The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007726	Neisseria elongata subsp. glycolytica ATCC 29315 chromosome, complete genome	2256647	1134707	1181276	2256647	integrase,capsid,portal,tRNA,head,terminase	Burkholderia_phage(15.79%)	49	1167629:1167675	1181683:1181729
WP_003770382.1|1134707_1137338_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.9	1.6e-185
WP_003770384.1|1137424_1138003_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_040665695.1|1138041_1139127_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	29.0	6.2e-30
WP_003770389.1|1139248_1139569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003770391.1|1139632_1141111_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_172459044.1|1141229_1141493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040665674.1|1141964_1142327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003770404.1|1142578_1144375_-	chorismate-binding protein	NA	S4VT78	Pandoravirus	28.9	7.4e-36
WP_041961378.1|1144622_1145552_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_003770411.1|1145678_1146431_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_003770412.1|1146548_1146929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003770418.1|1148498_1149089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041961380.1|1149151_1149940_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_040665696.1|1150261_1150624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003770424.1|1150791_1151814_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_003770427.1|1151810_1153190_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_003770429.1|1153282_1153480_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_003770434.1|1153696_1154038_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_003770436.1|1154114_1154477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040665677.1|1154473_1154653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041961381.1|1154770_1155235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003770444.1|1155424_1157278_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	44.6	1.0e-112
WP_003770446.1|1157319_1157820_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_003770450.1|1158217_1158538_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	3.0e-25
WP_003770452.1|1158584_1158839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003770455.1|1158980_1159367_-	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	83.5	7.5e-55
WP_003770459.1|1160042_1161257_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_003770462.1|1161283_1161727_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_040665678.1|1161955_1163125_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003770466.1|1163253_1164291_-	histone deacetylase family protein	NA	A0A2K9L2T7	Tupanvirus	28.2	1.2e-33
WP_041961383.1|1164558_1166244_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.9	5.0e-34
WP_003770475.1|1166322_1167426_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
1167629:1167675	attL	GACTCATAATCCCTTGGTCGTGGGTTCGAACCCCACCGGACCCACCA	NA	NA	NA	NA
WP_111751044.1|1167700_1168036_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	56.4	4.7e-13
WP_041961384.1|1167923_1168781_-	replication endonuclease	NA	A0A0M3ULG0	Salmonella_phage	50.4	2.9e-30
WP_003770482.1|1168777_1169377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003770483.1|1169460_1169754_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_040665680.1|1169743_1170223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040665681.1|1170284_1170569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158437458.1|1170764_1170881_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_111751074.1|1171118_1171808_+	helix-turn-helix domain-containing protein	NA	E5FFF8	Burkholderia_phage	33.1	5.9e-26
WP_052437418.1|1171873_1173013_+	hypothetical protein	NA	Q7Y4B3	Escherichia_virus	40.5	5.7e-58
WP_003770494.1|1173022_1174030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003770496.1|1174034_1174976_-	DNA (cytosine-5-)-methyltransferase	NA	Q7Y4B5	Escherichia_virus	67.3	1.2e-122
WP_003770497.1|1175059_1175560_-|head	head completion/stabilization protein	head	A0A077K9R2	Ralstonia_phage	40.2	7.8e-12
WP_003770500.1|1175667_1176297_-|terminase	phage small terminase subunit	terminase	K4NX86	Burkholderia_phage	36.6	3.9e-24
WP_003770502.1|1176379_1177429_-|capsid	P2 family phage major capsid protein	capsid	Q19UT3	Mannheimia_phage	45.0	1.7e-61
WP_050783669.1|1177468_1178362_-|capsid	capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	44.7	4.8e-28
WP_041961606.1|1178482_1180282_+	oxidoreductase	NA	E5FFI8	Burkholderia_phage	50.2	1.2e-158
WP_003770515.1|1180295_1181276_+|portal	phage portal protein	portal	A4JWV0	Burkholderia_virus	47.5	4.1e-81
1181683:1181729	attR	GACTCATAATCCCTTGGTCGTGGGTTCGAACCCCACCGGACCCACCA	NA	NA	NA	NA
