The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010377	Enterobacter hormaechei subsp. hormaechei strain 34983 chromosome, complete genome	4632074	831014	849754	4632074	head,tail,integrase,terminase,protease,portal,capsid	uncultured_Caudovirales_phage(64.29%)	24	830967:830985	847348:847366
830967:830985	attL	TATCAATCGGTGTATCAAT	NA	NA	NA	NA
WP_039273115.1|831014_832241_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	58.1	7.3e-136
WP_039273118.1|832332_833262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039273123.1|833400_833685_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_039273126.1|833705_834416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032661928.1|834906_835098_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032660562.1|835237_835426_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_039273129.1|835418_835613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032672064.1|835609_835822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032672063.1|835805_837575_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	51.6	6.2e-128
WP_032672062.1|837850_838111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032672061.1|838251_839313_+	hypothetical protein	NA	U5P4L0	Shigella_phage	40.1	6.6e-69
WP_032660547.1|839314_839797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039273134.1|840039_841206_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	98.2	7.7e-212
WP_039273137.1|841257_841818_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	98.4	1.3e-100
WP_032672059.1|841819_843055_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.3	7.4e-237
WP_039273140.1|843067_843391_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	88.8	3.0e-49
WP_039273143.1|843387_843681_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	84.5	7.7e-44
WP_039273146.1|843680_844124_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	88.4	2.0e-75
WP_000113647.1|844399_844756_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_039273150.1|844739_846401_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.2	0.0e+00
WP_072223418.1|846433_847027_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	53.9	2.2e-53
WP_039273155.1|847430_847967_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.3e-17
847348:847366	attR	TATCAATCGGTGTATCAAT	NA	NA	NA	NA
WP_039273157.1|848057_848720_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_003856300.1|848827_849754_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.3	5.3e-22
>prophage 2
NZ_CP010377	Enterobacter hormaechei subsp. hormaechei strain 34983 chromosome, complete genome	4632074	1165738	1199996	4632074	head,lysis,holin,integrase	Salmonella_phage(34.78%)	56	1165679:1165725	1212791:1212837
1165679:1165725	attL	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATT	NA	NA	NA	NA
WP_039273261.1|1165738_1166902_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	99.2	7.0e-229
WP_071882737.1|1166778_1167114_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157844043.1|1167220_1167391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039273263.1|1167387_1167738_-	hypothetical protein	NA	I3PV00	Vibrio_phage	54.8	1.4e-23
WP_039273265.1|1167740_1167956_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	61.4	3.8e-16
WP_039273267.1|1167958_1168468_-	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	48.8	5.0e-38
WP_039273269.1|1168559_1169171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032737341.1|1169167_1169386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039273273.1|1169382_1170042_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	91.8	3.9e-120
WP_006809793.1|1170038_1170191_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	1.3e-05
WP_032667080.1|1170190_1170520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039273276.1|1170540_1171089_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	85.2	6.9e-94
WP_039273279.1|1171097_1171673_-	single-stranded DNA-binding protein SSB1	NA	C6ZR36	Salmonella_phage	58.1	2.5e-54
WP_039273280.1|1171669_1172137_-	hypothetical protein	NA	A0A2I7QWC6	Vibrio_phage	58.7	1.5e-44
WP_039273283.1|1172137_1172863_-	recombinase	NA	B8K1D9	Salmonella_phage	64.9	2.0e-85
WP_157844042.1|1172859_1173018_-	hypothetical protein	NA	I6R9C0	Salmonella_phage	56.5	3.4e-06
WP_039273286.1|1173014_1173212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039273288.1|1173220_1174189_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	87.3	5.0e-71
WP_001752704.1|1174265_1174472_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	100.0	3.6e-32
WP_039273292.1|1174628_1174838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039273294.1|1174987_1175233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023306033.1|1176238_1176436_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	95.3	3.2e-25
WP_032655965.1|1176571_1177519_-	hypothetical protein	NA	A9YX09	Burkholderia_phage	42.3	2.0e-61
WP_052254344.1|1177657_1178299_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	76.8	5.2e-93
WP_039273300.1|1178402_1178618_+	helix-turn-helix transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	80.3	6.3e-27
WP_023300412.1|1178648_1179191_+	regulatory protein CII	NA	M9NZI6	Enterobacteria_phage	87.2	8.6e-81
WP_039273301.1|1179375_1180311_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	90.7	3.8e-76
WP_039273302.1|1180307_1180997_+	phage replication protein P	NA	G8C7U6	Escherichia_phage	94.8	1.1e-125
WP_039273304.1|1180998_1181343_+	helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	93.8	2.5e-54
WP_052254345.1|1181339_1181924_+	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	33.3	2.6e-06
WP_039273306.1|1183357_1183807_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	46.5	1.2e-32
WP_039273307.1|1183799_1183970_+	NinE family protein	NA	G8C7V4	Escherichia_phage	83.9	3.8e-19
WP_039273308.1|1184601_1185291_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	4.2e-56
WP_080320280.1|1185532_1186039_+	HNH endonuclease	NA	A0A2D2W6Q0	Pectobacterium_phage	35.3	1.1e-16
WP_122008274.1|1186601_1186907_+|holin	holin	holin	E7C9S8	Salmonella_phage	86.1	1.1e-43
WP_039273310.1|1186893_1187334_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	69.1	1.1e-49
WP_039273311.1|1187330_1187801_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	57.9	1.4e-39
WP_039273315.1|1187912_1188131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157844041.1|1188127_1188283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039273319.1|1188336_1188975_+	hypothetical protein	NA	I6S676	Salmonella_phage	91.5	1.7e-112
WP_039273320.1|1189006_1189486_+	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	74.2	5.5e-63
WP_039273321.1|1189472_1190951_+	phage DNA Packaging protein	NA	G0ZND4	Cronobacter_phage	87.6	1.2e-257
WP_039273322.1|1190966_1192316_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	91.3	1.9e-238
WP_039273323.1|1192275_1193202_+|head	SPP1 gp7 family phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	90.9	4.9e-161
WP_039273325.1|1193204_1194470_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	89.1	3.6e-215
WP_039273326.1|1194482_1194932_+	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.2	3.2e-65
WP_039273327.1|1194949_1196026_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.9	9.1e-191
WP_039273328.1|1196035_1196329_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	89.7	4.2e-42
WP_039273329.1|1196391_1196793_+	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	79.2	3.0e-54
WP_039273331.1|1196792_1196963_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	48.2	6.5e-11
WP_039273333.1|1196959_1197277_+	hypothetical protein	NA	G8GWD9	Rhodobacter_phage	67.4	7.3e-32
WP_039273335.1|1197287_1197638_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.8	4.0e-39
WP_039273337.1|1197640_1198081_+	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	52.6	6.0e-32
WP_032608745.1|1198077_1198461_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	2.3e-40
WP_039273340.1|1198523_1199267_+	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	86.7	5.9e-72
WP_039268935.1|1199324_1199996_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	49.8	7.0e-56
1212791:1212837	attR	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP010377	Enterobacter hormaechei subsp. hormaechei strain 34983 chromosome, complete genome	4632074	1203400	1212613	4632074	tail	Cronobacter_phage(55.56%)	9	NA	NA
WP_006808943.1|1203400_1203898_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	91.5	1.2e-89
WP_006808942.1|1203897_1204368_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	93.6	2.4e-79
WP_045284219.1|1204330_1204747_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	87.5	3.4e-69
WP_039273352.1|1204733_1207211_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.6	0.0e+00
WP_080320281.1|1207269_1209384_+	hypothetical protein	NA	C8XUT1	Shigella_phage	74.9	1.3e-286
WP_071882721.1|1209409_1210837_-	hypothetical protein	NA	F1C5A9	Cronobacter_phage	28.0	1.1e-34
WP_039273356.1|1210833_1211751_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	92.4	3.2e-160
WP_039273359.1|1211747_1212110_-	GtrA family protein	NA	U5P0S6	Shigella_phage	84.2	3.4e-49
WP_006809734.1|1212223_1212613_+	hypothetical protein	NA	Q6UAV9	Klebsiella_phage	68.2	2.6e-47
>prophage 4
NZ_CP010377	Enterobacter hormaechei subsp. hormaechei strain 34983 chromosome, complete genome	4632074	2830552	2839739	4632074	transposase	Burkholderia_phage(33.33%)	9	NA	NA
WP_039274063.1|2830552_2832253_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	31.7	2.6e-14
WP_003859574.1|2832337_2832520_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_032673930.1|2832597_2833509_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_006811166.1|2833687_2834602_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_006811167.1|2834573_2835065_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	7.9e-33
WP_006811168.1|2835045_2836479_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.9	1.2e-102
WP_006811169.1|2836522_2837224_-	phosphohydrolase	NA	S4W232	Pandoravirus	29.7	9.6e-08
WP_102765986.1|2837269_2838238_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	7.4e-184
WP_006811170.1|2838575_2839739_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.8	2.4e-112
>prophage 5
NZ_CP010377	Enterobacter hormaechei subsp. hormaechei strain 34983 chromosome, complete genome	4632074	2894224	2903080	4632074		Tupanvirus(28.57%)	8	NA	NA
WP_006811215.1|2894224_2894836_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	3.5e-14
WP_039274093.1|2894874_2895855_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_032673945.1|2896049_2897054_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	3.3e-33
WP_032673946.1|2897103_2898270_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.2	3.1e-112
WP_006811219.1|2898509_2899391_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.4	1.5e-103
WP_006811220.1|2899391_2900477_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.5	5.3e-98
WP_006811221.1|2900566_2901973_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
WP_006811222.1|2902066_2903080_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	50.2	5.3e-92
>prophage 6
NZ_CP010377	Enterobacter hormaechei subsp. hormaechei strain 34983 chromosome, complete genome	4632074	3720854	3778756	4632074	transposase,protease,integrase,tRNA	Salmonella_phage(57.14%)	55	3716712:3716748	3743838:3743874
3716712:3716748	attL	GCCCCTCACCCTAACCCTCTCCCCAAAGGGGAGAGGG	NA	NA	NA	NA
WP_024191970.1|3720854_3722312_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032675471.1|3722311_3724951_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_001567861.1|3724950_3725628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032160195.1|3725662_3725959_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_102765986.1|3726030_3726999_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	7.4e-184
WP_001567862.1|3727757_3728099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567863.1|3728098_3729469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567864.1|3729465_3730554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567865.1|3730686_3731235_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001567866.1|3731273_3732380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006811919.1|3733391_3734789_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_006811920.1|3734848_3735346_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_006811921.1|3735440_3736148_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_017382923.1|3736199_3736931_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_006811923.1|3736962_3737910_+	glutathione synthase	NA	NA	NA	NA	NA
WP_006811924.1|3737984_3738545_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_006811925.1|3738544_3738961_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_006811926.1|3738971_3739952_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_006811927.1|3739969_3740671_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_039274395.1|3740692_3741259_+	YggT family protein	NA	NA	NA	NA	NA
WP_003860023.1|3741255_3741552_+	YggU family protein	NA	NA	NA	NA	NA
WP_006811929.1|3741555_3742149_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_006811930.1|3742141_3743290_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_006811931.1|3743346_3743709_+	endonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_006811932.1|3743882_3744599_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
3743838:3743874	attR	CCCTCTCCCCTTTGGGGAGAGGGTTAGGGTGAGGGGC	NA	NA	NA	NA
WP_003862421.1|3744656_3744983_-	YggL family protein	NA	NA	NA	NA	NA
WP_006811933.1|3744982_3745702_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_006811934.1|3745840_3746899_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_032674044.1|3746925_3747198_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_003862427.1|3747322_3748399_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_006811937.1|3748685_3749942_+	nucleoside permease	NA	NA	NA	NA	NA
WP_001303432.1|3749992_3752128_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_006811938.1|3752309_3753023_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000654811.1|3754442_3755411_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_032674047.1|3757731_3759669_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_006811948.1|3759661_3760993_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	B9UDL7	Salmonella_phage	34.8	8.5e-05
WP_006811949.1|3760989_3761424_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_006811950.1|3761475_3763338_-	bifunctional glutathionylspermidine amidase/synthase	NA	Q56ES0	Aeromonas_virus	23.8	2.6e-20
WP_006811951.1|3763521_3764388_+	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_006811952.1|3764511_3764844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032674145.1|3764959_3765706_+	L-fucose operon activator	NA	NA	NA	NA	NA
WP_039274399.1|3765711_3767259_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	3.3e-08
WP_032674048.1|3767410_3768451_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_006811956.1|3768527_3769016_-	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_001084353.1|3769059_3769563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006811957.1|3769665_3770070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006811958.1|3770071_3770497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006811959.1|3770577_3771003_-	TonB system transport protein ExbD	NA	NA	NA	NA	NA
WP_003862482.1|3771007_3771739_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_032674049.1|3771990_3773178_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_006811961.1|3773320_3773980_+	DedA family protein	NA	NA	NA	NA	NA
WP_006811962.1|3774026_3774926_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_039274403.1|3775121_3776285_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003862493.1|3776390_3777218_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	1.9e-63
WP_102765986.1|3777787_3778756_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	7.4e-184
>prophage 7
NZ_CP010377	Enterobacter hormaechei subsp. hormaechei strain 34983 chromosome, complete genome	4632074	3786446	3831484	4632074	transposase,integrase	uncultured_Caudovirales_phage(33.33%)	34	3800868:3800883	3838749:3838764
WP_000227969.1|3786446_3787523_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016151369.1|3789062_3789413_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	9.6e-41
WP_022649395.1|3791576_3792545_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	6.9e-182
WP_007896426.1|3792698_3794024_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
WP_016151347.1|3795267_3795789_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_023304425.1|3795785_3796739_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_022652364.1|3796825_3799150_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_007898890.1|3799194_3800097_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|3800093_3801092_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
3800868:3800883	attL	CCGGTGGCGTTTATCG	NA	NA	NA	NA
WP_004118246.1|3801088_3802045_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_004152282.1|3802045_3802813_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_007898888.1|3802911_3803205_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_007898884.1|3803535_3803814_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|3804075_3805080_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_007898882.1|3805254_3805680_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.9e-51
WP_007898880.1|3805692_3806982_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.1	4.4e-168
WP_022649397.1|3807026_3807347_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	8.5e-20
WP_007898876.1|3807432_3808131_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	7.7e-90
WP_004206574.1|3808259_3808565_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004206572.1|3808575_3809781_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_016151342.1|3809956_3810535_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	35.5	5.7e-22
WP_000427623.1|3812699_3813704_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_032435706.1|3814107_3815100_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_007851507.1|3815469_3816552_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
WP_007894989.1|3816673_3819748_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
WP_003846917.1|3819799_3821053_+	lactose permease	NA	NA	NA	NA	NA
WP_003846919.1|3821109_3821280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384068.1|3822134_3823268_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_077946840.1|3823619_3824474_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	8.0e-81
WP_039274430.1|3824470_3824755_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017384060.1|3824881_3825310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000654811.1|3827058_3828027_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_007897920.1|3828483_3830250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897923.1|3830236_3831484_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3838749:3838764	attR	CGATAAACGCCACCGG	NA	NA	NA	NA
>prophage 8
NZ_CP010377	Enterobacter hormaechei subsp. hormaechei strain 34983 chromosome, complete genome	4632074	3885192	3907908	4632074	tail,head,integrase,terminase,tRNA,protease,portal,capsid	uncultured_Caudovirales_phage(68.42%)	26	3891372:3891393	3907958:3907979
WP_006812008.1|3885192_3886206_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	2.8e-109
WP_001144069.1|3886442_3886658_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_006812009.1|3886773_3888519_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_006812010.1|3888684_3890529_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_006812011.1|3890623_3891130_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3891372:3891393	attL	CTCTAGGATACCTATAGGATAC	NA	NA	NA	NA
WP_039274451.1|3891774_3892353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039274453.1|3892399_3892750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039274456.1|3892746_3893361_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	67.2	6.8e-66
WP_039274460.1|3893374_3895036_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.6	0.0e+00
WP_039274462.1|3895019_3895376_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	94.1	1.4e-58
WP_039274465.1|3895649_3896093_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	64.6	1.3e-50
WP_039274468.1|3896092_3896386_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	81.4	1.6e-41
WP_023304516.1|3896378_3896717_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	48.6	5.1e-23
WP_039274471.1|3896713_3897949_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	98.0	6.7e-238
WP_039274474.1|3897950_3898511_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	98.4	1.0e-100
WP_039274477.1|3898562_3899729_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.2	1.3e-214
WP_039274480.1|3899987_3900761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063927086.1|3901392_3902757_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	96.7	2.2e-258
WP_039274484.1|3902753_3903122_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	97.5	1.8e-61
WP_006178882.1|3903118_3903340_-	hypothetical protein	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	57.1	3.4e-12
WP_039274485.1|3903332_3903518_-	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	96.7	4.7e-23
WP_023304529.1|3903510_3903723_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	50.9	5.3e-10
WP_039274487.1|3904624_3905404_-	ROK family transcriptional regulator	NA	Q8HA02	Enterobacteria_phage	52.0	4.3e-41
WP_071882736.1|3905412_3905622_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039274849.1|3905764_3906124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039274488.1|3906486_3907908_-|integrase	integrase family protein	integrase	H7BV31	unidentified_phage	27.2	8.8e-08
3907958:3907979	attR	CTCTAGGATACCTATAGGATAC	NA	NA	NA	NA
>prophage 1
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	0	10746	328905		Bacillus_phage(100.0%)	9	NA	NA
WP_015063134.1|1204_1426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015063133.1|1496_3509_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_015063132.1|3586_4714_-	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_032610391.1|4785_5055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652173.1|5093_6146_-	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_022652172.1|6205_7192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652171.1|7252_7630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040115163.1|7688_8564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015063127.1|8937_10746_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	25.9	9.7e-20
>prophage 2
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	25634	26669	328905		Enterobacteria_phage(100.0%)	1	NA	NA
WP_015063116.1|25634_26669_-	ParM	NA	A0A0A7NPX4	Enterobacteria_phage	34.7	6.7e-42
>prophage 3
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	29916	30921	328905		Aeromonas_phage(100.0%)	1	NA	NA
WP_040115168.1|29916_30921_-	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	31.1	1.6e-11
>prophage 4
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	45682	54490	328905		Salmonella_phage(100.0%)	8	NA	NA
WP_015063098.1|45682_46558_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.8	1.0e-59
WP_022652149.1|47099_48173_+	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	34.1	2.9e-11
WP_022652148.1|48190_48391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063095.1|48387_49107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063094.1|49373_50195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063093.1|50209_51055_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	37.8	3.5e-44
WP_040115173.1|51394_52549_+	hypothetical protein	NA	A0A060D5B2	Salmonella_phage	27.8	3.1e-19
WP_040115175.1|52813_54490_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	31.0	4.4e-67
>prophage 5
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	61786	66429	328905		Wolbachia_phage(50.0%)	3	NA	NA
WP_004883035.1|61786_62854_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	32.9	3.7e-35
WP_004883036.1|63093_64341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883039.1|64629_66429_-	ATP-dependent helicase	NA	S5M596	Bacillus_phage	23.5	1.8e-29
>prophage 6
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	71017	79667	328905		Cronobacter_phage(25.0%)	11	NA	NA
WP_004883049.1|71017_71848_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	39.6	8.4e-43
WP_040115180.1|71928_73995_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.0	4.8e-23
WP_004883051.1|74805_75120_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_034138236.1|75159_75426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064717570.1|75422_75716_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_028699139.1|76035_76386_+	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	45.1	1.3e-18
WP_004883055.1|76729_77497_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_004883058.1|77609_77894_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004883059.1|77920_78763_+	RepA replication protein	NA	NA	NA	NA	NA
WP_071526700.1|78777_79032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883061.1|79028_79667_+	AAA family ATPase	NA	B0ZSI1	Halomonas_phage	40.1	1.1e-31
>prophage 7
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	106901	110372	328905		Escherichia_phage(50.0%)	5	NA	NA
WP_022652139.1|106901_107294_-	hypothetical protein	NA	Q71TH9	Escherichia_phage	62.6	1.0e-43
WP_022652138.1|107286_107559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015063087.1|107872_108199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015063086.1|108387_108903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040115182.1|109490_110372_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.3	5.0e-54
>prophage 8
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	114860	116548	328905		Cronobacter_phage(33.33%)	4	NA	NA
WP_015063081.1|114860_115565_-	hypothetical protein	NA	M1EZB9	Cronobacter_phage	27.9	1.8e-17
WP_032610385.1|115643_115943_-	hypothetical protein	NA	A0A2P1JU39	Erwinia_phage	60.0	9.4e-05
WP_022652133.1|115978_116233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652132.1|116284_116548_-	hypothetical protein	NA	A0A076YMQ7	Citrobacter_phage	42.3	1.8e-07
>prophage 9
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	120498	125068	328905		Caulobacter_phage(66.67%)	7	NA	NA
WP_015063076.1|120498_120795_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	36.2	8.4e-06
WP_015063075.1|120803_121985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063074.1|122375_122753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063073.1|122888_123323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077258061.1|123323_123644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063032.1|123759_124395_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	40.4	1.9e-26
WP_022652124.1|124456_125068_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	40.3	5.2e-26
>prophage 10
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	135227	137537	328905	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_015060490.1|135227_135605_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	91.3	2.7e-57
WP_040115192.1|135601_135949_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	5.3e-60
WP_015060488.1|135998_137537_+|transposase	IS66-like element ISSgsp1 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	92.0	5.9e-276
>prophage 11
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	141152	144949	328905	transposase	Shigella_phage(50.0%)	4	NA	NA
WP_085949497.1|141152_142299_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_012561110.1|142496_143333_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_012561111.1|143397_143796_-	VOC family protein	NA	NA	NA	NA	NA
WP_017384070.1|143839_144949_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.3	4.9e-30
>prophage 12
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	155349	157975	328905		Salmonella_phage(66.67%)	5	NA	NA
WP_015063024.1|155349_156081_+	hypothetical protein	NA	Q71T76	Escherichia_phage	56.0	7.3e-67
WP_022652358.1|156077_156386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652357.1|156419_156944_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	62.7	2.8e-44
WP_022652356.1|156974_157583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652355.1|157738_157975_+	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	1.1e-05
>prophage 13
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	165779	168556	328905		Pectobacterium_phage(50.0%)	3	NA	NA
WP_040115203.1|165779_166190_-	hypothetical protein	NA	A0A2D2W6B4	Pectobacterium_phage	45.1	1.9e-11
WP_032610479.1|166189_166444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040115206.1|167350_168556_+	DNA-binding protein	NA	A0A2P9HXK7	Yersinia_phage	27.8	4.5e-13
>prophage 14
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	172309	175822	328905	transposase	Escherichia_phage(33.33%)	4	NA	NA
WP_039273855.1|172309_173290_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.5	6.8e-185
WP_015063010.1|173518_173878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063009.1|173910_174639_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	37.7	3.4e-08
WP_040113315.1|174640_175822_-	S49 family peptidase	NA	A0A2I6UG67	Salinibacter_virus	29.5	7.8e-10
>prophage 15
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	207625	263900	328905	protease,transposase	Escherichia_phage(29.41%)	58	NA	NA
WP_032610457.1|207625_208705_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	5.6e-39
WP_032610456.1|208706_209480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032610455.1|209472_210615_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	34.1	2.5e-29
WP_015062980.1|210624_211683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062979.1|212005_212587_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.6	5.3e-12
WP_015062978.1|212586_213744_+	terA	NA	NA	NA	NA	NA
WP_000007448.1|213766_214222_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|214244_215285_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_015062976.1|215333_215912_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	1.5e-06
WP_015062975.1|215981_216557_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.6	5.6e-30
WP_032610453.1|216615_217266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062974.1|217281_218523_+	terF	NA	NA	NA	NA	NA
WP_032610522.1|218670_219351_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_032610449.1|219664_220294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610521.1|220442_220796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039273855.1|221163_222144_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.5	6.8e-185
WP_040115229.1|222275_223373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103216141.1|223687_223945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016246546.1|224334_224628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016246547.1|224648_224948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062961.1|225263_226202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062960.1|226207_226723_-	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.9	3.2e-08
WP_015062959.1|226945_228373_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	49.4	9.5e-103
WP_032610439.1|228692_230012_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_024191726.1|230025_230229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610436.1|230283_231504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062955.1|231506_232319_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_040113341.1|232819_233485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040115233.1|233522_233975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040115235.1|234086_234491_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_040115239.1|235151_238160_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.2	0.0e+00
WP_040115241.1|238319_238877_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	46.1	3.8e-39
WP_040115243.1|238893_239757_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_043495618.1|239797_240202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043495620.1|240478_240877_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_045284274.1|240881_242090_-	DUF4071 domain-containing protein	NA	NA	NA	NA	NA
WP_080198910.1|242408_242969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040115250.1|242980_243430_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_040115252.1|243491_243896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001243598.1|244355_244820_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_040115255.1|245065_246724_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_040115257.1|246884_247235_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072259269.1|247526_248003_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_016241611.1|248117_248555_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_000626969.1|248715_249177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137910.1|249151_249472_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_000427614.1|249931_250936_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004393997.1|251556_252267_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
WP_040115262.1|252268_253474_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032430843.1|253470_254622_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004393990.1|254618_255227_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022542389.1|255414_256419_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000493286.1|257022_257352_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|257332_257614_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_040115270.1|257891_258872_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_001752509.1|259188_259689_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_001067855.1|260015_260720_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_040115271.1|261860_263900_+	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	26.4	4.6e-26
>prophage 16
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	275367	289049	328905		Wolbachia_phage(33.33%)	14	NA	NA
WP_003092331.1|275367_276432_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	31.3	7.7e-33
WP_003092330.1|276783_277293_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	34.8	1.7e-17
WP_006379607.1|277359_279663_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003092327.1|280208_281036_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	39.6	1.6e-46
WP_000994919.1|281116_283186_+	ParB N-terminal domain-containing protein	NA	G8DH78	Emiliania_huxleyi_virus	26.1	7.7e-21
WP_022580212.1|283247_283457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273857.1|284232_284547_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_006379425.1|284859_285153_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016487838.1|285440_285788_+	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	46.8	6.6e-18
WP_003092318.1|286130_286901_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_001247107.1|287012_287297_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022652188.1|287323_288169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071534288.1|288183_288414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003092312.1|288410_289049_+	AAA family ATPase	NA	A0A2H4JGZ2	uncultured_Caudovirales_phage	40.0	3.5e-33
>prophage 17
NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	328905	294678	295500	328905		Pithovirus(100.0%)	1	NA	NA
WP_023093371.1|294678_295500_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	29.1	4.1e-10
>prophage 1
NZ_CP010378	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence	59134	4384	43746	59134	transposase,integrase,protease	Salmonella_phage(25.0%)	39	9602:9615	19025:19038
WP_001389365.1|4384_5149_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|5655_6156_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|6283_7123_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_012695489.1|7613_8258_+	quinolone resistance pentapeptide repeat protein QnrB2	NA	NA	NA	NA	NA
WP_003833285.1|8299_8752_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
9602:9615	attL	TTTCAGAAGACGGC	NA	NA	NA	NA
WP_001553819.1|10550_13448_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509966.1|13542_14148_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_000259031.1|15672_16512_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|16505_16853_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000470556.1|16957_17248_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_010890144.1|17384_17621_-	trimethoprim-resistant dihydrofolate reductase DfrB3	NA	A0A0F6R7A8	Sinorhizobium_phage	66.7	4.8e-12
WP_000845048.1|17828_18842_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001162012.1|19147_19705_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
19025:19038	attR	GCCGTCTTCTGAAA	NA	NA	NA	NA
WP_001138073.1|19707_22680_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_000427620.1|22758_23763_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000715148.1|24271_24799_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	38.7	1.1e-24
WP_001076634.1|24795_25797_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_000101920.1|25847_26981_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000758230.1|26980_27868_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_001208352.1|27878_28574_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_014014948.1|28792_29830_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000858958.1|29846_30089_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_014014949.1|30098_30800_-	conjugal transfer protein TraC	NA	NA	NA	NA	NA
WP_040115085.1|30815_33389_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_000462629.1|33389_33707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015060075.1|33746_34043_-	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_024562119.1|34289_35072_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000960955.1|35171_35489_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_024562120.1|35492_35843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040115112.1|35953_36178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099156415.1|36202_36490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024562121.1|36774_36960_+	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	57.8	2.6e-05
WP_000275218.1|36956_37565_-	recombinase family protein	NA	NA	NA	NA	NA
WP_032493174.1|37751_38084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085954994.1|38271_39398_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.8	1.4e-48
WP_064754415.1|39667_40297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040115094.1|40483_41365_+	replication protein	NA	NA	NA	NA	NA
WP_040115096.1|41935_42274_+	ArdK family transcriptional regulator	NA	NA	NA	NA	NA
WP_032493169.1|42960_43746_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
