The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP014565	Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553	5051841	364852	404493	5051841	holin,terminase,lysis,integrase,protease,coat,portal	Salmonella_phage(49.12%)	61	357675:357689	416558:416572
357675:357689	attL	GCGCAAAATCATACA	NA	NA	NA	NA
WP_001043675.1|364852_365905_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|366187_367291_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|367302_368553_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_022630914.1|368758_369922_-|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	98.2	2.1e-225
WP_153266261.1|370151_370292_-	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	100.0	3.2e-16
WP_023972681.1|370758_371232_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	2.5e-68
WP_022630918.1|371231_371681_-	ead/Ea22-like family protein	NA	Q716F4	Shigella_phage	85.3	2.7e-48
WP_022630919.1|371682_371982_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	96.0	3.1e-56
WP_022630920.1|371978_372377_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	72.0	3.5e-31
WP_023167639.1|372373_372538_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	5.5e-23
WP_022630922.1|372548_372842_-	DUF2856 family protein	NA	Q5G8U3	Enterobacteria_phage	87.6	3.8e-43
WP_001253478.1|372888_373173_-	Anti-RecBCD protein 1	NA	E7C9P9	Salmonella_phage	97.9	1.5e-44
WP_023167638.1|373172_373880_-	hypothetical protein	NA	I6R0N0	Salmonella_phage	99.1	2.2e-137
WP_023167637.1|373876_374020_-	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	95.7	1.6e-18
WP_000156731.1|374009_374198_-	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_023167636.1|374178_374352_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	94.2	2.4e-21
WP_041111767.1|374686_375313_-	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	92.3	5.7e-36
WP_001682202.1|375505_376084_+	super-infection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_041111770.1|376104_376407_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	97.0	3.1e-48
WP_000872381.1|376760_377414_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.8	1.9e-122
WP_000067727.1|377531_377747_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_041111774.1|377856_378153_+	hypothetical protein	NA	G9L678	Escherichia_phage	95.9	7.5e-47
WP_041111776.1|378185_378830_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_052319315.1|378816_379659_+	replication protein	NA	K7PGT1	Enterobacteria_phage	94.2	1.3e-128
WP_001601985.1|379661_380507_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	73.2	3.6e-110
WP_000145948.1|380503_380794_+	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_041111780.1|380867_381305_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	99.3	6.5e-79
WP_000679702.1|381301_381475_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|381441_381618_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|381620_381953_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|381945_382122_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|382114_382726_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|382722_382947_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149926.1|382943_383147_+	protein ninH	NA	Q5G8R8	Enterobacteria_phage	100.0	7.2e-33
WP_023167457.1|383127_383307_+	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	98.3	1.6e-23
WP_000027545.1|383303_383792_+	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
WP_022630928.1|384062_384581_+	HNH endonuclease	NA	A0A1V0E5R7	Salmonella_phage	66.9	6.3e-57
WP_000738703.1|384805_385132_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_023167456.1|385115_385553_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	3.7e-74
WP_011233123.1|385570_386020_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	87.8	3.0e-63
WP_001028469.1|386232_386754_+	KilA-N domain-containing protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_000808100.1|387077_387320_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_012532521.1|387322_387727_+	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	99.3	1.5e-66
WP_000729925.1|387730_388219_+	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_023972976.1|388196_389696_+|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.2	1.0e-304
WP_023170969.1|389695_391873_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.4	0.0e+00
WP_023167453.1|391886_392798_+	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.7	1.1e-160
WP_023167452.1|392797_394090_+|coat	coat protein	coat	C6ZR10	Salmonella_phage	98.8	2.3e-241
WP_023167451.1|394130_394691_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	1.6e-101
WP_001166098.1|394674_395175_+	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|395134_396553_+	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_023167450.1|396556_397258_+	hypothetical protein	NA	C6ZR14	Salmonella_phage	97.9	2.8e-76
WP_000627703.1|397257_397713_+	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_023167449.1|397715_398405_+	hypothetical protein	NA	A0A1R3Y5P8	Salmonella_virus	98.3	1.4e-88
WP_023893010.1|398414_399785_+	phage DNA ejection protein	NA	A0A1R3Y5Q4	Salmonella_virus	97.4	1.3e-242
WP_023167447.1|399784_401602_+	hypothetical protein	NA	A0A2H4FNB8	Salmonella_phage	93.3	4.1e-276
WP_023167446.1|401619_401949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023972977.1|402009_402651_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023972978.1|402750_402924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031306893.1|402997_403636_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	84.0	5.3e-98
WP_031306894.1|403719_404493_+	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	66.1	8.0e-80
416558:416572	attR	GCGCAAAATCATACA	NA	NA	NA	NA
>prophage 2
NZ_AP014565	Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553	5051841	1072942	1108192	5051841	transposase	Escherichia_phage(36.36%)	42	NA	NA
WP_000844627.1|1072942_1073185_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|1073216_1073867_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804063.1|1073972_1075172_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|1075438_1075744_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021038045.1|1075771_1076986_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.1	2.5e-19
WP_001447541.1|1077202_1078087_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|1078117_1079611_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|1079821_1080046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|1080042_1080780_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|1081265_1081406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|1081411_1082116_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|1082666_1083371_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000062185.1|1083585_1084083_-	hypothetical protein	NA	A0A1W5N0E9	Cronobacter_phage	34.7	2.4e-05
WP_001273096.1|1084085_1084574_-	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	61.7	1.7e-51
WP_000683476.1|1084670_1085006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001281821.1|1085020_1085491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000516916.1|1085483_1085855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343597.1|1085865_1086060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001061574.1|1086400_1086949_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000270043.1|1087111_1087462_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000124640.1|1087466_1087769_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_001239997.1|1087795_1088089_-	chromosome segregation protein ParM	NA	NA	NA	NA	NA
WP_001043047.1|1088176_1088449_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	4.2e-20
WP_001236377.1|1088506_1089034_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	40.1	1.6e-23
WP_001167032.1|1089264_1090122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972663.1|1090108_1090339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210756.1|1090338_1090857_-	nitrite reductase	NA	NA	NA	NA	NA
WP_000919345.1|1090853_1091300_-	Fe3+-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_000422768.1|1091299_1091659_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
WP_000591074.1|1091715_1092144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139698.1|1092177_1093038_-	DsbA family protein	NA	NA	NA	NA	NA
WP_000829616.1|1093053_1094013_-	S49 family peptidase	NA	A0A219Y8X7	Aeromonas_phage	29.9	5.5e-14
WP_000948429.1|1094631_1095831_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|1095840_1096029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000683483.1|1097097_1097460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000534551.1|1097497_1101112_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000256129.1|1101124_1102558_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001326396.1|1102559_1103600_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000811656.1|1103710_1105222_-	ATP-dependent helicase	NA	A0A2I7R5Z1	Vibrio_phage	33.3	3.0e-46
WP_000101568.1|1105508_1106549_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_052476409.1|1106710_1107463_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_001067855.1|1107487_1108192_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
NZ_AP014565	Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553	5051841	1141534	1150266	5051841	protease,transposase	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|1141534_1142653_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1142649_1144596_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1144725_1144947_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1145270_1145591_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1145621_1147898_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1148089_1148548_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|1149010_1150266_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 4
NZ_AP014565	Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553	5051841	1200056	1300782	5051841	holin,terminase,tail,transposase,tRNA,lysis,protease,portal	Salmonella_phage(43.86%)	101	NA	NA
WP_001154025.1|1200056_1200860_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1200852_1202175_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1202155_1202860_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1202859_1207326_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925872.1|1207670_1209512_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1209771_1210320_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1210347_1210995_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1211056_1212247_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1212431_1213523_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1214129_1215530_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1215730_1216192_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023972943.1|1216508_1217723_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1217967_1219404_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1219481_1220684_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1220878_1222171_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1222215_1222464_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1222504_1222744_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1222786_1223944_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1223906_1226792_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_000407058.1|1226918_1227155_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	81.1	1.5e-34
WP_000917564.1|1227239_1227398_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_077910972.1|1227390_1227651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1227700_1228111_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1228230_1228470_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1228435_1228810_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1228894_1229878_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1229880_1230630_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1230640_1230988_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1230984_1231296_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1231373_1231664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1231955_1232189_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1232300_1232522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1232604_1233207_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1233415_1234027_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1234023_1234170_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1234159_1234957_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1235023_1235341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1235514_1235640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1235775_1236225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1236585_1237272_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1237547_1237877_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1237860_1238313_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1238330_1238810_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1239017_1239551_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1239507_1241646_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1241642_1241849_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|1241845_1243393_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|1243316_1245398_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1245488_1245812_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_023972924.1|1245804_1246104_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	5.9e-15
WP_000453194.1|1246084_1246651_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1246647_1247049_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1247060_1247810_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1247855_1248254_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1248250_1248580_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1248659_1251647_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_023972925.1|1251643_1251976_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	60.6	2.2e-34
WP_000725267.1|1252074_1252572_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1252688_1253222_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1253311_1254007_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1254016_1254754_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1254651_1255356_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_001541993.1|1257902_1258778_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000178849.1|1258816_1259059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041112202.1|1259112_1261551_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1261550_1262132_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1262607_1263576_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1264223_1264850_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1264918_1265218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1265202_1265889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1266159_1266351_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1266777_1269390_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1269597_1270608_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1270773_1271316_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1271312_1272422_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086485.1|1272520_1274629_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1274641_1276549_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1276563_1277817_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1277821_1279462_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1279458_1280022_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1280277_1280445_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1280544_1281063_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000608644.1|1282872_1284135_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000877172.1|1284994_1285447_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1285518_1286571_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1286927_1287437_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1287653_1288259_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1288245_1290399_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1290417_1290864_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_041112204.1|1290987_1293042_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.4e-19
WP_000424187.1|1293077_1293536_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1293630_1294293_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1294466_1294880_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1294924_1295242_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1295299_1296511_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1296725_1297274_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1297299_1298079_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1298127_1298409_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1298405_1298735_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1298821_1299481_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1300101_1300782_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 5
NZ_AP014565	Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553	5051841	2089092	2095901	5051841	integrase,tail	Salmonella_phage(33.33%)	11	2083955:2083977	2093670:2093692
2083955:2083977	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|2089092_2089974_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|2090446_2090635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2090699_2090867_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|2091123_2091657_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|2091710_2091941_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|2092130_2092625_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|2092684_2093539_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|2093912_2094266_-	YebY family protein	NA	NA	NA	NA	NA
2093670:2093692	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|2094282_2095158_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|2095158_2095533_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|2095670_2095901_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 6
NZ_AP014565	Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553	5051841	2171351	2250695	5051841	holin,terminase,plate,lysis,tail,transposase,protease,head,portal,integrase,capsid	Salmonella_phage(86.36%)	102	2177889:2177904	2252318:2252333
WP_000502119.1|2171351_2171810_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2171990_2173196_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2173274_2174762_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2175018_2176422_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2176436_2176844_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_023972883.1|2176843_2177212_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_041112560.1|2177283_2178768_+	alpha-amylase	NA	NA	NA	NA	NA
2177889:2177904	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2178807_2179233_-	lipoprotein	NA	NA	NA	NA	NA
WP_023972907.1|2179418_2180624_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2180620_2180854_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2181118_2181505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2181624_2181939_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2182155_2183838_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2183830_2184826_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2184818_2185526_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2185525_2186896_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2186917_2187361_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2187357_2188575_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2188679_2189147_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2189151_2190156_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2190152_2190566_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2190565_2190943_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2190942_2191680_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2191689_2191959_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2191967_2192762_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2193043_2193667_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867218.1|2193705_2193900_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2194028_2194256_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2194565_2195381_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2195359_2197072_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_000232161.1|2197236_2197422_-	YodC family protein	NA	NA	NA	NA	NA
WP_085983315.1|2197498_2198416_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2198585_2199506_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2199494_2199965_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2199945_2201376_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2201449_2202145_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2202236_2202536_-	membrane protein	NA	NA	NA	NA	NA
WP_023972908.1|2203185_2204382_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.3	1.1e-109
WP_024131109.1|2204642_2204831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2204841_2205054_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2205508_2206777_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2206779_2207199_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2207325_2207487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2208117_2208339_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2208551_2209559_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_015701331.1|2209843_2210443_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000554737.1|2210412_2211975_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_001207832.1|2211961_2212549_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_014343855.1|2212551_2213073_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_014343856.1|2213107_2213653_-|plate	baseplate J/gp47 family protein	plate	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|2213624_2214038_-	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2214042_2214576_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066636.1|2214575_2215634_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_000863818.1|2215630_2216971_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2217004_2218933_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2219017_2219344_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2219340_2219697_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2219696_2221193_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_023233175.1|2221182_2221347_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	98.1	3.8e-24
WP_000779218.1|2221350_2221911_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2221907_2222420_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2222391_2222796_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2222792_2223116_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2223118_2223319_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|2223369_2224575_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|2224589_2225240_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2225217_2226459_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2226458_2226641_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2226652_2228386_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2228382_2228877_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2229002_2229353_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2229413_2229716_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2229935_2230355_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2230567_2231053_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2231049_2231664_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2231666_2232011_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2232172_2232607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2232536_2232794_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2232926_2233550_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001202277.1|2233560_2234550_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
WP_001061457.1|2234557_2235418_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|2235434_2235824_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2235820_2236714_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2236713_2237196_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2237197_2238016_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2238012_2238237_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2238233_2239391_-	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2239387_2239942_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2239970_2240195_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2240292_2240988_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2241802_2242174_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|2242231_2243059_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|2243195_2243735_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2243805_2244036_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2244032_2244548_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2244544_2245162_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2245158_2245992_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2245995_2246565_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_001527041.1|2246604_2246832_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_023972910.1|2246833_2247823_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	99.7	3.3e-195
WP_000598920.1|2248114_2248912_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001219015.1|2250221_2250695_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2252318:2252333	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 7
NZ_AP014565	Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553	5051841	2336689	2347195	5051841		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2336689_2338003_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2338029_2339109_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2339113_2339887_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2339883_2340876_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2340881_2341433_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2341433_2342312_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2342359_2343259_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2343258_2344344_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2344720_2345614_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2345791_2347195_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 8
NZ_AP014565	Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553	5051841	2415503	2424674	5051841	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2415503_2417537_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2417777_2418236_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2418407_2418938_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2418994_2419462_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2419508_2420228_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2420224_2421910_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2422132_2422864_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2422923_2423031_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2423011_2423743_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2423726_2424674_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 9
NZ_AP014565	Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553	5051841	2444081	2511245	5051841	holin,tail,lysis	Salmonella_phage(25.0%)	59	NA	NA
WP_000989296.1|2444081_2444777_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_041112656.1|2444930_2445815_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2445991_2446711_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2446707_2446953_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2447157_2448399_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2448392_2449628_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_041112659.1|2449702_2450683_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2451504_2453025_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2453158_2454157_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_023972823.1|2454655_2455678_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_031306778.1|2455827_2456970_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2456984_2457653_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2457982_2458840_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2458828_2459218_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2459222_2460590_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2460806_2461694_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2461726_2463049_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2463092_2465084_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2465428_2466898_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2467087_2467951_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2468071_2469121_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2469199_2470057_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2470121_2471810_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2471826_2472765_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2472764_2473895_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2474263_2475445_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2475509_2476175_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2476176_2476299_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2476686_2476941_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2477264_2477837_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2478049_2479036_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2479065_2479785_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2480198_2480771_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2481096_2482653_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2482759_2484565_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2484574_2485669_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2485668_2486694_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2486695_2488285_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2488288_2488633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2489023_2490214_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2490241_2490937_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2491088_2492849_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2492973_2493258_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2493366_2493987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2494014_2495022_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2495201_2495429_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2495460_2497221_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2497501_2498005_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2498032_2498323_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000022213.1|2500546_2500990_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_023972660.1|2501367_2501895_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	4.1e-11
WP_023972659.1|2501897_2503139_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2503731_2504061_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2504357_2505689_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2505717_2506086_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_023972658.1|2506100_2507090_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	1.7e-188
WP_023972657.1|2507418_2509785_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2509953_2510157_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2510453_2511245_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 10
NZ_AP014565	Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553	5051841	2849755	2956837	5051841	holin,terminase,lysis,tail,transposase,protease,head,tRNA,portal,integrase,capsid	Salmonella_phage(33.33%)	112	2874300:2874316	2964741:2964757
WP_000940032.1|2849755_2850487_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2850605_2851409_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2851553_2852432_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2852613_2853657_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2853660_2854479_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2854489_2855503_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2855503_2856490_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2856480_2857119_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2857244_2858522_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2858516_2859656_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2859851_2861105_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2861429_2862620_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2862801_2864346_+	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000100008.1|2864706_2866038_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2866120_2868265_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2868320_2869781_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2869829_2870168_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2870244_2871582_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2871578_2872343_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2872344_2873775_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2874300:2874316	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2874424_2878312_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2878333_2878567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2878567_2880112_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2880162_2880714_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2880738_2881374_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2881377_2882739_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2882749_2883643_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2883758_2884607_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2884645_2885563_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|2885584_2886781_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2886896_2887823_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2887860_2888121_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2888232_2888613_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2888612_2889344_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2889355_2890084_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2890095_2891001_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2890997_2891678_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2891951_2892926_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2892942_2894742_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2895146_2896640_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2897082_2897220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2897932_2898097_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001738443.1|2898804_2899017_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2899123_2899351_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2899447_2900026_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2900015_2900840_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2900836_2903209_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2903262_2903505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2903543_2906906_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2906967_2907615_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2907512_2908250_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2908256_2908955_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2908964_2909294_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|2909296_2912392_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|2912363_2912702_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2912698_2913094_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2913144_2913891_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2913898_2914300_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2914408_2915539_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2915587_2916166_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2916193_2916577_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2916587_2916947_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522566.1|2917004_2918033_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2918087_2918435_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2918447_2919944_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2919933_2921514_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2921510_2921714_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2921697_2923629_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2923600_2924146_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2924432_2924834_+	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001533543.1|2925069_2925522_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|2925539_2925992_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2925975_2926305_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2926580_2927267_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2927481_2927670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2928176_2928740_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2929012_2929690_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2929686_2929827_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2929823_2930435_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929791.1|2930643_2931246_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2931280_2931529_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2931645_2931879_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|2932121_2932754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|2932861_2933560_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801764.1|2933573_2934269_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_023972743.1|2934265_2935126_-	replication protein	NA	K7PGT1	Enterobacteria_phage	48.5	1.5e-47
WP_010835408.1|2935217_2935592_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|2935551_2935794_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_023972744.1|2935893_2936289_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	2.5e-37
WP_001111772.1|2936347_2937187_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|2937179_2937566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|2937565_2938228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2938684_2938843_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2938864_2939215_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|2939341_2942269_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_077248255.1|2942231_2943389_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2943431_2943671_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2943711_2943996_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2943973_2945203_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2945700_2946180_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2946176_2947133_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2947132_2947783_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2947814_2948390_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2948386_2948551_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2948814_2950437_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2950421_2951159_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2951289_2952624_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2952641_2953541_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2953643_2954231_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2954292_2954676_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2954994_2955684_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2955799_2956837_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2964741:2964757	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 11
NZ_AP014565	Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553	5051841	3504782	3561129	5051841	holin,terminase,plate,tail,head,tRNA,lysis,integrase,capsid,portal	Escherichia_phage(30.43%)	64	3500119:3500134	3543215:3543230
3500119:3500134	attL	ATGGCGGCGTAGCCAG	NA	NA	NA	NA
WP_001264394.1|3504782_3505796_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|3506023_3506239_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3506474_3508220_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3508369_3510217_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3510340_3510847_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_023135249.1|3511205_3511424_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	100.0	4.3e-39
WP_023972616.1|3511491_3512661_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	94.8	1.4e-205
WP_023972617.1|3512657_3513143_-|tail	phage tail protein	tail	O80317	Escherichia_phage	93.8	3.8e-80
WP_023972618.1|3513158_3515600_-|tail	phage tail tape measure protein	tail	Q37848	Escherichia_phage	87.2	0.0e+00
WP_000763323.1|3515592_3515712_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	100.0	1.4e-15
WP_023972619.1|3515744_3516080_-|tail	phage tail assembly protein	tail	Q37846	Escherichia_phage	97.3	1.5e-51
WP_001550210.1|3516142_3516664_-|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	100.0	1.7e-94
WP_015406361.1|3516679_3517867_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.7	2.6e-223
WP_023972620.1|3518001_3518403_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	81.8	4.1e-56
WP_015406363.1|3518409_3520050_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	61.1	4.6e-101
WP_023972621.1|3520056_3520590_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	93.1	7.9e-95
WP_001550204.1|3520582_3521491_-|plate	baseplate assembly protein	plate	Q37840	Escherichia_phage	95.7	6.8e-155
WP_023972622.1|3521497_3521845_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	95.7	8.8e-55
WP_023972623.1|3521841_3522483_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.2	2.5e-111
WP_023140001.1|3522551_3523001_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	96.0	2.5e-70
WP_023972624.1|3522993_3523461_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	98.1	1.0e-82
WP_001384078.1|3523423_3523597_-	hypothetical protein	NA	O80311	Escherichia_phage	98.2	6.2e-25
WP_023972625.1|3523568_3523982_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	94.2	5.2e-62
WP_023972626.1|3523978_3524476_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	96.4	2.2e-91
WP_000134660.1|3524462_3524759_-|holin	phage holin family protein	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
WP_023972627.1|3524762_3524966_-|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	97.0	3.0e-31
WP_023972628.1|3524965_3525472_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	98.2	4.7e-89
WP_023972629.1|3525565_3526315_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	97.6	7.6e-128
WP_001247243.1|3526318_3527386_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
WP_023972630.1|3527462_3528350_-|capsid	capsid scaffolding protein	capsid	A0A0M3UL81	Salmonella_phage	89.0	8.1e-129
WP_023972631.1|3528481_3530251_+|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	98.6	0.0e+00
WP_023972632.1|3530250_3530997_+	hypothetical protein	NA	O80303	Escherichia_phage	95.2	8.1e-138
WP_023972633.1|3530993_3532016_+|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	99.1	3.6e-197
WP_001524894.1|3532362_3533298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001524927.1|3533457_3534189_-	hypothetical protein	NA	Q37850	Escherichia_phage	94.2	4.3e-128
WP_023972634.1|3534270_3534711_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	100.0	1.9e-70
WP_077910960.1|3534829_3537076_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	93.9	0.0e+00
WP_153259982.1|3537074_3537668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023972636.1|3537689_3537914_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	98.6	4.2e-34
WP_001246237.1|3537913_3538141_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	100.0	6.8e-32
WP_000085639.1|3538210_3538411_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	98.5	2.3e-31
WP_000920168.1|3538397_3538625_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	2.1e-36
WP_023972637.1|3538632_3539142_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	97.6	1.4e-88
WP_023972638.1|3539162_3539438_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.4	4.5e-38
WP_023972639.1|3539570_3540146_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	65.4	6.8e-68
WP_023972640.1|3540145_3541153_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.5	3.1e-193
WP_023972641.1|3541168_3542494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000213760.1|3542784_3543552_-	siderophore-interacting protein	NA	NA	NA	NA	NA
3543215:3543230	attR	CTGGCTACGCCGCCAT	NA	NA	NA	NA
WP_000983441.1|3543783_3544431_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478472.1|3544427_3545993_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
WP_000094651.1|3546380_3547901_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	6.4e-33
WP_001520281.1|3548330_3549710_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_000121523.1|3549880_3551899_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_000019989.1|3551979_3553116_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_000202966.1|3553201_3553699_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000951049.1|3553850_3554543_+	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000617687.1|3554631_3555630_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098833.1|3555901_3556870_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_000235363.1|3557124_3558369_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_000422143.1|3558818_3559481_+	DedA family protein	NA	NA	NA	NA	NA
WP_000917516.1|3559484_3559868_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000877297.1|3560012_3560381_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000031219.1|3560422_3560728_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000785626.1|3560730_3561129_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 12
NZ_AP014565	Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553	5051841	4402049	4496183	5051841	holin,terminase,plate,lysis,tail,protease,head,tRNA,portal,integrase,capsid	Escherichia_phage(41.3%)	106	4434957:4435003	4466280:4466326
WP_000560974.1|4402049_4402487_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001518251.1|4402531_4403473_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001259011.1|4403487_4403934_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558166.1|4403930_4404242_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_001127703.1|4404327_4405257_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001159630.1|4405474_4405786_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_000362050.1|4405786_4406077_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000027730.1|4406123_4407053_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|4407049_4407685_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331361.1|4407681_4408584_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_010989087.1|4408596_4411647_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	2.7e-06
WP_001059744.1|4411841_4412678_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000710966.1|4412945_4413977_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000828052.1|4414159_4415260_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000527676.1|4415614_4415938_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|4415937_4416597_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010989088.1|4416679_4417246_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619478.1|4417334_4417649_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009249.1|4417645_4418794_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179685.1|4418920_4419748_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211463.1|4419890_4421150_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000143970.1|4421146_4422616_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217112.1|4422903_4423740_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013290.1|4423892_4424741_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063541.1|4424737_4425772_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|4426390_4427074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000566800.1|4427231_4428539_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091413.1|4428531_4429047_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000812819.1|4429065_4430049_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000122635.1|4430377_4430998_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	1.4e-63
WP_000559232.1|4431067_4431757_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000133444.1|4431768_4432164_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000580402.1|4432214_4433588_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|4433584_4434283_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001233463.1|4434433_4434934_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4434957:4435003	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985246.1|4435119_4436100_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|4436169_4436463_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|4436599_4436872_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_001005164.1|4436874_4437045_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	1.8e-24
WP_000217677.1|4437041_4437542_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000288879.1|4437605_4437830_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	2.3e-32
WP_001277964.1|4437829_4438132_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	97.0	2.5e-45
WP_001113272.1|4438131_4438356_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	97.3	8.5e-35
WP_000027666.1|4438352_4438628_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	97.8	1.6e-43
WP_000216280.1|4438617_4440906_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.0	0.0e+00
WP_010835386.1|4441136_4443344_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000038172.1|4443774_4444809_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	1.2e-200
WP_010835387.1|4444808_4446581_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_001085976.1|4446754_4447609_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	96.5	9.0e-133
WP_001248559.1|4447667_4448741_+|capsid	phage major capsid protein, P2 family	capsid	Q94MD1	Enterobacteria_phage	100.0	5.1e-202
WP_001682330.1|4448744_4449488_+|terminase	terminase endonuclease subunit	terminase	U5N091	Enterobacteria_phage	97.2	3.3e-123
WP_000988633.1|4449587_4450097_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|4450096_4450300_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|4450303_4450585_+|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000736607.1|4451096_4451522_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.8e-58
WP_000040673.1|4451509_4451935_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	4.7e-66
WP_000917156.1|4452042_4452510_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
WP_001001780.1|4452502_4452955_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_001093737.1|4453021_4453657_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	9.0e-114
WP_000127163.1|4453653_4454001_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121478.1|4454005_4454914_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_001285338.1|4454906_4455518_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	6.4e-117
WP_023210806.1|4455514_4456981_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	84.6	1.1e-143
WP_010835343.1|4456950_4457568_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	83.6	5.3e-95
WP_022631136.1|4457572_4458106_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.3	5.7e-77
WP_165489670.1|4458108_4458789_-|tail	phage tail protein	tail	A0A1C9II89	Salmonella_phage	61.7	8.3e-73
WP_010835363.1|4458912_4459506_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.8e-103
WP_001286720.1|4459565_4460756_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	4.8e-225
WP_001251408.1|4460768_4461287_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031306.1|4461343_4461619_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|4461651_4461771_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069914.1|4461763_4464211_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	97.1	0.0e+00
WP_000978885.1|4464225_4464705_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_000882949.1|4464704_4465868_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
WP_000468308.1|4465949_4466168_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001077320.1|4466404_4467307_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4466280:4466326	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|4467491_4468454_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758711.1|4468657_4469647_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750761.1|4469747_4470503_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000777317.1|4470765_4472100_+	MFS transporter	NA	NA	NA	NA	NA
WP_000646499.1|4472110_4473070_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557889.1|4473079_4474120_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001519915.1|4474182_4474905_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000061008.1|4475002_4475167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173080.1|4475403_4475754_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000113085.1|4475767_4477360_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001283048.1|4477447_4478407_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001167250.1|4478662_4480198_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_000911134.1|4480191_4481235_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000981826.1|4481231_4482233_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000090737.1|4482261_4483284_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774147.1|4483312_4484188_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001738619.1|4484270_4484561_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001088049.1|4484570_4485335_+	epimerase	NA	NA	NA	NA	NA
WP_001216339.1|4485426_4486194_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802242.1|4486306_4486903_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155237.1|4487003_4487432_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796300.1|4487538_4488285_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250625.1|4488381_4489392_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136809.1|4489503_4491012_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084285.1|4491032_4491878_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051370.1|4492276_4492516_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|4492737_4493223_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_023972960.1|4493315_4494245_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|4494311_4495643_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000208240.1|4495652_4496183_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 13
NZ_AP014565	Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553	5051841	4613033	4633453	5051841	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4613033_4613762_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4613958_4614249_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4614497_4614953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4614949_4615555_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4615559_4617305_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4617307_4617940_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4617932_4619048_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4619038_4619398_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4619561_4621109_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4621108_4622038_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4622034_4622397_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4622724_4623447_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4623456_4624500_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4624487_4624697_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4624696_4625650_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|4625649_4628004_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|4628100_4628229_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4628188_4628506_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4628557_4629082_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4629081_4630509_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4630498_4630696_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4630692_4631148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4631307_4631622_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4631634_4632240_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4632242_4632530_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4633105_4633453_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_AP014566	Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553 plasmid pST3553, complete sequence	132611	3299	58118	132611	transposase,protease,integrase	Salmonella_phage(27.27%)	46	30589:30605	58895:58911
WP_000948429.1|3299_4499_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|4508_4697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545987.1|5040_6174_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000905949.1|6340_7114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528931.1|7126_7627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261278.1|7891_8122_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034046.1|8118_8535_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001144732.1|8579_12374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261286.1|12754_12985_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034044.1|12981_13398_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001128474.1|13472_15038_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015056574.1|15022_16045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361611.1|20432_21410_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001066953.1|21694_22435_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_042344623.1|22555_22738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000948429.1|24130_25330_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|25339_25528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000018330.1|25895_26711_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.9	4.3e-161
WP_001277456.1|27581_27944_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|27940_28177_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|28212_28881_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000493383.1|29647_30508_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|30539_31739_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
30589:30605	attL	GCCGGCAGGCAGAGCAA	NA	NA	NA	NA
WP_041114458.1|31844_32495_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|32526_32769_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000983249.1|35249_36035_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_000376623.1|36210_36711_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|36838_37678_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001206316.1|38181_38973_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000845048.1|39121_40135_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|40337_40688_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|40813_41374_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|41376_44343_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_001262765.1|45658_46969_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001398199.1|47253_47655_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|47587_47845_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_072134990.1|47937_48270_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000027057.1|48569_49430_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|49612_50170_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000957857.1|53392_53581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000948429.1|53590_54790_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000813641.1|55965_56184_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159863.1|56185_56491_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_001266176.1|56492_56783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000198608.1|56779_57301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000082169.1|57335_58118_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
58895:58911	attR	GCCGGCAGGCAGAGCAA	NA	NA	NA	NA
>prophage 2
NZ_AP014566	Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553 plasmid pST3553, complete sequence	132611	76732	86028	132611	transposase	Escherichia_phage(28.57%)	12	NA	NA
WP_001541564.1|76732_77149_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|77332_77668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|77724_78291_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|78322_79264_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|79678_80884_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000064274.1|80883_81858_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.1e-84
WP_000457541.1|81939_83214_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000925627.1|83213_83636_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|84146_84617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|84609_84966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015056585.1|85011_85203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|85347_86028_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
