The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010384	Enterobacter hormaechei subsp. xiangfangensis strain 34399 chromosome, complete genome	4784288	934911	942506	4784288	integrase	Enterobacteria_phage(30.0%)	10	927327:927341	953020:953034
927327:927341	attL	ACGGCGTAATCCTGT	NA	NA	NA	NA
WP_003863199.1|934911_935964_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.6e-118
WP_003863197.1|936269_937373_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.7e-59
WP_003863195.1|937384_938638_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	2.3e-97
WP_039268727.1|938839_940003_-|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	95.1	5.0e-219
WP_003863191.1|939879_940230_-	helix-turn-helix domain-containing protein	NA	Q5G8V4	Enterobacteria_phage	95.7	1.5e-57
WP_003863189.1|940232_940442_-	hypothetical protein	NA	A0A220IH74	Escherichia_phage	59.3	2.1e-11
WP_032628143.1|940478_941027_-	hypothetical protein	NA	E5AGD3	Erwinia_phage	35.0	2.3e-20
WP_003863184.1|941035_941236_-	hypothetical protein	NA	G8C7S1	Escherichia_phage	71.2	1.1e-20
WP_022650432.1|941244_942045_-	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	85.0	6.6e-138
WP_022650433.1|942044_942506_-	VUT family protein	NA	A0A2H4N7D9	Pectobacterium_phage	55.7	4.1e-39
953020:953034	attR	ACGGCGTAATCCTGT	NA	NA	NA	NA
>prophage 2
NZ_CP010384	Enterobacter hormaechei subsp. xiangfangensis strain 34399 chromosome, complete genome	4784288	1421484	1452514	4784288	terminase,portal,tail,head,capsid,integrase,holin	Cronobacter_phage(80.65%)	38	1420789:1420803	1429950:1429964
1420789:1420803	attL	GAAGAGGGCAACCGC	NA	NA	NA	NA
WP_003858450.1|1421484_1422003_+	outer membrane protein OmpX	NA	K7PJP9	Enterobacteria_phage	31.4	3.2e-16
WP_022650656.1|1422118_1423702_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_017384915.1|1423971_1424100_-	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_039268748.1|1424266_1425307_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	61.4	4.4e-118
WP_039268749.1|1425307_1425886_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	40.7	1.3e-29
WP_001247709.1|1426005_1426227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039268750.1|1426257_1426761_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	70.1	9.5e-58
WP_039268751.1|1426770_1426965_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_013097409.1|1426954_1427383_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.2	5.8e-24
WP_013097408.1|1427382_1427784_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	54.1	6.0e-39
WP_013097407.1|1427850_1428084_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_039268752.1|1428074_1428941_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	93.6	5.0e-147
WP_032657714.1|1428937_1429150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039268754.1|1431307_1431514_+	hypothetical protein	NA	NA	NA	NA	NA
1429950:1429964	attR	GAAGAGGGCAACCGC	NA	NA	NA	NA
WP_039268756.1|1431487_1431811_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	88.5	1.3e-47
WP_039268757.1|1431807_1432860_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.3	1.5e-158
WP_039268759.1|1432856_1434632_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.1	2.0e-288
WP_039268760.1|1434804_1435602_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	53.1	8.2e-64
WP_039268761.1|1435661_1436684_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	79.1	1.6e-152
WP_039268762.1|1436686_1437388_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	3.3e-85
WP_039268763.1|1437447_1437939_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	78.0	1.4e-58
WP_039268764.1|1437935_1438442_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.7	1.1e-64
WP_039268765.1|1438438_1439146_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	77.8	3.4e-101
WP_039268766.1|1439142_1440270_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.7	4.3e-175
WP_013097392.1|1440266_1440722_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	3.5e-59
WP_039268767.1|1440731_1441025_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.4	6.8e-16
WP_039268768.1|1441021_1441363_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	89.1	5.4e-49
WP_039268770.1|1441362_1441731_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	52.4	3.6e-22
WP_039268771.1|1441850_1442111_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	59.3	2.4e-20
WP_039268772.1|1442298_1444611_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	57.5	3.8e-218
WP_039268773.1|1444607_1444937_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.5	4.6e-37
WP_039268774.1|1444933_1446118_+	phage protein	NA	F1BUK6	Cronobacter_phage	79.0	2.4e-176
WP_039268775.1|1446110_1446698_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	80.5	9.9e-91
WP_080332504.1|1446707_1449164_+	hypothetical protein	NA	F1BUK3	Cronobacter_phage	56.5	1.2e-169
WP_039268777.1|1449165_1449600_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	60.8	5.2e-20
WP_039268779.1|1449589_1450315_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	51.0	1.2e-61
WP_039268780.1|1450286_1450835_+	protein phage	NA	F1BUJ9	Cronobacter_phage	74.0	4.1e-62
WP_039268781.1|1450837_1452514_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	63.5	1.6e-205
>prophage 3
NZ_CP010384	Enterobacter hormaechei subsp. xiangfangensis strain 34399 chromosome, complete genome	4784288	1790705	1850959	4784288	protease,tRNA,portal,capsid,tail,head,terminase,integrase,holin	Enterobacterial_phage(27.45%)	78	1784383:1784400	1858729:1858746
1784383:1784400	attL	TTTTGTAGGCCGGGTAAG	NA	NA	NA	NA
WP_032628201.1|1790705_1791818_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_022650804.1|1791858_1792332_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_022650805.1|1792331_1792994_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_003857898.1|1793111_1794362_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
WP_022650806.1|1794437_1794683_+	YmjA family protein	NA	NA	NA	NA	NA
WP_022650807.1|1794687_1796187_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_071524166.1|1796311_1796404_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_003857896.1|1796775_1797024_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_015570794.1|1797077_1797152_-	protein YoaJ	NA	NA	NA	NA	NA
WP_015570793.1|1797152_1797251_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_022650808.1|1797296_1798325_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	5.0e-13
WP_022650809.1|1798636_1798891_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_022650810.1|1798971_1799277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003857886.1|1799277_1799622_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_022650811.1|1799772_1800480_+	CTP synthase	NA	NA	NA	NA	NA
WP_022650812.1|1800511_1801699_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_022650813.1|1801798_1802590_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003857881.1|1802573_1803020_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_022650814.1|1803126_1805163_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_022650815.1|1805178_1806510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022650816.1|1806919_1807420_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_032103854.1|1807639_1808782_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.3	6.4e-94
WP_022650818.1|1808756_1809020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071882635.1|1809401_1810178_-	DUF551 domain-containing protein	NA	M9NZE4	Enterobacteria_phage	43.1	1.1e-28
WP_039268806.1|1810174_1810597_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	85.7	2.5e-67
WP_039268809.1|1810933_1811164_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	97.4	9.7e-34
WP_052255153.1|1811160_1811679_-	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	52.3	1.3e-22
WP_063948321.1|1811665_1812691_-	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	90.4	4.6e-168
WP_039269162.1|1812687_1813101_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	86.1	3.6e-55
WP_039269163.1|1813635_1813839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039269164.1|1814049_1814709_-	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	62.1	4.1e-69
WP_039268812.1|1814816_1815041_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	54.5	5.4e-13
WP_039268813.1|1815066_1815537_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	91.7	6.8e-74
WP_071882636.1|1815777_1815984_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	4.5e-14
WP_039268815.1|1815946_1816885_+	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	87.1	6.5e-68
WP_039268818.1|1816881_1817376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039268819.1|1817375_1818035_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	78.6	1.3e-99
WP_039268820.1|1818031_1818355_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	77.9	7.2e-43
WP_039268821.1|1818351_1818741_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	93.8	5.1e-67
WP_039268822.1|1818737_1819727_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	89.4	4.7e-178
WP_039268823.1|1819739_1820318_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.3	7.3e-46
WP_039268826.1|1820897_1821797_+|protease	serine protease	protease	NA	NA	NA	NA
WP_006809173.1|1821889_1822294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000220248.1|1822290_1822572_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	35.9	3.0e-05
WP_039268827.1|1822568_1823195_+	glycoside hydrolase family 19 protein	NA	K7PJS7	Enterobacterial_phage	92.3	9.5e-108
WP_039268828.1|1823202_1823478_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	53.3	2.4e-15
WP_052255156.1|1823428_1823620_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	93.3	1.2e-18
WP_071882637.1|1823936_1824512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039268831.1|1824697_1826155_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	91.8	9.8e-273
WP_039268832.1|1826173_1826404_+	DUF1327 domain-containing protein	NA	NA	NA	NA	NA
WP_039268833.1|1826419_1826704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039268834.1|1826869_1827460_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	86.2	1.9e-97
WP_087713568.1|1827456_1827801_+	HNH endonuclease	NA	A0A2I6PIG1	Escherichia_phage	73.0	6.7e-47
WP_023315886.1|1827932_1828397_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	2.2e-48
WP_023315887.1|1828350_1830087_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	3.7e-141
WP_039269165.1|1830086_1831364_+|portal	phage portal protein	portal	F1C584	Cronobacter_phage	86.3	8.8e-217
WP_023315889.1|1831381_1832065_+|head,protease	HK97 family phage prohead protease	head,protease	Q9MCV5	Escherichia_phage	78.4	8.8e-99
WP_039268837.1|1832068_1833229_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	86.0	1.2e-185
WP_039269166.1|1833266_1833587_+	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	61.3	1.2e-34
WP_023315892.1|1833586_1833928_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	30.1	2.3e-07
WP_039268838.1|1833917_1834295_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	38.7	1.0e-19
WP_039268839.1|1834291_1834696_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	72.0	1.1e-43
WP_032104401.1|1834728_1835181_+|tail	major tail shaft subunit	tail	Q7Y403	Yersinia_phage	76.7	9.1e-60
WP_039268840.1|1835244_1835607_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	54.3	3.1e-26
WP_039268841.1|1835845_1839172_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	69.1	0.0e+00
WP_032104406.1|1839171_1839510_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	73.2	1.9e-46
WP_039268842.1|1839506_1840265_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	94.8	1.4e-142
WP_039268843.1|1840266_1840974_+	peptidase P60	NA	K7PLS6	Enterobacteria_phage	97.0	2.7e-143
WP_039269167.1|1841006_1841420_+	lipoprotein	NA	G8C7Q7	Escherichia_phage	65.7	4.9e-52
WP_039268844.1|1841478_1842069_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.6	3.3e-78
WP_039268846.1|1842122_1845959_+|tail	phage tail protein	tail	K7PJL6	Enterobacteria_phage	83.4	0.0e+00
WP_039268847.1|1846002_1846317_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	63.7	5.6e-32
WP_039268849.1|1846317_1846989_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	2.6e-87
WP_039268850.1|1847096_1847330_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	77.6	8.6e-30
WP_039268851.1|1847388_1848771_+	hypothetical protein	NA	K7P6I4	Enterobacteria_phage	56.8	1.9e-124
WP_039268852.1|1848853_1849093_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	71.8	3.5e-26
WP_039268853.1|1849092_1849413_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	54.7	2.3e-25
WP_039268854.1|1849675_1850959_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.4e-09
1858729:1858746	attR	CTTACCCGGCCTACAAAA	NA	NA	NA	NA
>prophage 4
NZ_CP010384	Enterobacter hormaechei subsp. xiangfangensis strain 34399 chromosome, complete genome	4784288	2085484	2092733	4784288		Escherichia_phage(83.33%)	8	NA	NA
WP_022651054.1|2085484_2086162_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	62.6	1.5e-77
WP_032609101.1|2086337_2086649_-	YebG family protein	NA	NA	NA	NA	NA
WP_017384547.1|2086758_2087373_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.7	3.3e-28
WP_022651056.1|2087417_2088272_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	34.9	1.2e-23
WP_003858259.1|2088273_2088891_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	1.4e-74
WP_039268870.1|2088901_2091340_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.5	2.9e-216
WP_003857424.1|2091470_2091776_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_003857421.1|2091878_2092733_-	benzoate transporter	NA	M1I711	Paramecium_bursaria_Chlorella_virus	33.2	8.1e-25
>prophage 5
NZ_CP010384	Enterobacter hormaechei subsp. xiangfangensis strain 34399 chromosome, complete genome	4784288	2415492	2489694	4784288	tRNA,plate,tail,terminase,integrase,holin	Enterobacteria_phage(26.0%)	75	2411894:2411909	2437421:2437436
2411894:2411909	attL	CGGAGGTAACCTGCCG	NA	NA	NA	NA
WP_071785691.1|2415492_2415693_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	71.7	1.1e-20
WP_022651252.1|2416017_2416707_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	1.1e-77
WP_071787990.1|2416744_2416957_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_022651253.1|2417239_2417458_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	65.7	2.9e-19
WP_032645629.1|2418019_2418247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651254.1|2418451_2418790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651255.1|2419204_2419771_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	80.0	6.0e-77
WP_104468396.1|2420704_2421535_-|tail	tail fiber domain-containing protein	tail	A0A192Y7T9	Enterobacteria_phage	30.6	8.4e-35
WP_022651260.1|2421543_2422806_-	hypothetical protein	NA	K7PM99	Enterobacterial_phage	65.9	3.2e-147
WP_022651261.1|2422864_2423098_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	76.3	9.5e-29
WP_022651262.1|2423166_2423877_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	3.6e-87
WP_022651263.1|2423877_2424192_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	65.7	6.6e-33
WP_022651264.1|2424232_2427784_-|tail	phage tail protein	tail	K7P840	Enterobacteria_phage	84.6	0.0e+00
WP_022651265.1|2427836_2428463_-|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	59.9	1.8e-53
WP_123839386.1|2428574_2429141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651267.1|2429217_2429931_-|tail	phage tail protein	tail	K7PLS6	Enterobacteria_phage	97.4	1.0e-142
WP_022651268.1|2429932_2430688_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	77.2	2.0e-115
WP_022651269.1|2430684_2431032_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	62.6	1.7e-37
WP_020690998.1|2431088_2431442_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	98.3	6.0e-59
WP_022651270.1|2431516_2434429_-|tail	phage tail tape measure protein	tail	A0A0K0VLY2	Klebsiella_phage	34.7	1.6e-128
WP_032645632.1|2434425_2434740_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	65.0	1.1e-16
WP_022651271.1|2434736_2435048_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.0	1.8e-35
WP_022651272.1|2435113_2435785_-	hypothetical protein	NA	I6PBN6	Cronobacter_phage	47.3	7.4e-50
WP_022651273.1|2435854_2436265_-	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	52.2	1.9e-32
WP_022651274.1|2436261_2436846_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	55.3	1.4e-49
WP_022651275.1|2436847_2437198_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	57.8	2.1e-32
WP_022651276.1|2437199_2437682_-	hypothetical protein	NA	A0A0E3GMJ4	Enterobacteria_phage	34.7	2.6e-12
2437421:2437436	attR	CGGAGGTAACCTGCCG	NA	NA	NA	NA
WP_127353320.1|2437718_2438075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039268908.1|2437999_2438953_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.0	5.3e-134
WP_022651278.1|2438965_2439736_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.6	6.3e-69
WP_022651279.1|2439816_2440914_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	57.9	1.8e-117
WP_022651280.1|2440915_2442304_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.2	2.1e-123
WP_022651281.1|2442305_2443613_-	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	57.3	1.3e-143
WP_022651282.1|2443590_2444589_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	43.4	1.1e-38
WP_032645635.1|2444635_2445085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032645710.1|2446593_2446869_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	84.4	3.7e-32
WP_022651285.1|2446876_2447506_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.1	2.3e-101
WP_022651286.1|2447505_2447787_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	1.3e-19
WP_015570936.1|2447773_2448160_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	78.1	3.2e-45
WP_022651288.1|2448945_2449137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651290.1|2449662_2450496_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	78.7	3.3e-124
WP_032645711.1|2450492_2450855_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.1	5.2e-50
WP_022651293.1|2451062_2451665_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	82.5	6.8e-95
WP_022651294.1|2452053_2452278_-	DinI family protein	NA	H6WRY5	Salmonella_phage	62.3	1.8e-21
WP_022651295.1|2452648_2453095_-	VOC family protein	NA	NA	NA	NA	NA
WP_039268909.1|2453581_2454763_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_014884019.1|2455108_2455327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014832179.1|2455628_2456078_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_039268911.1|2456354_2457041_-	phage replication protein P	NA	G8C7U6	Escherichia_phage	63.0	2.0e-82
WP_080332506.1|2457037_2457895_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	70.4	8.2e-102
WP_039268913.1|2458039_2458591_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	47.3	7.5e-32
WP_022651300.1|2458593_2458821_-	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	62.2	1.6e-20
WP_022651301.1|2458920_2459313_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	63.1	6.3e-41
WP_162183705.1|2459561_2459888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039268914.1|2460131_2463269_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	64.4	0.0e+00
WP_022651303.1|2463278_2464364_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	63.3	2.8e-123
WP_020882485.1|2464402_2464645_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	1.3e-33
WP_022651304.1|2464709_2464922_+	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	63.4	4.3e-20
WP_022651305.1|2464923_2466162_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	70.0	4.3e-168
WP_003856923.1|2466211_2467147_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.7	3.0e-142
WP_003856922.1|2467190_2468564_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.6	1.1e-50
WP_003856916.1|2469048_2470032_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_022651306.1|2470122_2471253_-	methyl-accepting chemotaxis sensory transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	2.6e-10
WP_003856913.1|2471569_2472058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651307.1|2472086_2473403_-	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_022651308.1|2473426_2473882_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003856903.1|2475027_2475552_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_123839387.1|2476115_2476391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651310.1|2476436_2476910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651313.1|2479539_2480547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039268915.1|2480536_2482999_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_022651315.1|2483003_2483528_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_022651316.1|2483563_2484646_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_022651318.1|2484978_2485470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651321.1|2487924_2489694_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 6
NZ_CP010384	Enterobacter hormaechei subsp. xiangfangensis strain 34399 chromosome, complete genome	4784288	2770282	2822624	4784288	integrase,tail,holin,terminase	Escherichia_phage(22.41%)	73	2772196:2772224	2820411:2820439
WP_003859884.1|2770282_2770927_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	3.3e-55
WP_003859879.1|2771094_2772075_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
2772196:2772224	attL	GATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_003859877.1|2772552_2773224_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.5	1.1e-80
WP_032666022.1|2773290_2773698_-	cell envelope integrity/translocation protein TolA	NA	NA	NA	NA	NA
WP_003859872.1|2773840_2775109_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.5	3.4e-229
WP_003859869.1|2775108_2775414_-	hypothetical protein	NA	I6PCW5	Cronobacter_phage	40.6	7.8e-15
WP_003859867.1|2775526_2775889_+	GtrA family protein	NA	U5P0S6	Shigella_phage	85.0	4.4e-49
WP_003859865.1|2775885_2776815_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	90.1	5.7e-157
WP_039268929.1|2776807_2778118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003859861.1|2778797_2781221_-	SGNH/GDSL hydrolase family protein	NA	G0XNW5	Escherichia_phage	39.8	3.5e-142
WP_039268930.1|2781276_2783754_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.8	0.0e+00
WP_039268931.1|2783740_2784106_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	93.3	1.1e-63
WP_039268932.1|2784119_2784590_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	94.2	1.1e-79
WP_039268933.1|2784589_2785087_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	87.9	5.3e-85
WP_039268934.1|2785086_2787990_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	37.3	1.7e-106
WP_039268935.1|2788002_2788674_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	49.8	7.0e-56
WP_017693204.1|2788731_2789475_-	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	85.4	1.3e-71
WP_032608745.1|2789539_2789923_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	2.3e-40
WP_039268936.1|2789919_2790384_-	hypothetical protein	NA	A0A2P1MXA4	Escherichia_phage	44.8	2.0e-30
WP_039268937.1|2790386_2790737_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	2.0e-38
WP_006820518.1|2790736_2790910_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	49.1	7.8e-12
WP_001514201.1|2790909_2791311_-	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	81.5	7.1e-56
WP_039268938.1|2791373_2791667_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	86.6	2.6e-39
WP_039268939.1|2791676_2792753_-	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	87.7	2.3e-178
WP_023300384.1|2792770_2793220_-	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.9	5.5e-65
WP_023314024.1|2793232_2794498_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	88.6	2.1e-215
WP_039268940.1|2795386_2796736_-	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	88.4	4.1e-233
WP_022651105.1|2796805_2797072_-	hypothetical protein	NA	Q5G8Y6	Enterobacteria_phage	94.3	3.8e-42
WP_022651104.1|2797133_2798618_-	hypothetical protein	NA	G0ZND4	Cronobacter_phage	88.1	2.2e-259
WP_015571553.1|2798604_2799177_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	72.1	6.5e-71
WP_022651103.1|2799204_2799540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651102.1|2799599_2799815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651101.1|2799919_2800171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047724946.1|2800348_2800546_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	90.7	1.6e-16
WP_022651100.1|2800502_2800775_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	59.1	3.1e-15
WP_022651099.1|2800771_2801314_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	70.4	2.7e-74
WP_001514184.1|2801316_2801592_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_001514183.1|2801588_2801990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039268944.1|2802701_2803391_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.5	5.1e-62
WP_003859831.1|2803503_2804145_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	71.6	2.6e-76
WP_003859830.1|2804137_2804308_-	NinE family protein	NA	G8C7V4	Escherichia_phage	90.9	8.2e-22
WP_003859829.1|2804304_2804742_-	NinB protein	NA	G8C7V3	Escherichia_phage	69.0	2.7e-53
WP_003859826.1|2804922_2805156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003859824.1|2805164_2805416_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	83.6	4.3e-27
WP_003859822.1|2805725_2806328_-	DUF551 domain-containing protein	NA	G8C7V0	Escherichia_phage	67.5	1.8e-31
WP_003859819.1|2806324_2806849_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	48.3	4.8e-36
WP_003859817.1|2806845_2807190_-	helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	96.5	2.1e-56
WP_003859816.1|2807186_2808059_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	66.2	5.8e-103
WP_003859814.1|2808043_2808913_-	replication protein	NA	K7PGT1	Enterobacteria_phage	48.8	8.4e-62
WP_003859813.1|2808998_2809544_-	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	82.3	7.3e-80
WP_003859811.1|2809573_2809807_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	67.6	1.1e-21
WP_003859808.1|2809845_2810616_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	65.1	1.9e-94
WP_003859807.1|2810626_2810923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039269180.1|2811466_2811904_+	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	97.2	3.9e-76
WP_003859803.1|2812067_2812277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001752704.1|2812433_2812640_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	100.0	3.6e-32
WP_003859795.1|2812718_2813003_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	91.5	1.9e-47
WP_003859792.1|2813021_2813867_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.2	1.1e-69
WP_003859791.1|2813863_2814544_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	94.7	4.5e-127
WP_003859790.1|2814540_2814969_+	hypothetical protein	NA	G8C7S8	Escherichia_phage	97.2	2.6e-72
WP_039268945.1|2815129_2815882_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	86.4	9.6e-131
WP_039268946.1|2815886_2817011_+	site-specific DNA-methyltransferase	NA	A0A060D598	Salmonella_phage	48.4	6.8e-88
WP_039268947.1|2817007_2817226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039268948.1|2817222_2817564_+	DUF551 domain-containing protein	NA	U5P092	Shigella_phage	51.9	3.2e-17
WP_039268949.1|2817655_2817874_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	64.8	2.1e-17
WP_039268950.1|2817964_2818234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039268951.1|2818322_2818853_+	hypothetical protein	NA	A0A059VFZ8	Pseudomonas_phage	42.1	3.0e-30
WP_039268952.1|2819009_2819282_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	63.3	2.5e-28
WP_039268953.1|2819250_2820336_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.4	9.6e-148
WP_003859787.1|2820658_2820997_-	YebY family protein	NA	NA	NA	NA	NA
2820411:2820439	attR	GATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_022651438.1|2821013_2821883_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_022651439.1|2821884_2822256_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_003859784.1|2822393_2822624_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
>prophage 7
NZ_CP010384	Enterobacter hormaechei subsp. xiangfangensis strain 34399 chromosome, complete genome	4784288	3003129	3010875	4784288		Bodo_saltans_virus(16.67%)	7	NA	NA
WP_003859480.1|3003129_3003741_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	2.1e-14
WP_003859479.1|3003779_3004760_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_003859478.1|3004952_3005957_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.3	1.1e-33
WP_003859477.1|3006005_3007172_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	4.1e-112
WP_003859476.1|3007411_3008293_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.4	1.5e-103
WP_003859475.1|3008293_3009379_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.6	3.7e-99
WP_003859473.1|3009468_3010875_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	3.1e-37
>prophage 8
NZ_CP010384	Enterobacter hormaechei subsp. xiangfangensis strain 34399 chromosome, complete genome	4784288	3441597	3522870	4784288	tRNA,portal,tail,lysis,capsid,head,terminase,integrase,plate	Escherichia_phage(21.57%)	88	3484217:3484234	3514532:3514549
WP_022651606.1|3441597_3442137_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_003860696.1|3442161_3442797_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_039268993.1|3442800_3444165_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003860700.1|3444174_3445071_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_003860702.1|3445189_3446038_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003860704.1|3446094_3446355_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	51.2	1.4e-17
WP_003860706.1|3446351_3446732_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003860707.1|3446731_3447463_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003860708.1|3447538_3448246_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003860709.1|3448263_3449169_-	GTPase Era	NA	NA	NA	NA	NA
WP_003860711.1|3449165_3449846_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.0	9.6e-21
WP_022651608.1|3450069_3451044_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003860714.1|3451059_3452865_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
WP_003860716.1|3453050_3453527_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_003860717.1|3453523_3454477_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_003860719.1|3454476_3455127_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_006176728.1|3455158_3455734_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
WP_022651669.1|3456159_3457779_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003860724.1|3457763_3458501_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003860725.1|3458633_3459962_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
WP_003860727.1|3460014_3460398_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
WP_003860729.1|3460713_3461403_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	7.9e-55
WP_022651671.1|3461442_3462528_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003860733.1|3462732_3463152_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
WP_003860734.1|3463222_3463921_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_022651672.1|3463956_3466620_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_022651673.1|3466729_3468085_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003860739.1|3468131_3468455_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_003860741.1|3468451_3469759_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	2.7e-43
WP_006811623.1|3469910_3470363_-	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	3.9e-34
WP_022651674.1|3476017_3478591_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	4.5e-127
WP_003863167.1|3478720_3479452_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_003863165.1|3479448_3480429_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_039268995.1|3480560_3481298_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003863162.1|3481565_3481907_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100229775.1|3482012_3482060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003863160.1|3482167_3483328_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_003863157.1|3483324_3484197_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
3484217:3484234	attL	AAAAGCCAGCAATGCTGG	NA	NA	NA	NA
WP_052255169.1|3484396_3484789_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	45.5	1.3e-25
WP_023323577.1|3484834_3485056_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.6	4.9e-27
WP_039268996.1|3485132_3486302_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.8	2.1e-172
WP_017383000.1|3486298_3486763_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	70.8	2.1e-59
WP_039268997.1|3486773_3489224_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	76.1	3.9e-306
WP_017382998.1|3489213_3489336_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	5.9e-14
WP_023323581.1|3489368_3489692_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	65.2	8.9e-25
WP_023295232.1|3489749_3490268_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	2.9e-78
WP_023323582.1|3490280_3491474_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	2.4e-184
WP_039268999.1|3491848_3492280_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	56.4	1.8e-17
WP_039269001.1|3492281_3494630_-|tail	tail fiber protein	tail	A0A0F7LDR4	Escherichia_phage	51.2	1.4e-114
WP_032682191.1|3494641_3495172_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	88.1	2.1e-92
WP_032618987.1|3495164_3496073_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	83.1	3.0e-134
WP_039269006.1|3496078_3496429_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	72.4	4.7e-40
WP_039269007.1|3496425_3497061_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	85.8	6.9e-98
WP_039269009.1|3497129_3497579_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.4	9.4e-49
WP_032673296.1|3497571_3498039_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	69.0	8.0e-59
WP_039269012.1|3498134_3498551_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	68.8	4.2e-43
WP_039269014.1|3498550_3498982_-	hypothetical protein	NA	A0A218M4L6	Erwinia_phage	79.7	1.1e-59
WP_039269015.1|3498978_3499491_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	88.2	3.0e-83
WP_017382980.1|3499474_3499696_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	74.0	7.1e-26
WP_039269017.1|3499686_3499890_-|tail	tail protein X	tail	Q858W3	Yersinia_virus	77.6	2.8e-24
WP_032609900.1|3499889_3500396_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	71.4	9.9e-63
WP_039269018.1|3500495_3501251_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	66.1	3.6e-77
WP_039269020.1|3501254_3502349_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	82.5	1.2e-166
WP_017382975.1|3502404_3503259_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	73.6	2.4e-114
WP_023295254.1|3503424_3505194_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	85.1	1.2e-301
WP_032618971.1|3505195_3506221_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.0	4.6e-168
WP_052255158.1|3506547_3507171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039269021.1|3507217_3507475_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	56.4	9.8e-19
WP_039269024.1|3507840_3508305_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	54.9	3.3e-41
WP_039269184.1|3508310_3510443_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	76.2	0.0e+00
WP_039269185.1|3510523_3511345_-	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	79.2	3.1e-130
WP_039269025.1|3511357_3511636_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	62.8	2.2e-24
WP_080332515.1|3511647_3511857_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_039269027.1|3511935_3512436_-	hypothetical protein	NA	M1SV55	Escherichia_phage	88.0	2.1e-81
WP_039269028.1|3512426_3512606_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	63.2	5.2e-11
WP_023295263.1|3512608_3512881_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	82.2	3.4e-38
WP_032610269.1|3513040_3513334_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	68.0	4.2e-34
WP_039269030.1|3513403_3514384_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	80.1	4.4e-152
WP_003863156.1|3514572_3515694_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
3514532:3514549	attR	AAAAGCCAGCAATGCTGG	NA	NA	NA	NA
WP_039269031.1|3515704_3516775_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
WP_003863151.1|3516987_3517362_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_003863149.1|3517515_3518052_+	YfiR family protein	NA	NA	NA	NA	NA
WP_003863147.1|3518044_3519265_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.2e-05
WP_003863144.1|3519277_3519763_+	OmpA family protein	NA	NA	NA	NA	NA
WP_003863143.1|3519765_3521136_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003863141.1|3521174_3521579_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|3521711_3522059_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003863138.1|3522102_3522870_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP010384	Enterobacter hormaechei subsp. xiangfangensis strain 34399 chromosome, complete genome	4784288	3532250	3573700	4784288	protease,holin,portal,tail,terminase,plate	Salmonella_phage(21.05%)	49	NA	NA
WP_003863115.1|3532250_3532733_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
WP_039269032.1|3533475_3534681_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_039269186.1|3534936_3535608_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.2	5.1e-83
WP_039269033.1|3535617_3535935_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	1.9e-24
WP_004157630.1|3536469_3536625_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	78.4	1.2e-16
WP_032619507.1|3536646_3537051_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	49.2	3.1e-35
WP_039269035.1|3537091_3538162_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_039269037.1|3538238_3538817_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	54.4	8.9e-52
WP_052255160.1|3538816_3540994_-	hypothetical protein	NA	A0A0M3ULF6	Salmonella_phage	38.7	1.9e-54
WP_032619504.1|3540996_3541548_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	41.0	4.3e-27
WP_039269039.1|3541540_3542455_-|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	46.0	6.3e-60
WP_032619502.1|3542438_3542792_-|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	50.0	8.5e-21
WP_039269041.1|3542828_3543947_-	late control protein D	NA	R9TNM7	Vibrio_phage	32.6	2.7e-36
WP_032620301.1|3543949_3544165_-|tail	tail protein	tail	R9TR63	Vibrio_phage	52.9	1.8e-13
WP_032619500.1|3544139_3544610_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	33.8	3.8e-16
WP_023299869.1|3546853_3547141_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_039269044.1|3547192_3547699_-|tail	tail protein	tail	NA	NA	NA	NA
WP_039269045.1|3547695_3549165_-|tail	tail protein	tail	R9TMQ0	Vibrio_phage	46.8	3.2e-77
WP_039269046.1|3549203_3549827_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	38.6	1.6e-14
WP_039269047.1|3549819_3550374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039269048.1|3550382_3551045_-	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	2.5e-21
WP_039269050.1|3551046_3551403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039269051.1|3551402_3551738_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	43.6	6.8e-12
WP_039269189.1|3551805_3553884_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	53.3	2.7e-199
WP_032634300.1|3553873_3555394_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	1.6e-153
WP_039269052.1|3555402_3555618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080332508.1|3555614_3557735_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.7	7.0e-304
WP_032619489.1|3557738_3558242_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	62.3	5.2e-48
WP_039269056.1|3558451_3558967_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	91.2	3.4e-79
WP_039269058.1|3558963_3559500_-	lysozyme	NA	K7PM52	Enterobacteria_phage	81.1	4.1e-83
WP_000286102.1|3559499_3559715_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	80.3	6.3e-27
WP_039269059.1|3560513_3561578_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	79.9	5.0e-173
WP_016240136.1|3561728_3561920_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	79.0	5.1e-20
WP_039269061.1|3562118_3562811_-	antitermination protein	NA	NA	NA	NA	NA
WP_039269063.1|3562832_3563894_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	55.7	7.0e-111
WP_039269064.1|3563890_3564583_-	antirepressor	NA	G0ZND1	Cronobacter_phage	55.1	3.1e-59
WP_032678776.1|3564685_3566020_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	51.3	9.7e-118
WP_039269065.1|3566016_3566871_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	82.2	1.1e-58
WP_020690687.1|3566860_3567040_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	8.6e-14
WP_032678779.1|3567212_3567761_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	68.7	1.3e-68
WP_032678781.1|3567783_3567999_-	cell division protein	NA	NA	NA	NA	NA
WP_032678782.1|3568097_3568724_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.3	2.7e-46
WP_016247397.1|3569357_3569729_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	90.2	2.2e-56
WP_039269066.1|3569782_3570613_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	77.5	3.9e-117
WP_039269067.1|3570748_3571288_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	74.3	2.9e-73
WP_039269068.1|3571275_3571473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039269069.1|3571469_3571763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032678787.1|3571759_3572332_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	83.4	1.3e-92
WP_039269071.1|3572533_3573700_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.3	3.9e-147
>prophage 1
NZ_CP010385	Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-106.698kb, complete sequence	106698	0	10940	106698	integrase	Pseudomonas_phage(50.0%)	12	2310:2322	12049:12061
WP_022649988.1|607_895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032623579.1|891_2037_-	plasmid transfer ATPase TraJ	NA	NA	NA	NA	NA
WP_022649986.1|2064_2871_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
2310:2322	attL	CGCGACCTTCCTG	NA	NA	NA	NA
WP_022649985.1|2867_3341_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_123839394.1|3411_3828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022649984.1|3936_5142_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_022649983.1|5247_6084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022649982.1|6230_6707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088263190.1|6726_7860_-|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	43.3	9.0e-48
WP_040110252.1|8464_9802_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_022649979.1|9798_10473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045261878.1|10457_10940_-	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	36.2	8.9e-05
12049:12061	attR	CAGGAAGGTCGCG	NA	NA	NA	NA
>prophage 2
NZ_CP010385	Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-106.698kb, complete sequence	106698	28605	29175	106698		Ochrobactrum_phage(100.0%)	1	NA	NA
WP_022650058.1|28605_29175_+	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	55.8	8.6e-23
>prophage 3
NZ_CP010385	Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-106.698kb, complete sequence	106698	39098	39956	106698		Enterobacteria_phage(100.0%)	1	NA	NA
WP_012477595.1|39098_39956_+	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
>prophage 4
NZ_CP010385	Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-106.698kb, complete sequence	106698	44416	44989	106698		Clostridium_phage(100.0%)	1	NA	NA
WP_001493762.1|44416_44989_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
>prophage 5
NZ_CP010385	Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-106.698kb, complete sequence	106698	48520	51843	106698		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_012477572.1|48520_49192_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	57.7	1.8e-72
WP_022650044.1|49158_49656_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	36.0	3.3e-18
WP_012477570.1|49821_51843_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	31.3	3.0e-38
>prophage 6
NZ_CP010385	Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-106.698kb, complete sequence	106698	59888	66910	106698	integrase	Escherichia_phage(33.33%)	10	54112:54124	62084:62096
54112:54124	attL	TTCGTCATAGGTG	NA	NA	NA	NA
WP_022650038.1|59888_60668_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	3.5e-51
WP_022650037.1|60766_61045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022650036.1|61044_61683_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	44.9	5.8e-44
WP_022650035.1|61919_62891_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	2.2e-66
62084:62096	attR	CACCTATGACGAA	NA	NA	NA	NA
WP_022650034.1|62895_63285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022650033.1|63288_64560_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	2.9e-156
WP_022650032.1|64559_64988_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.3e-28
WP_080332517.1|65118_65376_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_022650031.1|65353_65821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022650030.1|66217_66910_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	36.7	5.7e-29
>prophage 7
NZ_CP010385	Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-106.698kb, complete sequence	106698	70035	73287	106698		Escherichia_phage(50.0%)	3	NA	NA
WP_022650024.1|70035_70290_+	hypothetical protein	NA	Q71T70	Escherichia_phage	64.9	1.0e-20
WP_032623592.1|70987_71233_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_022650022.1|71301_73287_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.1	9.3e-32
>prophage 8
NZ_CP010385	Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-106.698kb, complete sequence	106698	77062	78175	106698		Faecalibacterium_phage(50.0%)	2	NA	NA
WP_022650014.1|77062_77893_+	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	32.5	5.8e-20
WP_032623560.1|77911_78175_-	hypothetical protein	NA	A0A248SLB9	Klebsiella_phage	55.4	2.9e-10
>prophage 1
NZ_CP010386	Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-121.660kb, complete sequence	121660	0	120897	121660	tail,terminase,portal,integrase,transposase	Salmonella_phage(91.82%)	133	63733:63754	78287:78308
WP_001291547.1|863_1142_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
WP_000683475.1|1201_1624_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
WP_006812523.1|1628_2156_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	99.3	2.6e-82
WP_040110254.1|2479_3130_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.1	2.1e-113
WP_016051712.1|3180_3384_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	100.0	1.3e-29
WP_006812526.1|4027_4510_-	hypothetical protein	NA	J9Q805	Salmonella_phage	97.5	2.5e-87
WP_160859095.1|4715_4913_-	hypothetical protein	NA	J9Q753	Salmonella_phage	98.5	1.6e-32
WP_006812529.1|5123_5519_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	66.2	2.0e-42
WP_006812530.1|5647_5959_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	97.1	1.2e-47
WP_160859106.1|6099_6315_-	hypothetical protein	NA	J9Q804	Salmonella_phage	97.2	4.1e-34
WP_032655918.1|6322_6544_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	1.2e-33
WP_006812532.1|6689_6932_+	hypothetical protein	NA	J9Q751	Salmonella_phage	93.8	8.9e-38
WP_157842145.1|8370_8535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040110257.1|8781_9102_-	hypothetical protein	NA	J9Q750	Salmonella_phage	93.4	1.3e-57
WP_040110258.1|9098_9335_-	DUF1380 domain-containing protein	NA	J9Q7H8	Salmonella_phage	96.2	7.9e-39
WP_040110259.1|9420_9687_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	69.3	3.4e-30
WP_040110260.1|9876_10080_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	95.5	3.7e-29
WP_040110261.1|10135_10834_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	89.7	6.0e-111
WP_040110262.1|10872_11424_-	hypothetical protein	NA	J9Q748	Salmonella_phage	90.7	2.8e-95
WP_040110263.1|11420_12062_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	98.6	7.0e-114
WP_040110264.1|12153_12525_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	99.2	1.2e-62
WP_040110265.1|12527_12809_-	hypothetical protein	NA	J9Q801	Salmonella_phage	98.9	1.9e-47
WP_040110266.1|12805_13495_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	97.4	6.8e-123
WP_040110267.1|13553_15239_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
WP_040110268.1|15628_17698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040110269.1|17866_18361_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	99.4	4.9e-83
WP_040110270.1|19697_19934_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	1.1e-35
WP_004109976.1|20136_20730_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	100.0	2.1e-112
WP_080332518.1|20915_21842_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	92.9	4.9e-108
WP_004109984.1|21968_23075_+	DUF697 domain-containing protein	NA	NA	NA	NA	NA
WP_040110272.1|23113_23656_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	97.2	4.2e-96
WP_040110273.1|23665_24085_-	hypothetical protein	NA	J9Q743	Salmonella_phage	97.1	3.2e-67
WP_040110274.1|24148_24793_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	99.5	1.5e-116
WP_160859086.1|24792_25263_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	100.0	2.0e-89
WP_162183711.1|25265_25661_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	96.9	7.9e-68
WP_040110276.1|25680_26784_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.4	4.4e-217
WP_040110277.1|26973_27843_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	99.3	1.8e-160
WP_040110278.1|27925_29068_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.7	2.9e-219
WP_040110279.1|29175_31491_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.6	0.0e+00
WP_002214145.1|31568_32138_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_006812552.1|32149_32896_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.4	3.4e-136
WP_160859089.1|32885_33389_-	SMC family ATPase	NA	J9Q741	Salmonella_phage	99.4	8.2e-86
WP_040110281.1|35031_36117_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.3	1.7e-205
WP_040110282.1|36345_36849_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.6	2.1e-89
WP_040110283.1|36880_37375_-	GNAT family acetyltransferase	NA	J9Q6J3	Salmonella_phage	97.0	7.3e-87
WP_022649908.1|37450_38095_-	hypothetical protein	NA	J9Q739	Salmonella_phage	99.1	2.2e-123
WP_040110284.1|38838_39903_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.0	7.9e-187
WP_006812558.1|40471_40684_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	98.6	3.1e-34
WP_004110033.1|40683_41019_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	99.1	1.6e-56
WP_040110285.1|41235_41511_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	2.3e-45
WP_032655922.1|41579_41990_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	98.5	4.8e-76
WP_004110046.1|41973_42345_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	99.2	1.0e-69
WP_004110049.1|42507_43338_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	99.3	1.1e-127
WP_040110286.1|43341_43542_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	92.3	6.7e-23
WP_162183712.1|43633_44665_-	recombinase	NA	J9Q736	Salmonella_phage	98.8	1.3e-194
WP_000920226.1|44712_44979_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_040110288.1|44978_45923_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	2.2e-180
WP_040110289.1|45983_47012_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	99.7	4.1e-164
WP_040110290.1|47131_47563_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	99.3	8.9e-73
WP_052255174.1|47689_48613_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_160389865.1|48644_49070_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	99.3	1.7e-71
WP_074136122.1|49084_50254_-	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	95.4	7.8e-212
WP_023315970.1|50273_50969_-	hypothetical protein	NA	Q854L3	Mycobacterium_phage	45.1	1.4e-19
WP_074136117.1|50971_53335_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.8	0.0e+00
WP_004110112.1|53515_54751_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	2.3e-238
WP_006812566.1|54847_57214_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.5	0.0e+00
WP_004110118.1|57323_57536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004110129.1|57799_58186_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_023315967.1|58177_59284_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.6	5.6e-26
WP_006812568.1|59457_59874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006812569.1|59864_60389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006812570.1|60485_60731_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	1.0e-12
WP_006812571.1|60730_61096_-	hypothetical protein	NA	K7PH35	Enterobacteria_phage	66.4	5.1e-37
WP_022649890.1|61111_61315_-	hypothetical protein	NA	A0A2P1CDD4	Klebsiella_phage	50.7	5.6e-09
WP_006812573.1|61325_62159_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	63.6	2.3e-88
WP_000067984.1|63340_63646_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
63733:63754	attL	GGGGTCGTCTCAGAAAACGGAA	NA	NA	NA	NA
WP_040110292.1|66853_68533_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_040110293.1|68535_69444_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_040110294.1|69440_70658_+	TniQ family protein	NA	NA	NA	NA	NA
WP_040110295.1|70718_71333_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.7	2.3e-37
WP_040110296.1|71363_72146_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_123839400.1|72221_73433_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_040110298.1|73443_73749_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001247892.1|73916_74207_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|74203_74605_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003465043.1|74594_74951_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_006812576.1|75205_75532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|75528_76029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040110299.1|76025_76397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|76390_76948_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_000427623.1|77026_78031_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_006812577.1|78375_78588_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	3.7e-32
78287:78308	attR	TTCCGTTTTCTGAGACGACCCC	NA	NA	NA	NA
WP_006812578.1|78747_80070_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.9	1.8e-257
WP_032666393.1|80104_80362_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	96.5	4.4e-35
WP_006812580.1|80662_81457_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	2.9e-141
WP_040110300.1|81537_82653_-	DNA primase	NA	J9Q720	Salmonella_phage	97.0	3.6e-214
WP_040110301.1|82811_84152_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.3	6.5e-247
WP_006812583.1|84212_84938_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	99.2	3.8e-140
WP_077990606.1|85201_85999_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	26.1	2.1e-11
WP_160956455.1|86040_86394_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.2e-45
WP_023315962.1|86399_87065_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	95.0	4.7e-113
WP_016582626.1|87481_87751_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_016582627.1|87754_88279_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080332520.1|88306_88513_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	80.0	8.1e-24
WP_040110303.1|88463_88715_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	88.0	5.4e-30
WP_006812500.1|88716_89409_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	96.1	3.9e-126
WP_000064173.1|89422_89746_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	92.5	1.4e-46
WP_040110304.1|89820_90609_-	receptor-recognizing protein	NA	E5DHZ0	Enterobacter_phage	63.5	3.9e-58
WP_023316017.1|99682_100270_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.3	1.9e-102
WP_023316016.1|100257_101055_-	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.5	2.3e-154
WP_016051624.1|101047_101746_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	100.0	3.7e-137
WP_000440566.1|101835_102171_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_040110306.1|102212_106793_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.6	0.0e+00
WP_000952684.1|106800_107025_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|107150_107468_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_040110307.1|107528_108275_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	89.1	6.6e-116
WP_000469441.1|108349_108733_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
WP_040110308.1|108734_109208_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	2.0e-81
WP_040110309.1|109198_109543_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	99.1	5.5e-57
WP_040110310.1|109640_110474_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	5.8e-153
WP_040110311.1|110473_110908_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	1.4e-73
WP_040110312.1|110951_111875_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	98.4	9.9e-154
WP_040110313.1|111949_112825_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	1.9e-162
WP_040110314.1|112851_113748_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	98.0	5.1e-147
WP_040110315.1|113770_115345_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	99.2	3.2e-301
WP_002211787.1|115378_116635_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_006812517.1|116637_117279_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	3.4e-108
WP_000176291.1|117476_117743_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|117752_118643_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_001113021.1|118648_118903_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
WP_016051719.1|118895_119534_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	100.0	3.8e-112
WP_040110316.1|119530_120199_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	99.1	4.3e-114
WP_032634983.1|120198_120897_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	99.1	2.5e-125
>prophage 1
NZ_CP010387	Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-43.500kb, complete sequence	43500	0	1220	43500	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_004199214.1|194_1220_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
>prophage 2
NZ_CP010387	Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-43.500kb, complete sequence	43500	7295	14584	43500	integrase	Enterobacteria_phage(33.33%)	11	10907:10935	14879:14907
WP_001217881.1|7295_7853_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000027057.1|8035_8896_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_002353177.1|9243_9495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002353182.1|9585_10233_-	ParA family protein	NA	J9Q7R7	Salmonella_phage	28.3	4.1e-05
WP_032442017.1|10395_10839_-	antirestriction protein	NA	NA	NA	NA	NA
10907:10935	attL	GTGCGTTTCAACCGGGTATAGCGCACGTT	NA	NA	NA	NA
WP_002353199.1|11075_11843_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	42.7	2.0e-14
WP_002353184.1|12458_12848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353195.1|13098_13290_-	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	55.6	7.8e-05
WP_032442018.1|13450_13774_-	CcdB family protein	NA	NA	NA	NA	NA
WP_077261114.1|13773_14022_-	post-segregation antitoxin CcdA	NA	NA	NA	NA	NA
WP_032442020.1|14119_14584_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	42.0	5.5e-20
14879:14907	attR	AACGTGCGCTATACCCGGTTGAAACGCAC	NA	NA	NA	NA
>prophage 3
NZ_CP010387	Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-43.500kb, complete sequence	43500	32489	34030	43500		Bacillus_phage(50.0%)	3	NA	NA
WP_032442030.1|32489_33176_+	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	53.1	7.9e-23
WP_043053774.1|33176_33527_+	trbM family protein	NA	NA	NA	NA	NA
WP_032442031.1|33568_34030_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	93.2	3.0e-58
>prophage 4
NZ_CP010387	Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-43.500kb, complete sequence	43500	40081	42532	43500	transposase	Staphylococcus_prophage(50.0%)	2	NA	NA
WP_004152397.1|40081_41401_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152396.1|41650_42532_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
