The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009559	Salmonella enterica subsp. enterica serovar Paratyphi A strain CMCC 50503 chromosome, complete genome	4612373	256	7912	4612373		Enterobacteria_phage(50.0%)	8	NA	NA
WP_000126347.1|256_1570_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565907.1|1596_2676_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.7e-16
WP_000648782.1|2680_3454_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018223.1|3469_4444_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973711.1|4449_5001_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000857533.1|5001_5880_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.2	6.0e-108
WP_001023655.1|5927_6827_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	4.7e-31
WP_000697846.1|6826_7912_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
>prophage 2
NZ_CP009559	Salmonella enterica subsp. enterica serovar Paratyphi A strain CMCC 50503 chromosome, complete genome	4612373	93160	102331	4612373	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195335.1|93160_95194_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703141.1|95434_95893_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.9	2.4e-52
WP_001265354.1|96064_96595_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|96651_97119_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|97165_97885_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272855.1|97881_99567_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	88.9	3.7e-279
WP_001240418.1|99789_100521_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|100580_100688_+	protein YohO	NA	NA	NA	NA	NA
WP_000824856.1|100668_101400_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569167.1|101383_102331_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 3
NZ_CP009559	Salmonella enterica subsp. enterica serovar Paratyphi A strain CMCC 50503 chromosome, complete genome	4612373	331388	337666	4612373		Salmonella_virus(50.0%)	7	NA	NA
WP_000377775.1|331388_332330_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.5	2.7e-146
WP_001682026.1|333572_333962_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000703599.1|333930_334185_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_187704795.1|334170_334413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000400612.1|334448_336371_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.5	1.9e-300
WP_106417236.1|337360_337504_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_106417237.1|337519_337666_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
>prophage 4
NZ_CP009559	Salmonella enterica subsp. enterica serovar Paratyphi A strain CMCC 50503 chromosome, complete genome	4612373	994201	1004875	4612373	integrase	Enterobacteria_phage(60.0%)	13	980656:980672	1006164:1006180
980656:980672	attL	GCCGGAGATAAAGACGC	NA	NA	NA	NA
WP_000783718.1|994201_996535_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.1	0.0e+00
WP_000743148.1|996549_996870_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216601.1|996866_997094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980371.1|997090_997642_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	60.9	2.0e-24
WP_000556591.1|997638_997905_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_000198637.1|998442_999180_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.9	3.4e-80
WP_000984211.1|999176_999422_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|999438_1000005_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
WP_000667328.1|1000224_1000788_-	type II restriction endonuclease PvuII	NA	A0A1B0UXL9	Roseobacter_phage	42.9	7.2e-30
WP_010376679.1|1000784_1001021_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000970946.1|1001076_1002072_+	site-specific DNA-methyltransferase	NA	S0A236	Cellulophaga_phage	24.2	3.5e-19
WP_020839656.1|1002125_1003385_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.2	3.7e-74
WP_000152556.1|1003855_1004875_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	7.9e-43
1006164:1006180	attR	GCGTCTTTATCTCCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP009559	Salmonella enterica subsp. enterica serovar Paratyphi A strain CMCC 50503 chromosome, complete genome	4612373	2742270	2869123	4612373	terminase,lysis,portal,head,tRNA,integrase,holin,capsid,tail,plate	Salmonella_phage(51.85%)	128	2741123:2741171	2806933:2806981
2741123:2741171	attL	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACATCCTC	NA	NA	NA	NA
WP_012532529.1|2742270_2743284_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUN9	Cronobacter_phage	85.1	2.5e-174
WP_000687097.1|2743283_2743856_-	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	53.8	1.7e-58
WP_023211710.1|2744238_2744742_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	4.5e-60
WP_000643374.1|2744751_2744979_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000022786.1|2745393_2745795_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000057334.1|2745862_2746093_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_011233149.1|2746083_2746896_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	84.3	8.8e-122
WP_016504913.1|2746936_2747080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137729.1|2747206_2748958_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.0	2.2e-255
WP_000960960.1|2749070_2749289_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.1	2.8e-06
WP_001552031.1|2749262_2749586_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038210.1|2749582_2750644_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001151947.1|2750640_2752416_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	82.6	7.0e-289
WP_000018798.1|2752576_2753377_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|2753438_2754461_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218536.1|2754464_2755166_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.2	3.2e-88
WP_001680743.1|2755262_2755715_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
WP_000084220.1|2755711_2756218_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560074.1|2756214_2756922_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	75.2	6.3e-100
WP_000220202.1|2756918_2758046_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.5	5.6e-175
WP_000166742.1|2758042_2758498_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	2.1e-56
WP_001154425.1|2758507_2758801_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_039755423.1|2758797_2759139_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	90.1	3.8e-50
WP_000376372.1|2759138_2759471_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.6e-35
WP_000411339.1|2759617_2759875_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811085.1|2760062_2762033_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.1	5.6e-271
WP_001002797.1|2762029_2762359_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136924.1|2762355_2763540_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	77.6	2.8e-177
WP_001001826.1|2763532_2764120_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	2.4e-89
WP_000084304.1|2764129_2766157_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	47.9	1.2e-154
WP_000421117.1|2766174_2766702_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	3.1e-51
WP_000267952.1|2766691_2767417_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.8	2.3e-68
WP_000200793.1|2767388_2767934_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.5	1.9e-59
WP_000977532.1|2767933_2769637_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.9	9.2e-222
WP_000136561.1|2770316_2771435_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_001177838.1|2773059_2773308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027757.1|2773551_2774577_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
WP_000052560.1|2774580_2775213_-	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000102106.1|2775329_2775572_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_000460852.1|2775604_2776114_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
WP_000956167.1|2776121_2776322_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
WP_000963479.1|2776285_2776627_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_001244240.1|2776694_2776928_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
WP_000785510.1|2776927_2777155_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_001090717.1|2777151_2777736_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
WP_000104130.1|2777732_2778593_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
WP_000301196.1|2778583_2780986_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.5	0.0e+00
WP_001154438.1|2781153_2781342_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	7.9e-26
WP_001217561.1|2781353_2781587_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_000835188.1|2781682_2781901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039755430.1|2781910_2782975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789324.1|2782971_2784036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080839.1|2784055_2784751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011233140.1|2784799_2785843_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.0	1.2e-174
WP_001098454.1|2785842_2787609_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.3	0.0e+00
WP_000216272.1|2787751_2788585_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
WP_000730751.1|2788601_2789666_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
WP_000059175.1|2789669_2790320_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000673540.1|2790413_2790878_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
WP_000868184.1|2790877_2791081_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|2791084_2791300_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069889.1|2791280_2791790_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	1.2e-92
WP_000731034.1|2791794_2792172_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
WP_024131238.1|2792168_2792597_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	3.3e-67
WP_001039961.1|2792692_2793124_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_000343944.1|2793116_2793563_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
WP_000993747.1|2793631_2794210_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.1e-107
WP_000177408.1|2794206_2794566_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_000268328.1|2794552_2795461_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	99.7	3.5e-159
WP_001086800.1|2795453_2796059_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	99.0	1.3e-117
WP_001274654.1|2796055_2797675_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	91.2	3.2e-155
WP_000006337.1|2797681_2798089_+|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
WP_000161709.1|2798286_2799009_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000388790.1|2799222_2799441_+	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	90.3	1.4e-29
WP_000046101.1|2799543_2800716_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
WP_001207653.1|2800725_2801241_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280965.1|2801295_2801598_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
WP_000763315.1|2801612_2801732_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_001282813.1|2801724_2804505_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
WP_000980405.1|2804504_2804990_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
WP_001011749.1|2804986_2806087_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	91.8	3.0e-189
WP_001775272.1|2806154_2806373_+	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
WP_001039750.1|2806459_2806837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000342601.1|2807366_2808530_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
2806933:2806981	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACATCCTC	NA	NA	NA	NA
WP_000196157.1|2808537_2810718_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533854.1|2810714_2812124_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237661.1|2812188_2823663_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|2824281_2824764_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242604.1|2824912_2825389_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|2825378_2825669_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203433.1|2825834_2826173_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|2826321_2827983_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|2828068_2828947_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|2829069_2829660_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_000271804.1|2829700_2830306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127908301.1|2830435_2831722_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|2831741_2832533_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460060.1|2832698_2834060_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|2834311_2834560_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|2834578_2835127_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469802.1|2835171_2835939_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|2835979_2836327_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030993.1|2836483_2837704_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.7e-07
WP_001212373.1|2837696_2838215_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|2838654_2839725_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225183.1|2839734_2840856_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210975.1|2840913_2841822_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200087.1|2841782_2842943_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|2843042_2843090_-	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000178449.1|2843193_2843532_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|2843803_2844541_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|2844672_2845653_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992634.1|2845649_2846381_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|2846510_2849084_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000154860.1|2855087_2855891_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	34.6	5.1e-37
WP_000648518.1|2855912_2856827_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001127560.1|2856931_2858107_+	MFS transporter	NA	NA	NA	NA	NA
WP_001230970.1|2858238_2859039_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000207237.1|2859116_2859887_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_039755476.1|2859942_2861310_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	32.5	9.0e-10
WP_001052769.1|2861381_2862137_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000801242.1|2862171_2862894_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917872.1|2862890_2863358_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_001670675.1|2863421_2864153_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000367632.1|2864683_2865727_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_000145239.1|2865737_2866733_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000371505.1|2866729_2868613_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000108009.1|2868628_2869123_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 6
NZ_CP009559	Salmonella enterica subsp. enterica serovar Paratyphi A strain CMCC 50503 chromosome, complete genome	4612373	2945903	2990612	4612373	protease,terminase,portal,holin,integrase,lysis,coat	Salmonella_phage(51.52%)	67	2948515:2948528	2959810:2959823
WP_001043666.1|2945903_2946956_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.3e-112
WP_001285277.1|2947238_2948342_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	9.0e-61
WP_000893229.1|2948353_2949604_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.0e-97
2948515:2948528	attL	AGCCAATGGCCTGA	NA	NA	NA	NA
WP_000051901.1|2949809_2950973_-|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	99.7	4.1e-229
WP_157804913.1|2951202_2951343_-	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	95.7	7.2e-16
WP_000002128.1|2951411_2951696_-	ASCH domain-containing protein	NA	A0A1R3Y5R3	Salmonella_virus	100.0	4.1e-50
WP_000208071.1|2951688_2952774_-	DUF550 domain-containing protein	NA	A0A1R3Y5Q8	Salmonella_virus	76.7	2.0e-153
WP_000582227.1|2952784_2953540_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	99.2	5.5e-150
WP_001017879.1|2953539_2954040_-	ead/Ea22-like family protein	NA	A0A1R3Y5T1	Salmonella_virus	62.6	1.0e-64
WP_000665851.1|2954036_2954696_-	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	61.6	2.2e-62
WP_001214769.1|2954692_2954863_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	94.6	5.7e-23
WP_001111312.1|2954873_2955167_-	DUF2856 family protein	NA	A0A1R3Y5T7	Salmonella_virus	100.0	3.2e-50
WP_001046981.1|2955497_2956205_-	recombinase	NA	A0A1R3Y600	Salmonella_virus	100.0	4.1e-139
WP_000902088.1|2956201_2956345_-	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	97.9	2.7e-18
WP_000156730.1|2956334_2956523_-	DUF5444 family protein	NA	A0A1R3Y5S5	Salmonella_virus	100.0	1.6e-31
WP_001200114.1|2956503_2956656_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	B8K1E2	Salmonella_phage	98.0	9.2e-25
WP_000542409.1|2956970_2957264_-	hypothetical protein	NA	B8K1E3	Salmonella_phage	95.7	4.1e-45
WP_000213983.1|2957300_2957495_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_001066166.1|2957708_2958296_+	superinfection exclusion B family protein	NA	A0A0M4R594	Salmonella_phage	98.5	1.4e-84
WP_000216028.1|2958308_2958611_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	97.0	8.2e-49
WP_000786965.1|2958974_2959184_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	92.8	1.9e-28
WP_000680395.1|2959222_2959468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000712403.1|2959825_2960515_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
2959810:2959823	attR	TCAGGCCATTGGCT	NA	NA	NA	NA
WP_000182204.1|2960625_2960841_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_001103491.1|2960951_2961233_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	98.9	1.6e-43
WP_001125982.1|2961267_2961414_+	DUF2740 family protein	NA	A0A0M4S617	Salmonella_phage	100.0	1.9e-19
WP_000065656.1|2961406_2962306_+	hypothetical protein	NA	E7C9R4	Salmonella_phage	98.7	2.5e-154
WP_000131495.1|2962295_2963732_+	AAA family ATPase	NA	A0A220NQX0	Salmonella_phage	99.2	3.0e-274
WP_000248682.1|2963807_2964014_+	hypothetical protein	NA	I6RSI5	Salmonella_phage	100.0	1.1e-31
WP_000975822.1|2964025_2964181_+	hypothetical protein	NA	A0A2H4FWM4	Salmonella_phage	100.0	2.4e-20
WP_000344579.1|2964192_2964513_+	hypothetical protein	NA	I6R992	Salmonella_phage	59.4	1.1e-22
WP_000049340.1|2964515_2964812_+	hypothetical protein	NA	E7C9R7	Salmonella_phage	99.0	6.8e-48
WP_000811302.1|2964768_2965215_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	98.6	7.8e-80
WP_000679702.1|2965211_2965385_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113770.1|2965351_2965528_+	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_011233124.1|2965530_2965872_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	99.1	5.1e-63
WP_000950962.1|2965864_2966041_+	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_001286918.1|2966033_2966246_+	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	4.7e-35
WP_000002244.1|2966238_2966529_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_001046347.1|2966525_2966888_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	7.8e-62
WP_000994515.1|2966884_2967073_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001235452.1|2967069_2967693_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	87.0	8.3e-96
WP_000738703.1|2968127_2968454_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_001167374.1|2968437_2968875_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
WP_011233123.1|2968892_2969342_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	87.8	3.0e-63
WP_001028469.1|2969554_2970076_+	KilA-N domain-containing protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_000808100.1|2970399_2970642_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_012532521.1|2970644_2971049_+	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	99.3	1.5e-66
WP_000729925.1|2971052_2971541_+	DNA-packaging protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_000417866.1|2971518_2973018_+|terminase	terminase large subunit	terminase	A0A2H4FUR5	Salmonella_phage	100.0	4.8e-307
WP_000774658.1|2973017_2975195_+|portal	portal protein p19	portal	I6R968	Salmonella_phage	98.6	0.0e+00
WP_000433852.1|2975208_2976120_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196936.1|2976119_2977412_+|coat	coat protein	coat	A0A075B8L2	Enterobacteria_phage	99.8	2.5e-243
WP_000538674.1|2977452_2978013_+	hypothetical protein	NA	E7C9T9	Salmonella_phage	100.0	1.3e-103
WP_001166094.1|2977996_2978497_+	packaged DNA stabilization gp4 family protein	NA	E7C9U0	Salmonella_phage	98.8	1.2e-89
WP_001122416.1|2978456_2979875_+	packaged DNA stabilization protein gp10	NA	A0A220NQZ5	Salmonella_phage	99.8	2.4e-276
WP_000774919.1|2979878_2980517_+	hypothetical protein	NA	A8CGD2	Salmonella_phage	100.0	6.3e-91
WP_000627703.1|2980516_2980972_+	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_000964851.1|2980974_2981664_+	hypothetical protein	NA	I1TEJ4	Salmonella_phage	100.0	2.9e-81
WP_000190212.1|2981673_2983044_+	phage DNA ejection protein	NA	A0A1R3Y5Q4	Salmonella_virus	99.3	1.6e-248
WP_000868979.1|2983043_2984975_+	hypothetical protein	NA	I1TEJ6	Salmonella_phage	99.1	0.0e+00
WP_071533035.1|2985113_2985407_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_000532177.1|2985427_2985676_-	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_000129927.1|2985811_2987815_+	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	99.9	0.0e+00
WP_000671498.1|2987873_2989331_-	glucosyltransferase domain-containing protein	NA	E7C9N7	Salmonella_phage	99.2	1.4e-239
WP_000703606.1|2989320_2990253_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	99.7	1.2e-175
WP_000915523.1|2990249_2990612_-	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
>prophage 7
NZ_CP009559	Salmonella enterica subsp. enterica serovar Paratyphi A strain CMCC 50503 chromosome, complete genome	4612373	3546975	3556505	4612373	protease,integrase	Dickeya_phage(16.67%)	8	3548226:3548240	3561702:3561716
WP_001201759.1|3546975_3548094_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_000125879.1|3548090_3550037_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
3548226:3548240	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|3550166_3550388_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|3550711_3551032_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|3551062_3553339_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000274276.1|3553837_3554368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001117984.1|3555768_3555966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011233091.1|3556127_3556505_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	2.6e-20
3561702:3561716	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 8
NZ_CP009559	Salmonella enterica subsp. enterica serovar Paratyphi A strain CMCC 50503 chromosome, complete genome	4612373	3806668	3814861	4612373		Escherichia_phage(42.86%)	8	NA	NA
WP_000444503.1|3806668_3807919_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_000915986.1|3808377_3809502_+	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_011233074.1|3810448_3810862_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_011233073.1|3810878_3811607_+	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.9	4.1e-62
WP_000158843.1|3811798_3812341_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_001277616.1|3812488_3812866_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_011233072.1|3812938_3813748_-	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.4	4.2e-63
WP_000497451.1|3814621_3814861_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
>prophage 9
NZ_CP009559	Salmonella enterica subsp. enterica serovar Paratyphi A strain CMCC 50503 chromosome, complete genome	4612373	4518021	4525248	4612373		Morganella_phage(33.33%)	7	NA	NA
WP_001157323.1|4518021_4519452_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377044.1|4519525_4520221_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.8e-07
WP_001080667.1|4521261_4522440_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.7	2.3e-107
WP_024131163.1|4522700_4522889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|4522899_4523112_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457650.1|4523557_4524826_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	1.3e-225
WP_000394197.1|4524828_4525248_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
