239419.1|4663869_4665696_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001097216.1|4666259_4666559_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044597505.1|4666911_4667838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324699.1|4667849_4669406_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001049180.1|4669446_4670895_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000351437.1|4670894_4673018_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000090707.1|4673004_4673847_-|transposase	transposase	transposase	NA	NA	NA	NA
4678057:4678074	attR	CGCTTACCGGGCCTACAG	NA	NA	NA	NA
>prophage 12
NZ_CP012162	Enterobacter roggenkampii strain 35734 chromosome 1, complete sequence	5017289	4814951	4929677	5017289	protease,terminase,integrase,head,portal,plate,capsid,holin,tail,tRNA	Salmonella_phage(76.19%)	108	4867172:4867213	4898612:4898653
WP_044597478.1|4814951_4816052_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_008501783.1|4816131_4816491_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_008501784.1|4816500_4817139_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_008501785.1|4817335_4818736_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_044597477.1|4818709_4819636_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_044597476.1|4819931_4821305_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_088728450.1|4821379_4822156_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_008501789.1|4822162_4823167_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_008501790.1|4823255_4824407_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_023345106.1|4824653_4827305_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_023326307.1|4827400_4828249_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044597475.1|4828235_4828592_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_044597474.1|4828594_4829470_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_044597473.1|4829435_4831733_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	7.8e-06
WP_023326311.1|4831784_4832105_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_044597472.1|4832119_4833199_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_044597471.1|4833504_4836006_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.9	2.5e-10
WP_021242818.1|4836020_4836683_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	8.4e-30
WP_008501794.1|4836695_4837799_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_044597470.1|4837890_4840071_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_008501796.1|4840218_4841106_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_008501797.1|4841332_4843765_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_021242813.1|4843767_4844928_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_003862042.1|4845204_4845522_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_003862040.1|4845570_4845783_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_044597469.1|4845983_4848179_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_044597468.1|4848298_4849324_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_032622950.1|4849417_4850407_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_008501802.1|4850501_4851032_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_008501803.1|4851041_4852376_+	HslU--HslV peptidase ATPase subunit	NA	A0A173GE36	Erwinia_phage	29.2	7.1e-44
WP_008501804.1|4852444_4853365_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_008501805.1|4853457_4853943_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_008501806.1|4854528_4854768_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_014885705.1|4855178_4856024_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.5	8.9e-16
WP_044597467.1|4856045_4857554_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_023293599.1|4857672_4858683_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_044597466.1|4858779_4859526_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_008501811.1|4859526_4859946_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_044597465.1|4860058_4860655_+	DUF1454 family protein	NA	NA	NA	NA	NA
WP_003862019.1|4860766_4861534_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_039265638.1|4861615_4862920_-	citrate transporter	NA	NA	NA	NA	NA
WP_044597464.1|4862993_4863737_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_044597463.1|4863844_4864834_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008501816.1|4865052_4866015_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_008501817.1|4866189_4867083_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4867172:4867213	attL	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_044597462.1|4867327_4867975_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_044597461.1|4867971_4868304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251454.1|4868405_4868648_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_044597460.1|4868696_4869815_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	99.2	1.5e-191
WP_000224788.1|4869972_4871166_+|tail	tail protein	tail	A0A0M4S6M1	Salmonella_phage	94.2	7.7e-215
WP_001207578.1|4871178_4871694_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	98.8	4.2e-93
WP_000047593.1|4871708_4872044_+	hypothetical protein	NA	A0A0M4RCV2	Salmonella_phage	99.1	3.0e-52
WP_000763324.1|4872052_4872169_+|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	100.0	6.6e-15
WP_044597459.1|4872169_4875340_+|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	74.2	0.0e+00
WP_023276958.1|4875350_4875800_+|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	92.6	2.2e-74
WP_044597458.1|4876252_4876708_-|tail	tail assembly chaperone	tail	K7PMC4	Enterobacterial_phage	50.5	1.2e-22
WP_071882582.1|4876710_4878405_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	72.3	1.3e-138
WP_044597457.1|4878401_4879010_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	81.5	4.0e-95
WP_044597456.1|4879002_4879914_-|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	98.3	5.4e-160
WP_000108898.1|4879910_4880273_-|plate	baseplate assembly protein	plate	A0A0M4S6L5	Salmonella_phage	100.0	5.0e-61
WP_001052319.1|4880269_4880899_-|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	97.6	5.4e-111
WP_001337857.1|4881056_4881701_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	98.1	1.2e-116
WP_000917105.1|4881661_4882156_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	98.0	8.7e-80
WP_001373667.1|4882155_4882689_-	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	94.8	5.7e-45
WP_023309713.1|4882790_4883231_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	96.6	8.8e-76
WP_000543937.1|4883214_4883550_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	98.2	2.1e-53
WP_001102549.1|4883560_4883761_-|tail	tail protein	tail	A0A0M4RTN6	Salmonella_phage	100.0	1.8e-31
WP_016246752.1|4883760_4884249_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	97.5	5.2e-85
WP_044597455.1|4884351_4885200_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	97.5	1.4e-133
WP_001246221.1|4885242_4886289_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	98.8	9.1e-196
WP_044598013.1|4886329_4887175_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	97.2	3.5e-153
WP_001090183.1|4887328_4889041_+|terminase	terminase	terminase	A0A0M4S6K7	Salmonella_phage	98.4	0.0e+00
WP_000014576.1|4889041_4890091_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	100.0	6.7e-207
WP_044597454.1|4890486_4891125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044597453.1|4891128_4892127_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_044597452.1|4892285_4894640_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	86.9	0.0e+00
WP_001048820.1|4894636_4894816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044597451.1|4894815_4895787_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	81.3	1.1e-137
WP_044597450.1|4895788_4896001_-	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	67.1	7.3e-20
WP_044597449.1|4896086_4896317_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	94.7	6.1e-36
WP_071882583.1|4896306_4896513_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	98.5	2.8e-32
WP_044597448.1|4896523_4896727_-	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	97.0	2.6e-30
WP_021312625.1|4896737_4897019_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	97.8	2.0e-49
WP_016246740.1|4897130_4897451_+	transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	84.9	2.9e-44
WP_016246739.1|4897520_4898501_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	98.8	2.1e-186
WP_044597447.1|4898675_4899182_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4898612:4898653	attR	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_006179159.1|4899332_4900031_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	2.4e-06
WP_003862003.1|4900027_4901401_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	5.5e-15
WP_044597446.1|4901454_4902129_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_003861999.1|4902200_4902821_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	2.2e-64
WP_044597445.1|4902983_4904249_-	MFS transporter	NA	NA	NA	NA	NA
WP_044597444.1|4904293_4906417_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_023345118.1|4906520_4907516_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_021242797.1|4907533_4908082_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023293608.1|4908184_4908844_+	azaleucine resistance protein AzlC	NA	NA	NA	NA	NA
WP_023618141.1|4908843_4909167_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_008501827.1|4909207_4909420_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_044597443.1|4909534_4910371_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_088728449.1|4910742_4913793_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_008501831.1|4913805_4914708_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_008501832.1|4914704_4915340_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_008501833.1|4915336_4916266_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_050009968.1|4916455_4918150_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_023326328.1|4918152_4918665_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_063448628.1|4927414_4927669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084832492.1|4927703_4928003_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_023326334.1|4928253_4929195_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_008501836.1|4929239_4929677_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP012163	Enterobacter roggenkampii strain 35734 plasmid p35734-109.753kb, complete sequence	109753	4910	67309	109753	transposase,integrase	Escherichia_phage(26.67%)	53	14512:14564	67310:67362
WP_004152397.1|4910_6230_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152396.1|6479_7361_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152394.1|7747_8527_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152392.1|9656_12686_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|12795_14511_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
14512:14564	attL	ATTTTCATCATACGGAATGACGGAATTTTCTGGGATTCCCGCTTAGAACCCCA	NA	NA	NA	NA
WP_000509966.1|15380_15986_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004194048.1|16645_17827_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000091613.1|18253_18568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|18822_19179_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|19168_19570_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|19566_19857_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003100881.1|19931_22898_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_157877506.1|22976_23177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016162063.1|23213_23918_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_000427623.1|24044_25049_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_017694781.1|25758_26049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017694271.1|26102_26786_-	ParA family protein	NA	NA	NA	NA	NA
WP_087451024.1|27236_28356_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_032666417.1|28693_29185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017694266.1|29679_29919_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	52.6	1.6e-18
WP_032666420.1|30368_30800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032666421.1|30831_31359_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	38.2	3.3e-21
WP_032666422.1|31351_32098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032666423.1|32112_34020_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_032666424.1|34728_35121_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_032666425.1|35117_37319_-	type IA DNA topoisomerase	NA	NA	NA	NA	NA
WP_032666426.1|37315_37624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032666427.1|37599_37935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000683352.1|37961_38279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050010006.1|38369_38771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044598044.1|38757_39807_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_032666428.1|39810_41007_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_001045307.1|41003_41897_-	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_001293055.1|41889_42576_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_032666429.1|42785_43793_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000769859.1|43810_44095_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_088555714.1|44106_44817_-	type IV secretion system protein VirB5	NA	NA	NA	NA	NA
WP_017694776.1|44841_47592_-	ATPase	NA	NA	NA	NA	NA
WP_050010005.1|47601_47901_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_000958205.1|47911_48574_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_001112907.1|48576_48792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032666431.1|48784_49093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077950058.1|49406_50321_+	response regulator	NA	NA	NA	NA	NA
WP_032666432.1|50324_51308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032666433.1|51300_51789_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032666434.1|51785_53504_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	28.0	2.1e-27
WP_017694275.1|54100_54463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152397.1|57709_59029_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152396.1|59278_60160_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152394.1|60546_61326_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|61322_62348_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|62454_65484_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|65593_67309_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
67310:67362	attR	ATTTTCATCATACGGAATGACGGAATTTTCTGGGATTCCCGCTTAGAACCCCA	NA	NA	NA	NA
