The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009166	Escherichia coli 1303 chromosome, complete genome	4948797	1318951	1377125	4948797	integrase,tRNA,terminase,holin,tail,capsid,transposase,head,portal	Enterobacteria_phage(41.3%)	65	1313179:1313193	1320526:1320540
1313179:1313193	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074975.1|1318951_1320070_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.7	1.2e-84
WP_000003742.1|1320038_1320308_-	excisionase	NA	NA	NA	NA	NA
WP_000048533.1|1320369_1322841_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
1320526:1320540	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001090190.1|1322933_1323125_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449182.1|1323127_1323310_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000373330.1|1324007_1324454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345627.1|1324532_1324907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001345626.1|1324918_1325071_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	4.3e-06
WP_040081872.1|1325340_1326057_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.4	1.3e-52
WP_000471549.1|1326106_1326322_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_040081868.1|1326318_1326744_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032215141.1|1326764_1327730_+	phage O protein family	NA	U5P0A0	Shigella_phage	64.8	4.3e-59
WP_040081866.1|1327736_1328483_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	81.3	1.2e-112
WP_040081864.1|1328505_1329276_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	69.9	8.4e-90
WP_040081863.1|1329291_1329714_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.0	5.5e-67
WP_052476150.1|1329737_1330184_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.0	1.6e-64
WP_001224673.1|1330328_1330511_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	5.9e-26
WP_040081858.1|1330503_1330674_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	89.7	5.1e-24
WP_040081856.1|1330670_1331186_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.1	1.9e-37
WP_001358663.1|1331242_1332439_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001176099.1|1332773_1333031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1333284_1333440_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_157795068.1|1333583_1333739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040081853.1|1334271_1334550_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	2.8e-11
WP_001265061.1|1334551_1335601_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	4.5e-110
WP_000510631.1|1335613_1335985_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.5	2.1e-38
WP_001345623.1|1335977_1336361_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.8	5.9e-60
WP_040081848.1|1337346_1338090_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001294582.1|1338269_1338662_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	90.0	1.5e-50
WP_000950572.1|1338651_1338930_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	94.5	1.8e-42
WP_000836745.1|1338931_1339477_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	87.3	2.0e-93
WP_000753189.1|1339794_1340088_-	Bor family protein	NA	K7PL54	Enterobacteria_phage	87.6	7.2e-42
WP_040081845.1|1340312_1340723_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	85.3	3.4e-61
WP_144318840.1|1340885_1342047_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	5.8e-50
WP_040082784.1|1342724_1343273_+|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	62.8	2.5e-59
WP_040082782.1|1343244_1345173_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.6	3.9e-261
WP_000259002.1|1345156_1345363_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_040082780.1|1345359_1346952_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.9e-184
WP_040082778.1|1346941_1348447_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	2.7e-100
WP_000256840.1|1348483_1348831_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522651.1|1348888_1349917_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|1349968_1350343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040082774.1|1350335_1350689_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	5.8e-38
WP_041124087.1|1350701_1351280_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	87.0	1.3e-79
WP_041124088.1|1351276_1351672_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_041124210.1|1351679_1352420_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_000479169.1|1352435_1352858_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|1352839_1353274_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_041124089.1|1353266_1355828_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.6	0.0e+00
WP_000847332.1|1355824_1356154_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
WP_001563779.1|1356153_1356852_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
WP_041124090.1|1356856_1357600_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	9.5e-147
WP_000090891.1|1357536_1358169_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_041124091.1|1358229_1361628_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.3	0.0e+00
WP_040082181.1|1363983_1364547_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.8	7.6e-80
WP_040082179.1|1364772_1365765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000799406.1|1366962_1367826_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1367809_1368946_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359434.1|1369195_1370422_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1370470_1371592_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|1371667_1373128_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|1373127_1373799_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1373967_1375338_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|1375341_1375983_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1376018_1377125_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP009166	Escherichia coli 1303 chromosome, complete genome	4948797	1742037	1837839	4948797	integrase,terminase,protease,tail,lysis,transposase,head	Enterobacteria_phage(27.91%)	102	1735283:1735297	1753190:1753204
1735283:1735297	attL	AATAAAAAATAATGA	NA	NA	NA	NA
WP_088895425.1|1742037_1743266_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_041124212.1|1743341_1744949_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_032223311.1|1744911_1746435_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001125439.1|1746673_1747996_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001301023.1|1747995_1748262_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001083595.1|1748484_1749885_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
WP_000113145.1|1754435_1756028_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
1753190:1753204	attR	TCATTATTTTTTATT	NA	NA	NA	NA
WP_000154352.1|1756106_1757060_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_021570792.1|1757308_1758844_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	2.2e-20
WP_000911166.1|1758837_1759866_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222729.1|1759865_1760858_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172488.1|1760869_1761892_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774183.1|1761918_1762794_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558527.1|1762817_1763108_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286597.1|1763164_1763923_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_001351738.1|1763926_1764841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854633.1|1765047_1766499_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558029.1|1766725_1768144_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.9e-18
WP_001191027.1|1768282_1768642_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|1768641_1769568_-	glutaminase B	NA	NA	NA	NA	NA
WP_000156615.1|1769631_1771020_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366501.1|1771120_1772002_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000258600.1|1772079_1773195_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|1773344_1774535_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|1774559_1775225_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843414.1|1775436_1775871_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|1775890_1776274_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_032223317.1|1776305_1776524_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000087214.1|1776554_1777454_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054183.1|1777648_1778836_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|1778962_1779058_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592814.1|1779276_1780167_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
WP_000671737.1|1780421_1780814_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024746.1|1781089_1781608_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000210373.1|1781651_1783697_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|1783833_1784580_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|1784668_1785355_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|1785531_1785735_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527809.1|1785769_1787230_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000347482.1|1787318_1788602_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1789204_1789318_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1789386_1789620_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086531.1|1789936_1790527_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	1.1e-23
WP_000885634.1|1790624_1791200_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	9.4e-102
WP_071889255.1|1791199_1794550_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000753007.1|1794710_1795064_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_023281240.1|1795075_1795474_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	97.0	1.9e-61
WP_072134963.1|1795973_1797224_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.3	5.3e-251
WP_021575143.1|1797198_1797744_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	8.9e-94
WP_001368374.1|1798132_1798366_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1798423_1798834_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1798985_1799159_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1799330_1799486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1799565_1799631_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1799633_1799822_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1799832_1800045_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1800407_1800905_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1800901_1801435_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1801431_1801743_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1801747_1801963_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1802716_1802932_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1803232_1803445_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1803499_1803589_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1803866_1804619_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1804632_1805682_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1805683_1805962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1806028_1806280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1806496_1806652_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1806723_1807011_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1807010_1807250_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1807274_1807580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1807782_1808115_+	protein FlxA	NA	NA	NA	NA	NA
WP_089566769.1|1808572_1809734_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000589005.1|1809792_1811106_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|1811283_1811466_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_001326992.1|1812772_1813084_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	67.0	2.5e-32
WP_000854559.1|1813185_1813374_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1813370_1813562_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_021570798.1|1813654_1816126_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	4.2e-58
WP_000005552.1|1816198_1816450_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876986.1|1816484_1817765_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001389342.1|1817766_1817895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|1817952_1818972_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1818983_1820198_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1820403_1820730_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1820864_1821206_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1821240_1821801_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1821803_1822514_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1822621_1822927_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_041124096.1|1823125_1825552_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
WP_001340362.1|1825612_1828036_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|1828046_1828664_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|1828665_1829520_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1829562_1830177_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071593517.1|1830335_1831628_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919226.1|1831580_1832276_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|1832400_1833621_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019530.1|1833755_1834649_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091828.1|1834755_1836009_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743942.1|1836406_1836742_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|1836834_1836918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260835.1|1837017_1837839_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP009166	Escherichia coli 1303 chromosome, complete genome	4948797	1957939	2004052	4948797	integrase,tRNA,terminase,holin,tail,capsid,head,plate,portal	Enterobacteria_phage(76.6%)	58	1960346:1960366	1996697:1996717
WP_000029466.1|1957939_1958689_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154168.1|1958688_1959240_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|1959302_1960283_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
1960346:1960366	attL	AAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000416305.1|1960472_1960868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247208.1|1960878_1961814_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.8	5.6e-80
WP_000021112.1|1961902_1962214_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	49.5	8.3e-20
WP_001151412.1|1962309_1962588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917795.1|1962602_1962941_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	86.2	8.9e-52
WP_000158971.1|1962951_1963239_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514277.1|1963250_1963493_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021668.1|1963489_1963603_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000985159.1|1963689_1963893_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000153689.1|1963889_1964135_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	85.2	6.7e-33
WP_000599382.1|1964276_1964642_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_041124101.1|1964648_1967471_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.3	0.0e+00
WP_041124102.1|1967547_1968507_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	3.8e-180
WP_041124103.1|1968511_1968823_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	90.3	1.3e-44
WP_000279222.1|1968953_1969472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000885991.1|1969474_1970674_-	hypothetical protein	NA	A0A0P0IKU8	Acinetobacter_phage	33.2	2.3e-54
WP_000087812.1|1971210_1972257_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613768.1|1972256_1974008_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	99.8	0.0e+00
WP_001262673.1|1974162_1974999_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055118.1|1975021_1976074_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	100.0	6.8e-199
WP_000632347.1|1976119_1976920_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.5	1.6e-131
WP_000063103.1|1977021_1977516_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864901.1|1977515_1977716_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|1977718_1978042_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|1978038_1978431_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_041124104.1|1978427_1978835_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	2.1e-63
WP_000920594.1|1978972_1979440_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356339.1|1979432_1980068_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001369311.1|1980079_1980646_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.8	2.1e-98
WP_001067548.1|1980663_1980993_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111940.1|1980996_1981893_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.3e-153
WP_000071724.1|1981885_1982494_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_077878358.1|1982490_1983975_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	66.9	2.5e-106
WP_021546685.1|1984001_1984442_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	4.7e-53
WP_041124215.1|1984413_1985007_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	63.7	1.3e-58
WP_041124216.1|1985006_1985501_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_041124105.1|1985531_1986131_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	82.2	6.8e-87
WP_000979945.1|1986157_1986646_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_041124106.1|1986658_1989466_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.0	0.0e+00
WP_000333503.1|1989452_1989608_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|1989616_1989991_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290462.1|1990046_1990559_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_041124107.1|1990558_1991743_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	3.4e-223
WP_041124108.1|1991900_1993010_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	3.1e-194
WP_000402003.1|1993322_1995461_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000488110.1|1995838_1996099_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|1996289_1996430_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|1996734_1997034_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
1996697:1996717	attR	AAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672380.1|1997038_1999426_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|1999440_2000424_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2000707_2000752_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2000874_2001231_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2001283_2001481_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2001577_2002120_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|2002123_2004052_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 4
NZ_CP009166	Escherichia coli 1303 chromosome, complete genome	4948797	2321121	2328717	4948797		Enterobacteria_phage(33.33%)	7	NA	NA
WP_001752777.1|2321121_2322225_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	31.1	8.2e-38
WP_024198037.1|2322303_2322711_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_001752781.1|2322707_2323577_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	3.0e-107
WP_001752783.1|2323576_2324662_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	4.7e-102
WP_000183032.1|2325033_2325927_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_000999474.1|2326169_2327165_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.7	8.6e-10
WP_001752784.1|2327322_2328717_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	3.7e-19
>prophage 5
NZ_CP009166	Escherichia coli 1303 chromosome, complete genome	4948797	3026045	3039228	4948797		Escherichia_phage(50.0%)	12	NA	NA
WP_001272898.1|3026045_3028607_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141322.1|3028712_3029369_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|3029419_3030187_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|3030382_3031291_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|3031287_3032550_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|3032546_3033185_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|3033189_3033966_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|3034054_3035419_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3035512_3036505_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3036567_3037707_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3037846_3038473_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3038466_3039228_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 6
NZ_CP009166	Escherichia coli 1303 chromosome, complete genome	4948797	4870727	4911177	4948797	integrase,terminase,tail,capsid,lysis,head,portal	Enterobacteria_phage(57.78%)	48	4867001:4867016	4915138:4915153
4867001:4867016	attL	TGATAATGAATTTGAA	NA	NA	NA	NA
WP_023148581.1|4870727_4871966_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	97.8	8.5e-233
WP_041124189.1|4872118_4873714_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_041124190.1|4874448_4875069_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.3	2.2e-112
WP_041124191.1|4875068_4875431_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	96.6	2.2e-64
WP_041124192.1|4875421_4875958_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.3	4.1e-99
WP_001402828.1|4876086_4876911_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.5	1.5e-148
WP_000135682.1|4876976_4877339_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001311077.1|4878061_4878754_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_001191669.1|4878851_4879112_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_041124193.1|4879104_4879656_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	96.7	1.6e-98
WP_041124194.1|4879652_4880804_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	97.7	2.9e-211
WP_000620696.1|4880800_4881025_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_041124195.1|4881021_4881828_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.8	9.4e-124
WP_001305611.1|4881824_4882319_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_021543207.1|4882318_4882972_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_040088106.1|4882968_4883295_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	99.1	2.3e-52
WP_041124196.1|4883291_4883681_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.2e-68
WP_001061445.1|4883700_4884510_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
WP_001433852.1|4884517_4885507_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
WP_041124197.1|4885520_4886273_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	1.5e-136
WP_000917724.1|4886526_4886730_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_041124198.1|4886880_4887933_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.4	1.2e-206
WP_000839596.1|4888000_4888216_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_041124199.1|4888215_4888713_+	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	98.8	1.9e-90
WP_041124200.1|4888709_4889147_+|lysis	lysis protein	lysis	A0A220NRM0	Escherichia_phage	96.6	4.2e-70
WP_000654792.1|4889568_4890189_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	53.2	1.9e-52
WP_000077907.1|4890130_4891198_-	beta family protein	NA	NA	NA	NA	NA
WP_000867568.1|4891609_4892158_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001349605.1|4892129_4894058_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.9	2.5e-260
WP_000259002.1|4894041_4894248_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831760.1|4894244_4895837_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
WP_001253910.1|4895826_4897332_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.0e-99
WP_024237999.1|4897368_4897716_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_041124201.1|4897773_4898802_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	4.1e-116
WP_000201530.1|4898853_4899228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|4899220_4899574_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_041124202.1|4899585_4900164_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	6.6e-79
WP_000683113.1|4900160_4900556_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	3.8e-70
WP_001345558.1|4900563_4901304_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_041124203.1|4901319_4901742_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	9.7e-72
WP_000459458.1|4901723_4902158_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_041124204.1|4902150_4904712_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.4	0.0e+00
WP_000847347.1|4904708_4905038_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152612.1|4905037_4905736_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_041124205.1|4905741_4906485_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	1.9e-147
WP_000090891.1|4906421_4907054_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_041124206.1|4907114_4910510_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.7	0.0e+00
WP_041124207.1|4910577_4911177_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	1.6e-104
4915138:4915153	attR	TTCAAATTCATTATCA	NA	NA	NA	NA
>prophage 1
NZ_CP009167	Escherichia coli 1303 plasmid p1303_109, complete sequence	108501	5951	50600	108501	protease,integrase,transposase	Stx2-converting_phage(41.67%)	25	13894:13907	57684:57697
WP_001143750.1|5951_8960_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.4	0.0e+00
WP_001092154.1|9550_10612_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001351580.1|10721_11135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351581.1|11298_11763_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_000483319.1|11868_12282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131420.1|12884_13073_-	hypothetical protein	NA	NA	NA	NA	NA
13894:13907	attL	CAGCCAGACGTTGC	NA	NA	NA	NA
WP_001351566.1|14776_15109_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.3	2.0e-32
WP_162483617.1|15124_15367_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	60.8	1.2e-21
WP_000286435.1|16320_17013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041124236.1|17765_22703_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000995793.1|23338_27454_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	37.1	1.6e-126
WP_000422741.1|28035_28461_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|28457_28808_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|28838_30452_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_041124237.1|30713_31661_+|protease	omptin family outer membrane protease OmpP	protease	NA	NA	NA	NA
WP_072165818.1|31765_33253_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001066941.1|34009_34750_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001309253.1|34992_35970_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.5	6.1e-101
WP_001345816.1|37525_37789_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	51.2	2.1e-16
WP_163448519.1|39124_41656_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	51.4	4.6e-116
WP_001443026.1|44545_44650_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_041124238.1|44677_45514_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000813639.1|49266_49485_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|49486_49792_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_050544099.1|49820_50600_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.6e-57
57684:57697	attR	GCAACGTCTGGCTG	NA	NA	NA	NA
>prophage 2
NZ_CP009167	Escherichia coli 1303 plasmid p1303_109, complete sequence	108501	100481	106909	108501	transposase	Stx2-converting_phage(33.33%)	8	NA	NA
WP_000205749.1|100481_101228_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
WP_000704512.1|101286_102147_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000139319.1|102249_102807_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_041124243.1|102961_103165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|103998_104424_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|104420_104771_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|104801_106415_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000760079.1|106447_106909_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	32.7	2.2e-16
>prophage 1
NZ_CP009168	Escherichia coli 1303 plasmid p1303_95, complete sequence	94959	100	94733	94959	holin,head,tail,integrase,terminase	Escherichia_phage(56.07%)	109	1073:1091	94900:94918
WP_001076427.1|100_961_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
1073:1091	attL	TTTCCCTCCAGCACACATC	NA	NA	NA	NA
WP_001285362.1|1518_2715_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038866.1|2731_3733_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_032332879.1|3957_5664_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_000085145.1|5724_7314_+	hypothetical protein	NA	A0A077SLN8	Escherichia_phage	100.0	2.5e-306
WP_000041761.1|7323_8139_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
WP_000035303.1|8174_8756_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	96.9	2.8e-101
WP_000509939.1|8767_9277_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_001352007.1|9393_9549_-	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
WP_001339187.1|9730_9976_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	2.0e-13
WP_024190290.1|10026_10872_-	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.2	4.7e-150
WP_001187871.1|10901_11702_-	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	99.6	5.4e-148
WP_024946683.1|11866_12901_-	phage antirepressor KilAC domain-containing protein	NA	A0A077SLI1	Escherichia_phage	99.4	6.9e-188
WP_000245712.1|12897_13119_-	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
WP_000120524.1|13519_14194_+	hypothetical protein	NA	Q71TC4	Escherichia_phage	94.0	6.8e-19
WP_001220697.1|14255_14732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000188924.1|14790_15357_+	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	100.0	6.6e-100
WP_000523980.1|15367_15979_+	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000926342.1|15993_16875_+	hypothetical protein	NA	Q71TC9	Escherichia_phage	98.6	2.7e-172
WP_000440154.1|16956_20646_+	transglycosylase SLT domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	89.3	0.0e+00
WP_000002797.1|20645_21002_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	99.2	6.5e-61
WP_000047924.1|20998_22432_+	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	99.8	1.1e-271
WP_001189832.1|22431_23268_+	hypothetical protein	NA	A0A1B0V7F2	Salmonella_phage	100.0	1.4e-154
WP_001286325.1|23346_23781_+	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	99.3	7.4e-75
WP_077878367.1|23792_25811_+|tail	tail fiber protein	tail	A0A1B0V7G4	Salmonella_phage	59.7	4.0e-123
WP_000367945.1|25816_26428_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	78.6	3.6e-83
WP_071889281.1|26427_26886_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.2	1.2e-43
WP_071889283.1|26896_27370_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	50.0	1.2e-33
WP_023154361.1|27410_27878_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	65.8	1.4e-50
WP_001408991.1|27888_28347_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.6	6.0e-43
WP_071889283.1|28375_28849_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	50.0	1.2e-33
WP_001165547.1|28950_29523_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.0	4.4e-83
WP_000145199.1|29958_30222_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
WP_000887652.1|30296_30626_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580776.1|30622_31066_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_001345482.1|31052_31655_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000434689.1|31656_33576_+	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	96.7	0.0e+00
WP_000175491.1|33572_33938_+	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	98.3	9.3e-47
WP_041124250.1|33950_36938_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	98.9	0.0e+00
WP_001165933.1|36927_37239_+	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.8e-46
WP_000610387.1|37270_38365_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	36.3	5.7e-39
WP_000126782.1|38357_39146_-	hypothetical protein	NA	A0A077SK34	Escherichia_phage	99.2	1.0e-143
WP_041124251.1|39348_39837_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	90.7	7.2e-79
WP_001345478.1|40006_40564_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_000132937.1|40855_41875_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_041124252.1|41867_43577_-	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.3	0.0e+00
WP_041124253.1|43653_50421_+	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.7	0.0e+00
WP_000224043.1|50454_50895_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|50891_51140_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_001749390.1|51177_52299_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	100.0	2.2e-211
WP_024139118.1|52411_53053_-	hypothetical protein	NA	A0A1B0VAG4	Salmonella_phage	100.0	7.5e-116
WP_001568010.1|53241_53802_-	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	100.0	5.9e-101
WP_001749391.1|54049_54361_-	hypothetical protein	NA	Q5QBN5	Enterobacteria_phage	100.0	2.1e-47
WP_001749392.1|54411_55443_-|integrase	tyrosine-type recombinase/integrase	integrase	Q5QBN6	Enterobacteria_phage	100.0	1.3e-194
WP_000542336.1|55450_55672_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_000874154.1|56276_56486_+	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
WP_000611656.1|56596_57448_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000124159.1|57472_58957_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
WP_000219604.1|58956_60150_-|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	100.0	5.7e-210
WP_001312282.1|60236_60689_-	late promoter-activating protein (Gp10)	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
WP_023351456.1|60777_61821_-	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	98.3	6.3e-205
WP_000113019.1|61848_62028_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_001216047.1|62032_62413_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	2.5e-63
WP_001190712.1|62412_62634_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_000506726.1|62706_63096_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001283837.1|63219_63471_-	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	100.0	1.4e-38
WP_001344848.1|63644_63854_+	hypothetical protein	NA	A0A222YY00	Escherichia_phage	98.6	1.1e-31
WP_001142394.1|63838_64123_-	hypothetical protein	NA	A0A222YXZ5	Escherichia_phage	100.0	2.4e-05
WP_000057451.1|64106_64757_-	hypothetical protein	NA	A0A077SK55	Escherichia_phage	96.7	4.9e-99
WP_000988657.1|64738_65113_-	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	96.8	4.1e-66
WP_000269004.1|65119_65413_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	3.1e-45
WP_000517421.1|65591_65825_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	98.7	7.3e-37
WP_041124254.1|65907_66777_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	71.8	8.9e-112
WP_157794728.1|66773_67106_-	hypothetical protein	NA	V5URG6	Shigella_phage	98.2	3.8e-63
WP_000797279.1|67290_67479_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_021543023.1|67824_68418_-	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	82.9	5.7e-86
WP_000672528.1|68414_69149_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	55.2	1.7e-39
WP_001018057.1|69145_69436_-	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_041124255.1|69432_70299_-	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	46.9	5.8e-47
WP_001571181.1|70295_70940_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	99.5	2.0e-132
WP_001702243.1|70936_71176_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	92.4	2.4e-35
WP_000158003.1|71168_71372_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	6.8e-31
WP_023153717.1|71455_72184_-	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	1.7e-140
WP_000021768.1|72378_72885_-	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.8e-93
WP_041124256.1|72957_74220_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.5	4.6e-234
WP_000684845.1|74521_75223_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
WP_001354545.1|75219_75897_-	metallophosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000484110.1|75893_76520_-	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_000096174.1|77021_77177_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_000943607.1|77243_77822_-	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
WP_000840931.1|77824_78070_-	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000235786.1|78216_78594_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_041124257.1|78603_79821_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.5	7.0e-224
WP_000896801.1|79824_80553_+	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_000602716.1|80539_81325_+	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.2	1.4e-143
WP_000212023.1|81326_82343_+	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.7	5.9e-192
WP_000535208.1|82335_82968_+	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_041124258.1|83013_84012_-	hypothetical protein	NA	A0A1B0VCH7	Salmonella_phage	98.2	4.0e-193
WP_024224107.1|84011_85376_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	99.8	4.7e-253
WP_000751808.1|85765_86593_-	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
WP_157895434.1|88341_88509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041124260.1|88567_90832_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	68.3	0.0e+00
WP_000472529.1|90828_91734_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_001177860.1|91726_92011_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_023154391.1|92473_93262_+	hypothetical protein	NA	A0A077SK48	Escherichia_phage	100.0	8.0e-120
WP_041124261.1|93301_93724_+	hypothetical protein	NA	Q71TL5	Escherichia_phage	89.3	1.2e-58
WP_000336812.1|93749_93890_+	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_001561118.1|93901_94261_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	68.3	1.3e-37
WP_000458377.1|94331_94733_+	hypothetical protein	NA	Q71TL7	Escherichia_phage	54.0	5.5e-32
94900:94918	attR	GATGTGTGCTGGAGGGAAA	NA	NA	NA	NA
