The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009274	Klebsiella variicola strain DX120E chromosome, complete genome	5501013	1645169	1652095	5501013	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_008804073.1|1645169_1646033_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.9	6.9e-08
WP_016161506.1|1646043_1646817_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.0e-26
WP_008804075.1|1647056_1647953_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	3.6e-15
WP_008804076.1|1648195_1649557_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.0e-207
WP_004201558.1|1649873_1650596_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_012541063.1|1650592_1652095_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.6e-30
>prophage 2
NZ_CP009274	Klebsiella variicola strain DX120E chromosome, complete genome	5501013	1694305	1706582	5501013		Enterobacteria_phage(22.22%)	11	NA	NA
WP_000043542.1|1694305_1695712_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_032736000.1|1695934_1696999_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.0e-105
WP_032735999.1|1697025_1697895_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	7.5e-111
WP_004206787.1|1697926_1698817_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	3.7e-28
WP_023297948.1|1698831_1699386_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	5.0e-52
WP_000704907.1|1699567_1700734_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_004144151.1|1701156_1701279_-	small membrane protein	NA	NA	NA	NA	NA
WP_071983253.1|1701415_1701610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008804104.1|1701678_1702683_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	1.2e-30
WP_039104127.1|1703760_1705176_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.6	1.2e-52
WP_012967600.1|1705199_1706582_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.8	4.2e-31
>prophage 3
NZ_CP009274	Klebsiella variicola strain DX120E chromosome, complete genome	5501013	1813608	1851189	5501013	terminase,protease,integrase,portal,tail,holin	Klebsiella_phage(23.68%)	47	1813434:1813493	1856781:1856845
1813434:1813493	attL	CCGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCG	NA	NA	NA	NA
WP_004184758.1|1813608_1814601_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	4.9e-175
WP_004184757.1|1814602_1814830_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	1.1e-29
WP_039104070.1|1815137_1815566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039104069.1|1815562_1815943_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	92.8	1.6e-62
WP_039104067.1|1815942_1816602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039104065.1|1816598_1817348_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_039104063.1|1817826_1818612_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.0	1.3e-61
WP_032437708.1|1818611_1818911_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	48.6	8.5e-14
WP_039104060.1|1819768_1820464_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	2.7e-87
WP_001191665.1|1820561_1820804_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_000230161.1|1820838_1821300_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	3.8e-69
WP_023317571.1|1821537_1821750_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
WP_039104057.1|1821706_1822621_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.4e-30
WP_039104055.1|1822617_1823427_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	9.1e-111
WP_000779146.1|1823436_1823814_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_039104053.1|1823826_1824807_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	67.8	4.9e-135
WP_039104051.1|1824825_1825167_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	78.2	2.4e-49
WP_071983260.1|1825209_1826259_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_128205800.1|1826262_1826835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039104049.1|1826831_1827545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024176410.1|1828376_1828676_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_032695797.1|1828672_1829212_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	1.5e-101
WP_039104046.1|1829208_1829556_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	82.6	9.5e-41
WP_039104044.1|1829552_1829828_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	68.5	1.7e-24
WP_065912073.1|1829778_1829964_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	2.0e-21
WP_039104040.1|1830281_1830485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039104038.1|1830603_1830849_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	4.2e-35
WP_107334310.1|1831074_1831335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228567.1|1831908_1832400_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
WP_039104036.1|1832399_1834508_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.2	0.0e+00
WP_020317294.1|1834504_1834720_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	7.7e-25
WP_020317329.1|1834716_1836216_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
WP_039104034.1|1836160_1838176_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.5	0.0e+00
WP_014228572.1|1838256_1838583_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.4	1.4e-33
WP_020317349.1|1838575_1838869_+	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_020317346.1|1838858_1839410_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.9	5.3e-54
WP_039104031.1|1839406_1839805_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	1.9e-40
WP_023304948.1|1839812_1840295_+	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
WP_039104029.1|1840337_1840733_+|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	28.2	8.3e-09
WP_032420719.1|1840753_1841071_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_039104025.1|1841051_1843748_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.6	2.2e-201
WP_039104023.1|1843747_1844221_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.5	1.3e-53
WP_039104022.1|1844207_1844690_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	68.4	5.0e-56
WP_039104020.1|1844697_1845084_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	51.6	7.3e-34
WP_039104018.1|1845080_1848149_+	kinase	NA	A0A286S259	Klebsiella_phage	66.0	0.0e+00
WP_039104017.1|1848224_1850417_+	hypothetical protein	NA	A0A2H4YH15	Raoultella_phage	39.9	5.4e-97
WP_039104015.1|1850406_1851189_+	hypothetical protein	NA	A0A2H4YHE3	Raoultella_phage	30.2	3.0e-18
1856781:1856845	attR	CCGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCACT	NA	NA	NA	NA
>prophage 4
NZ_CP009274	Klebsiella variicola strain DX120E chromosome, complete genome	5501013	2166128	2180426	5501013	integrase	Salmonella_phage(41.18%)	21	2163792:2163805	2177119:2177132
2163792:2163805	attL	CGCGCTGGCGGCGA	NA	NA	NA	NA
WP_032741145.1|2166128_2167376_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	48.4	2.1e-114
WP_012967855.1|2167375_2167591_-	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	54.9	7.7e-17
WP_004184543.1|2167655_2167895_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	73.1	2.9e-25
WP_032421501.1|2167902_2168211_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	57.8	1.1e-24
WP_039103898.1|2168207_2168858_-	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	44.5	7.2e-42
WP_032421692.1|2168892_2170002_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	87.0	9.1e-186
WP_039103895.1|2170014_2173056_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	60.9	4.9e-298
WP_023282477.1|2173193_2173349_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
WP_039103893.1|2173358_2173550_-	YebW family protein	NA	NA	NA	NA	NA
WP_039103891.1|2174091_2174370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039103890.1|2174467_2174926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039103888.1|2175087_2175501_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	79.0	9.5e-48
WP_039103886.1|2175570_2175798_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	63.5	4.2e-21
WP_039103884.1|2175800_2176337_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.6	9.8e-61
WP_039104307.1|2176465_2177260_+	ParB/RepB/Spo0J family partition protein	NA	C7BGF1	Burkholderia_phage	51.3	6.3e-64
2177119:2177132	attR	TCGCCGCCAGCGCG	NA	NA	NA	NA
WP_039104305.1|2177325_2178171_+	hypothetical protein	NA	S5MC07	Escherichia_phage	52.2	1.5e-23
WP_039103883.1|2178173_2178923_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	81.5	3.5e-117
WP_039103881.1|2178930_2179275_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.6	2.3e-10
WP_052251491.1|2179258_2179729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039103879.1|2179725_2180208_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	83.2	5.3e-74
WP_039103878.1|2180204_2180426_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.0	1.0e-11
>prophage 5
NZ_CP009274	Klebsiella variicola strain DX120E chromosome, complete genome	5501013	2185294	2215705	5501013	terminase,coat,tail,holin	Escherichia_phage(31.03%)	40	NA	NA
WP_071983264.1|2185294_2185537_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	60.0	1.2e-18
WP_039103870.1|2185572_2186169_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	78.6	9.4e-89
WP_039103868.1|2186168_2186375_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	72.7	4.8e-24
WP_004184498.1|2186377_2186674_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	75.0	4.1e-37
WP_039103866.1|2186670_2187486_+	molecular chaperone	NA	A0A1B5FPA5	Escherichia_phage	70.1	1.8e-106
WP_023289577.1|2187767_2188067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039103864.1|2188214_2188574_-	hypothetical protein	NA	D5GW25	Campylobacter_virus	34.0	5.8e-09
WP_039103863.1|2188852_2189128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158514487.1|2189605_2189764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213330.1|2190400_2190796_+	membrane protein	NA	G8C7V8	Escherichia_phage	73.1	1.5e-45
WP_012967892.1|2190782_2191064_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	72.0	3.8e-32
WP_039103860.1|2191063_2191690_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	76.8	4.4e-89
WP_012967895.1|2191895_2192078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032735912.1|2192163_2192448_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	74.5	8.6e-32
WP_110227683.1|2192545_2192818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139015922.1|2193125_2193245_-	small membrane protein	NA	NA	NA	NA	NA
WP_032735910.1|2193798_2194158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184480.1|2195433_2195679_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	1.6e-34
WP_038421381.1|2196237_2197233_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.8	1.3e-34
WP_039103857.1|2197210_2198515_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.3	3.7e-146
WP_039103855.1|2198519_2199944_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.7	2.0e-193
WP_039103853.1|2199927_2201040_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	54.1	1.8e-109
WP_024359389.1|2201146_2201911_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	59.4	1.4e-76
WP_039103850.1|2201998_2203135_+|coat	coat protein	coat	G8C7P7	Escherichia_phage	76.5	4.8e-158
WP_016160819.1|2203174_2203387_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	53.7	4.5e-09
WP_039103848.1|2203390_2203801_+	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	38.2	3.9e-09
WP_071983265.1|2203802_2204036_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	51.5	2.1e-12
WP_039104301.1|2204022_2204406_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	44.4	3.5e-20
WP_039103846.1|2204407_2204959_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	5.9e-29
WP_039103844.1|2204955_2205348_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_039103842.1|2205371_2206304_+	hypothetical protein	NA	A0A0D4DBN5	Acinetobacter_phage	26.6	2.8e-23
WP_023159435.1|2206341_2206824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145940796.1|2206961_2207159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077253596.1|2207253_2207595_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	43.3	2.6e-06
WP_039103838.1|2207696_2210576_+|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.9	3.5e-104
WP_015958316.1|2210659_2210995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023313121.1|2211306_2211780_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.6	8.6e-61
WP_039103836.1|2211766_2212249_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.2	1.8e-82
WP_039103834.1|2212259_2212640_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	95.2	2.4e-69
WP_039103831.1|2212636_2215705_+	kinase	NA	A0A286S259	Klebsiella_phage	97.1	0.0e+00
>prophage 6
NZ_CP009274	Klebsiella variicola strain DX120E chromosome, complete genome	5501013	2866354	2875762	5501013		Escherichia_phage(87.5%)	9	NA	NA
WP_162493260.1|2866354_2867989_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.5	2.6e-181
WP_012968277.1|2868043_2869309_+	MFS transporter	NA	NA	NA	NA	NA
WP_023340104.1|2869339_2870428_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	97.8	9.1e-207
WP_008804980.1|2870514_2870775_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	95.3	3.0e-39
WP_039103359.1|2871069_2871930_+	class A beta-lactamase LEN-17	NA	A0A077SL40	Escherichia_phage	90.9	1.8e-144
WP_008804982.1|2871947_2872709_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.2	2.1e-133
WP_032733005.1|2872969_2873872_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.0	9.4e-157
WP_032730293.1|2873883_2875149_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	97.6	2.0e-229
WP_012541792.1|2875141_2875762_+	aldolase	NA	A0A077SK32	Escherichia_phage	98.1	5.7e-113
>prophage 7
NZ_CP009274	Klebsiella variicola strain DX120E chromosome, complete genome	5501013	3380949	3412204	5501013	integrase,lysis,tail	Salmonella_phage(20.83%)	40	3382962:3382976	3416277:3416291
WP_023289196.1|3380949_3382008_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.1	6.1e-14
WP_039104252.1|3382430_3383381_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	56.4	2.0e-96
3382962:3382976	attL	GGTCGATGATGCTGT	NA	NA	NA	NA
WP_012542161.1|3383831_3384539_-	peptidase P60	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	45.4	1.3e-60
WP_039103083.1|3384541_3385291_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	57.2	2.0e-83
WP_039103082.1|3385383_3385743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039103081.1|3385755_3386106_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	7.6e-22
WP_039103080.1|3386105_3389102_-|tail	phage tail tape measure protein	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	25.8	5.2e-34
WP_016160678.1|3389330_3389675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039103079.1|3389689_3390157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039104250.1|3390177_3390579_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	61.1	7.4e-37
WP_039103078.1|3390595_3390976_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	66.9	8.8e-40
WP_023289182.1|3391772_3391997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023289181.1|3392035_3392473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3393421_3393772_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_023317653.1|3393768_3394266_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.2	3.7e-78
WP_016160648.1|3394265_3394481_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_139042930.1|3395398_3395518_+	small membrane protein	NA	NA	NA	NA	NA
WP_128316005.1|3396286_3396490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039103077.1|3396732_3397335_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.9e-76
WP_039103076.1|3397351_3398383_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	1.2e-96
WP_023289175.1|3398582_3398975_-	hypothetical protein	NA	K7PHB4	Enterobacterial_phage	35.6	1.0e-11
WP_077256314.1|3399015_3399306_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
WP_039103075.1|3399317_3399551_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	64.9	2.3e-22
WP_145940800.1|3400000_3401086_+	hypothetical protein	NA	Q684B3	Sulfolobus_virus	25.7	2.6e-12
WP_145940801.1|3401096_3402140_+	AAA family ATPase	NA	Q56VQ0	Pseudomonas_phage	25.4	4.3e-12
WP_071983293.1|3402143_3403013_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_039103074.1|3403193_3403538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039104246.1|3403534_3403798_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039104244.1|3403847_3404312_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	71.5	4.1e-63
WP_077269953.1|3404304_3405309_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.9	4.3e-33
WP_039103073.1|3405368_3405923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004147982.1|3405925_3406147_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	75.3	1.2e-28
WP_004147981.1|3406417_3406672_+	hypothetical protein	NA	H6WRX4	Salmonella_phage	54.8	1.6e-13
WP_052251466.1|3406993_3407236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145940802.1|3407294_3407690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039103071.1|3407936_3408131_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3408173_3408518_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_039103070.1|3408659_3410798_+	exonuclease	NA	H6WRX1	Salmonella_phage	42.9	1.1e-99
WP_012542206.1|3410850_3411096_+	excisionase	NA	NA	NA	NA	NA
WP_023328117.1|3411076_3412204_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
3416277:3416291	attR	ACAGCATCATCGACC	NA	NA	NA	NA
>prophage 8
NZ_CP009274	Klebsiella variicola strain DX120E chromosome, complete genome	5501013	3664690	3739780	5501013	terminase,protease,integrase,tRNA,portal,head,capsid,tail,holin	Cronobacter_phage(55.81%)	79	3708505:3708525	3739858:3739878
WP_023297317.1|3664690_3666412_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	4.5e-14
WP_162493280.1|3666433_3667156_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3667507_3667726_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012542332.1|3667844_3670124_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	3.7e-165
WP_002896520.1|3670154_3670472_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3670797_3671019_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_039103032.1|3671085_3673026_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	2.9e-38
WP_008805838.1|3673022_3674138_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_008805837.1|3674275_3675934_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3676353_3677049_+	aquaporin Z	NA	NA	NA	NA	NA
WP_032732737.1|3677164_3678064_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_012968625.1|3678207_3679860_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_032732736.1|3679870_3680839_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_016160554.1|3681046_3681481_-	DoxX family protein	NA	NA	NA	NA	NA
WP_008805831.1|3681632_3683351_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_023297312.1|3683389_3684391_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_039103030.1|3684401_3685844_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_008805828.1|3685931_3686945_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008805827.1|3686941_3687772_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	2.4e-05
WP_016160551.1|3687803_3688943_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_008805825.1|3689304_3689577_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_012968629.1|3689831_3690347_+	lipoprotein	NA	NA	NA	NA	NA
WP_012968630.1|3690573_3691302_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	2.7e-29
WP_002896390.1|3691322_3692054_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3692060_3692777_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_008805822.1|3692776_3693445_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_008805821.1|3693629_3694361_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039103029.1|3694444_3695917_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.4	6.7e-27
WP_012542345.1|3695913_3696630_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	4.0e-33
WP_039103028.1|3696708_3697836_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	26.2	6.1e-20
WP_008805817.1|3697877_3698366_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3698423_3699269_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_008805816.1|3699265_3700219_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_008805815.1|3700229_3701396_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	3.0e-30
WP_002896368.1|3701526_3702639_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3702987_3703467_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_012542349.1|3703555_3704458_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.5	7.0e-35
WP_022065296.1|3704572_3705295_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_008805812.1|3705278_3705566_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3705768_3706032_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_008805811.1|3706038_3706422_-	membrane protein	NA	NA	NA	NA	NA
WP_008805810.1|3706689_3708375_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_012542352.1|3708366_3708489_-	hypothetical protein	NA	NA	NA	NA	NA
3708505:3708525	attL	ATGGGTTTTTTGTTGCCTGAA	NA	NA	NA	NA
WP_039103027.1|3708615_3709734_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_145940804.1|3710029_3710305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039103026.1|3710405_3712085_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	59.2	2.0e-189
WP_039103025.1|3712088_3712640_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	68.9	5.7e-56
WP_039103024.1|3712611_3713337_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	47.5	1.0e-52
WP_039103022.1|3713336_3713576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052251464.1|3713598_3716211_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	60.5	1.3e-94
WP_039103021.1|3716219_3716858_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	70.9	1.0e-72
WP_039103020.1|3716850_3718035_-	phage protein	NA	F1BUK6	Cronobacter_phage	76.0	6.5e-174
WP_039103019.1|3718031_3718361_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	4.9e-39
WP_039103018.1|3718357_3720241_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	60.1	2.1e-222
WP_039103017.1|3720428_3720692_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	56.5	7.0e-20
WP_039103015.1|3720838_3721171_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	5.7e-35
WP_039103014.1|3721170_3721512_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	90.1	3.8e-50
WP_039103013.1|3721508_3721799_-|holin	holin	holin	C7BGD7	Burkholderia_phage	50.6	8.8e-16
WP_039103012.1|3721808_3722267_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	74.7	3.9e-58
WP_039103011.1|3722263_3723382_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	71.2	8.1e-150
WP_039103010.1|3723368_3724085_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	73.5	9.3e-91
WP_039103009.1|3724084_3724588_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	64.2	4.5e-60
WP_039103008.1|3724584_3725037_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.0	3.9e-63
WP_039103007.1|3725133_3725835_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	62.9	1.7e-81
WP_039103006.1|3725837_3726860_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	80.0	7.6e-155
WP_039103005.1|3726921_3727716_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	59.0	4.1e-63
WP_039103004.1|3727888_3729661_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	81.6	7.0e-289
WP_039103003.1|3729657_3730707_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	75.7	1.5e-153
WP_039103002.1|3730703_3731027_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	86.0	1.7e-44
WP_052251462.1|3731326_3733393_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	57.4	8.4e-201
WP_039103001.1|3733389_3734247_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	80.3	3.0e-128
WP_039103000.1|3734237_3734471_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_052251460.1|3734536_3734734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032411117.1|3734733_3735162_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	50.4	1.8e-25
WP_039102999.1|3735354_3735858_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	69.5	1.8e-56
WP_071983319.1|3735894_3736113_-	regulator	NA	NA	NA	NA	NA
WP_039102998.1|3736241_3736805_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	40.2	1.7e-34
WP_039102997.1|3738068_3738650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162493329.1|3738835_3739780_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	53.4	2.6e-88
3739858:3739878	attR	ATGGGTTTTTTGTTGCCTGAA	NA	NA	NA	NA
>prophage 9
NZ_CP009274	Klebsiella variicola strain DX120E chromosome, complete genome	5501013	4868245	4874060	5501013		Enterobacteria_phage(100.0%)	8	NA	NA
WP_039102776.1|4868245_4870579_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.0	0.0e+00
WP_014837515.1|4870590_4870911_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_039102775.1|4870907_4871135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162493346.1|4871131_4871677_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.3	3.3e-32
WP_039102774.1|4871679_4871946_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	4.4e-30
WP_039102773.1|4872496_4873234_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.8	2.9e-71
WP_004098164.1|4873230_4873476_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	5.0e-20
WP_039102772.1|4873493_4874060_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	1.3e-58
>prophage 1
NZ_CP009275	Klebsiella variicola strain DX120E plasmid pKV1, complete sequence	162706	47206	55683	162706	integrase	Macacine_betaherpesvirus(50.0%)	6	44760:44773	52454:52467
44760:44773	attL	AAGAGTGAATCTGA	NA	NA	NA	NA
WP_001515717.1|47206_47947_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_032740675.1|48729_49740_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.6	8.8e-87
WP_000523815.1|50481_51648_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.8e-224
WP_032740676.1|51647_52613_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	88.8	1.2e-154
52454:52467	attR	AAGAGTGAATCTGA	NA	NA	NA	NA
WP_040107907.1|53922_54312_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	8.7e-27
WP_032740678.1|54393_55683_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	52.8	5.9e-120
>prophage 1
NZ_CP009276	Klebsiella variicola strain DX120E plasmid pKV2, complete sequence	54715	10	51047	54715	portal,terminase,capsid,head,tail	Klebsiella_phage(86.96%)	48	NA	NA
WP_023339381.1|10_1174_+	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
WP_040108014.1|1176_2142_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	86.9	8.5e-156
WP_040108017.1|2219_3653_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	48.9	3.4e-84
WP_158514516.1|3714_16599_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	48.1	0.0e+00
WP_014228919.1|16661_17273_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	72.5	5.3e-71
WP_021462612.1|17287_17638_-	hypothetical protein	NA	K7PLP0	Enterobacteria_phage	38.1	3.9e-10
WP_017880253.1|17669_18380_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.3	8.5e-137
WP_040108021.1|18381_19137_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	79.3	4.4e-123
WP_014228916.1|19133_19472_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	8.3e-58
WP_040108023.1|19471_22807_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.1	0.0e+00
WP_014228914.1|23039_23405_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_014228913.1|23461_23923_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_021462608.1|23954_24356_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	93.2	1.1e-61
WP_032432816.1|24352_24742_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_014228910.1|24722_25061_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_020317538.1|25057_25375_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_040108032.1|25355_25670_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	79.2	1.3e-17
WP_040108035.1|25728_27015_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	84.6	7.7e-205
WP_040108038.1|27092_28013_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	2.1e-148
WP_040108041.1|28049_29309_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	3.6e-223
WP_040108048.1|29481_31191_-|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	94.9	0.0e+00
WP_032408957.1|31225_31660_-|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	95.8	2.4e-73
WP_077254208.1|32162_32594_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	60.6	2.6e-40
WP_023339407.1|32590_32875_-	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	37.5	2.4e-05
WP_032414214.1|32871_33234_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	92.5	7.8e-62
WP_052251518.1|33217_34489_-	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	37.4	1.2e-35
WP_032408961.1|34729_35029_-	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	96.0	3.0e-51
WP_117037470.1|35140_35335_-	hypothetical protein	NA	Q6UAS6	Klebsiella_phage	89.5	1.5e-19
WP_040108053.1|35282_35759_-	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.1	3.9e-61
WP_040108055.1|35775_36267_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.2	3.2e-82
WP_023339388.1|36263_36575_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	89.1	6.3e-44
WP_023339389.1|36633_37695_-	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	93.2	1.6e-171
WP_032408967.1|38012_38240_-	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
WP_023339391.1|38251_38473_-	hypothetical protein	NA	O64358	Escherichia_phage	90.4	3.0e-32
WP_023339392.1|38643_38952_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
WP_023339393.1|38951_39239_+	helix-turn-helix transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
WP_023339395.1|39590_39818_-	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
WP_032408968.1|39838_40165_-	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	3.9e-52
WP_023339397.1|40157_40403_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	83.1	5.1e-25
WP_040108063.1|41003_41612_-	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.0	2.5e-97
WP_032408971.1|42023_42761_-	phage antitermination Q family protein	NA	Q6UAU4	Klebsiella_phage	84.5	2.2e-119
WP_032408972.1|42750_42960_-	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
WP_032413541.1|43040_43649_+	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	92.1	2.8e-104
WP_040108069.1|43900_47905_+	origin of replication-binding family protein	NA	A0A2I6TD01	Escherichia_phage	81.3	0.0e+00
WP_040108071.1|47897_48194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040108074.1|48190_48541_+	hypothetical protein	NA	O64343	Escherichia_phage	76.7	3.3e-49
WP_077268490.1|49220_50354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032413547.1|50882_51047_+	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	96.3	2.8e-19
