The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006738	Klebsiella pneumoniae HK787 chromosome, complete genome	5329385	1327254	1341976	5329385	tail,integrase	Morganella_phage(50.0%)	18	1327007:1327027	1347071:1347091
1327007:1327027	attL	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
WP_032424540.1|1327254_1328508_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.4	7.2e-147
WP_004213158.1|1328603_1329611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213159.1|1329741_1329960_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004213160.1|1329959_1330394_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.3	2.4e-25
WP_004213161.1|1330407_1331010_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	57.8	1.2e-54
WP_004213162.1|1331009_1331189_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_023302683.1|1331185_1332151_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	44.3	3.9e-07
WP_004213165.1|1332147_1332651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213166.1|1332647_1332857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213167.1|1332853_1333480_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.6e-25
WP_004213168.1|1333489_1333840_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.0	3.4e-38
WP_004213169.1|1333832_1336595_+	TOPRIM and DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.1	2.8e-292
WP_032424539.1|1336934_1337381_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_004213171.1|1337361_1337745_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004213172.1|1337749_1338223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213173.1|1338406_1338577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213174.1|1338576_1338903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213175.1|1338910_1341976_+|tail	phage tail length tape measure family protein	tail	B1GS57	Salmonella_phage	40.5	2.0e-94
1347071:1347091	attR	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
>prophage 2
NZ_CP006738	Klebsiella pneumoniae HK787 chromosome, complete genome	5329385	1683963	1690868	5329385	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1683963_1684827_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004214747.1|1684837_1685611_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
WP_004151134.1|1685851_1686748_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1686990_1688352_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004201558.1|1688670_1689393_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004214740.1|1689389_1690868_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
>prophage 3
NZ_CP006738	Klebsiella pneumoniae HK787 chromosome, complete genome	5329385	2722872	2733759	5329385		Escherichia_phage(87.5%)	9	NA	NA
WP_004209809.1|2722872_2725980_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
WP_004176258.1|2726034_2727300_+	MFS transporter	NA	NA	NA	NA	NA
WP_004209813.1|2727330_2728419_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.0e-210
WP_004176262.1|2728505_2728766_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|2729063_2729924_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004209817.1|2729944_2730706_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.6	5.5e-134
WP_002903955.1|2730966_2731869_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004183946.1|2731880_2733146_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002210516.1|2733138_2733759_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
NZ_CP006738	Klebsiella pneumoniae HK787 chromosome, complete genome	5329385	2768967	2849377	5329385	tail,portal,transposase,holin,capsid,protease,integrase,terminase,head	Klebsiella_phage(20.93%)	88	2794583:2794599	2827340:2827356
WP_004209779.1|2768967_2769780_+|protease	serine protease	protease	NA	NA	NA	NA
WP_002903685.1|2769793_2769910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903683.1|2769953_2770283_-	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
WP_002903681.1|2770269_2770632_-	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
WP_002903679.1|2771074_2772109_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002903677.1|2772333_2773989_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_004143107.1|2773988_2774831_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_002903639.1|2774848_2775148_+	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_004143105.1|2775140_2775974_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_004209782.1|2775973_2776774_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_004209783.1|2776910_2777870_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
WP_004209784.1|2777873_2778491_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_004209787.1|2778490_2779393_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_004148289.1|2779382_2780309_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022615525.1|2780466_2782122_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_004209791.1|2782386_2783307_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_004179716.1|2783470_2783827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004183910.1|2783982_2785599_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004176303.1|2785595_2786315_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_004209794.1|2786295_2787246_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_004209796.1|2787313_2790091_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.0	6.8e-65
WP_004148278.1|2790733_2792245_+	anion permease	NA	NA	NA	NA	NA
WP_004152246.1|2792299_2793952_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_023302609.1|2794114_2795731_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
2794583:2794599	attL	CTGCTGCTGGCGCTGTT	NA	NA	NA	NA
WP_004143067.1|2796770_2797160_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_004215412.1|2797152_2797917_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_020316475.1|2797906_2799259_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_004214878.1|2799268_2800471_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_004176317.1|2800481_2801138_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_002903522.1|2801148_2801835_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_004151560.1|2802004_2802811_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143055.1|2802807_2803371_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_004148273.1|2803472_2804381_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004214881.1|2804547_2805858_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_004176321.1|2805857_2807303_+	amidohydrolase	NA	NA	NA	NA	NA
WP_022615523.1|2807422_2808541_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_004214887.1|2808669_2809770_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	8.3e-115
WP_004214894.1|2810971_2811271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022615522.1|2811438_2812083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022615521.1|2812138_2812873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039108567.1|2812885_2815039_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.2	4.8e-90
WP_016530179.1|2815111_2818189_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	61.5	0.0e+00
WP_022615519.1|2818185_2818566_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
WP_004864228.1|2818578_2819055_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004177132.1|2819041_2819515_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_039108569.1|2819535_2822925_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	60.5	0.0e+00
WP_016530182.1|2822985_2823219_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_016530183.1|2823292_2823598_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_016530184.1|2823600_2824005_-|tail	phage tail assembly chaperone	tail	K7PKV6	Enterobacterial_phage	57.4	3.2e-32
WP_016530185.1|2824035_2824740_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	67.4	6.6e-81
WP_016530186.1|2824796_2825144_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_016530187.1|2825140_2825590_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	7.4e-62
WP_016530188.1|2825586_2825925_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	7.8e-40
WP_016530189.1|2825933_2826251_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	51.0	1.8e-22
WP_023284978.1|2826328_2827567_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.4	1.8e-158
2827340:2827356	attR	CTGCTGCTGGCGCTGTT	NA	NA	NA	NA
WP_000999827.1|2827576_2828176_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_016530190.1|2828168_2829395_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
WP_025108055.1|2829542_2831294_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.5	4.0e-252
WP_016530193.1|2831297_2831795_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	73.9	5.7e-63
WP_023317581.1|2831952_2832303_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	81.6	4.6e-51
WP_039108578.1|2832404_2832806_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_039108580.1|2832881_2833127_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	91.4	4.8e-31
WP_039108582.1|2833446_2833638_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	94.6	3.4e-24
WP_039108585.1|2833588_2833864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039108587.1|2833860_2834208_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	2.0e-38
WP_039108588.1|2834204_2834744_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	97.2	4.8e-100
WP_024176410.1|2834740_2835040_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_125330507.1|2835855_2836182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004886669.1|2836449_2837271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004886665.1|2837295_2837781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004886660.1|2837829_2838171_-	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	2.5e-54
WP_039108593.1|2838189_2839170_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.1e-134
WP_000779146.1|2839182_2839560_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_039108595.1|2839569_2840379_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.5	5.0e-109
WP_039108597.1|2840375_2841314_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	74.2	2.0e-101
WP_004184738.1|2841303_2841483_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	1.6e-15
WP_039108602.1|2841681_2842767_+|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.4e-05
WP_004213338.1|2842821_2843283_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_016530206.1|2843308_2843506_-	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_016530207.1|2843598_2844258_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	62.7	7.3e-74
WP_004213349.1|2845025_2845325_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	9.4e-13
WP_004213351.1|2845324_2846110_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	5.3e-63
WP_004213355.1|2846237_2846582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039108606.1|2846574_2847237_+	morphogenetic protein	NA	Q71T76	Escherichia_phage	56.0	2.2e-54
WP_039108608.1|2847233_2847419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530209.1|2847538_2847799_+	pyocin activator PrtN family protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_002903398.1|2848410_2848569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213367.1|2848861_2849377_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.9	2.0e-23
>prophage 5
NZ_CP006738	Klebsiella pneumoniae HK787 chromosome, complete genome	5329385	3440071	3449535	5329385	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004209699.1|3440071_3441793_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3441837_3442539_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3442892_3443111_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3443231_3445511_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3445541_3445859_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3446184_3446406_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_023302553.1|3446482_3448423_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.2e-36
WP_039108682.1|3448419_3449535_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 6
NZ_CP006738	Klebsiella pneumoniae HK787 chromosome, complete genome	5329385	3929703	3973017	5329385	plate,terminase	Salmonella_phage(35.29%)	65	NA	NA
WP_039108738.1|3929703_3931866_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.1	8.4e-87
WP_114502289.1|3931933_3932119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124044855.1|3932118_3933024_-	hypothetical protein	NA	A0A1I9SEW2	Klebsiella_phage	59.4	1.3e-49
WP_032428613.1|3933023_3933800_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	56.5	8.8e-79
WP_039108741.1|3933796_3934996_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	1.1e-157
WP_004152573.1|3934995_3935349_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_039108743.1|3935350_3936004_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	57.5	1.0e-72
WP_000506882.1|3936091_3936409_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000734772.1|3936439_3936772_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	64.5	3.4e-19
WP_039108746.1|3936768_3937836_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	68.5	4.4e-137
WP_074188356.1|3937838_3938066_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.0	9.6e-18
WP_025269945.1|3938141_3938717_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	66.0	5.0e-63
WP_039108751.1|3938716_3940633_-	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	58.1	3.6e-198
WP_016244729.1|3940622_3940775_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_039108753.1|3940816_3941236_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	65.2	7.4e-40
WP_039108755.1|3941239_3941680_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	78.8	2.1e-61
WP_025269950.1|3941690_3942842_-	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	81.5	2.1e-177
WP_064144275.1|3942843_3943395_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.9	1.5e-40
WP_039108757.1|3943387_3943792_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	72.3	3.7e-44
WP_025269952.1|3943791_3944298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039108758.1|3944294_3944714_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	9.7e-40
WP_000725700.1|3944682_3944964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038435199.1|3945003_3945945_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.4	1.3e-137
WP_032428595.1|3945956_3946451_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	9.3e-50
WP_039108761.1|3946454_3947657_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.4	7.7e-106
WP_025714257.1|3947708_3948257_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
WP_039108763.1|3948312_3949764_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	7.2e-191
WP_021312714.1|3950001_3951402_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	9.4e-188
WP_020804051.1|3951352_3951841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064347.1|3952176_3952695_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	100.0	2.9e-94
WP_039108769.1|3952979_3953369_-	hypothetical protein	NA	A0A192Y6H8	Salmonella_phage	47.5	4.5e-23
WP_039108771.1|3953365_3953869_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	6.5e-75
WP_004146347.1|3953871_3954186_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_004884209.1|3955161_3955662_-	phage antitermination Q family protein	NA	G8C7V7	Escherichia_phage	91.5	3.3e-87
WP_060613575.1|3955658_3955799_-	YlcG family protein	NA	NA	NA	NA	NA
WP_039108774.1|3955795_3956431_-	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	77.9	2.0e-81
WP_004196828.1|3956423_3956594_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	3.3e-15
WP_039108777.1|3956574_3957042_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.2	2.2e-32
WP_039108779.1|3957396_3957717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052253486.1|3958130_3958802_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	30.0	2.5e-05
WP_029602865.1|3958798_3959092_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_039108784.1|3959091_3959619_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	55.8	4.8e-28
WP_004884201.1|3959611_3959875_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	74.4	6.3e-29
WP_004884208.1|3959871_3960345_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	32.1	9.4e-07
WP_004884186.1|3960341_3960566_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	53.4	4.4e-15
WP_039108787.1|3960562_3960865_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075209545.1|3960864_3962280_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.5	4.6e-182
WP_073545955.1|3962284_3963136_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	56.3	6.9e-85
WP_004151298.1|3963176_3963323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039108790.1|3963408_3963630_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_004191589.1|3963669_3963888_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
WP_004191591.1|3963996_3964656_+	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	62.4	8.3e-70
WP_039108792.1|3965097_3965445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039108794.1|3965651_3965864_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	4.3e-20
WP_074423018.1|3966362_3966488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039108796.1|3966480_3966675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039108798.1|3966763_3967048_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	80.9	6.6e-40
WP_039108801.1|3967064_3967811_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	5.3e-65
WP_039108803.1|3967807_3968431_+	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	59.7	3.1e-58
WP_039108983.1|3968459_3968987_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	3.8e-57
WP_039108805.1|3968983_3969754_+	hypothetical protein	NA	D5LH17	Escherichia_phage	52.0	5.5e-65
WP_023304908.1|3969750_3969969_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.6e-09
WP_039108808.1|3969970_3970186_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	59.6	9.1e-10
WP_071844011.1|3970343_3970679_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004143017.1|3972150_3973017_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
