The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007573	Streptococcus anginosus strain SA1 chromosome, complete genome	2036353	35785	44633	2036353		Streptococcus_phage(33.33%)	9	NA	NA
WP_003027890.1|35785_37267_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.5	7.3e-98
WP_003027889.1|37355_38453_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003027888.1|38454_38832_-	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	65.3	1.2e-20
WP_037582553.1|39007_40255_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	49.8	6.3e-111
WP_003027886.1|40254_41550_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	25.5	2.7e-16
WP_003027884.1|41608_42430_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003027883.1|42440_42980_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_022525260.1|42981_43809_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	2.7e-17
WP_003027880.1|43793_44633_+	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	34.2	3.9e-16
>prophage 2
NZ_CP007573	Streptococcus anginosus strain SA1 chromosome, complete genome	2036353	111575	119860	2036353		Streptococcus_phage(75.0%)	10	NA	NA
WP_022525220.1|111575_114137_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.0	8.6e-38
WP_003027807.1|114325_114784_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_022525219.1|114780_115221_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003027805.1|115772_116153_-	antitoxin HicB	NA	A0A1X9I5X0	Streptococcus_phage	75.2	3.0e-48
WP_003027804.1|116188_116380_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1X9I5T5	Streptococcus_phage	82.3	6.4e-23
WP_022525218.1|116898_117339_-	hypothetical protein	NA	A0A2H4JEJ9	uncultured_Caudovirales_phage	41.3	1.2e-19
WP_003027802.1|117587_118439_-	ATP-binding protein	NA	A0A1X9I6C4	Streptococcus_phage	49.6	1.6e-73
WP_003027801.1|118453_119245_-	DnaD domain protein	NA	A3F622	Streptococcus_phage	48.2	2.4e-55
WP_003027800.1|119253_119523_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	59.8	2.5e-20
WP_003027798.1|119524_119860_-	hypothetical protein	NA	A0A1X9I5Z6	Streptococcus_phage	50.6	8.6e-15
>prophage 3
NZ_CP007573	Streptococcus anginosus strain SA1 chromosome, complete genome	2036353	836788	846372	2036353	integrase	Liberibacter_phage(83.33%)	6	842316:842343	847330:847357
WP_080769464.1|836788_839209_+	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	43.4	1.7e-112
WP_003029179.1|839198_840689_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	53.0	5.4e-133
WP_022525012.1|840675_841254_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	35.4	1.2e-16
WP_041331701.1|841253_842429_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	41.2	2.6e-29
842316:842343	attL	TTTGCAGAACAGAGCGATAAATCAAAAT	NA	NA	NA	NA
WP_003029186.1|842432_845348_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	37.3	3.9e-188
WP_022525010.1|845403_846372_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	30.7	6.1e-37
847330:847357	attR	TTTGCAGAACAGAGCGATAAATCAAAAT	NA	NA	NA	NA
>prophage 4
NZ_CP007573	Streptococcus anginosus strain SA1 chromosome, complete genome	2036353	1229018	1236550	2036353		Streptococcus_phage(28.57%)	8	NA	NA
WP_003028001.1|1229018_1230107_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	5.4e-58
WP_003028000.1|1230145_1231069_-	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	30.7	4.6e-26
WP_003024843.1|1231127_1232396_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	35.4	3.3e-59
WP_003027998.1|1232400_1232922_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_003027997.1|1233203_1234115_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	70.0	1.7e-113
WP_003027996.1|1234111_1235089_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	83.1	1.7e-156
WP_003024854.1|1235085_1235976_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	32.2	1.0e-06
WP_003024857.1|1236127_1236550_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	46.0	9.8e-24
>prophage 5
NZ_CP007573	Streptococcus anginosus strain SA1 chromosome, complete genome	2036353	1252852	1262214	2036353	protease	Bacillus_phage(42.86%)	8	NA	NA
WP_003027981.1|1252852_1254601_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	4.0e-55
WP_022525343.1|1254581_1256327_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	22.6	3.3e-09
WP_003027979.1|1256499_1257207_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXE4	Bacillus_phage	42.3	7.4e-16
WP_003027978.1|1257329_1257917_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003027977.1|1257928_1259161_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.7	1.1e-131
WP_003027976.1|1259372_1259885_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	35.7	5.0e-22
WP_003027975.1|1260069_1260909_-	thymidylate synthase	NA	U5J9N5	Bacillus_phage	55.7	5.2e-85
WP_003027974.1|1260996_1262214_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	51.0	3.3e-96
>prophage 6
NZ_CP007573	Streptococcus anginosus strain SA1 chromosome, complete genome	2036353	1383163	1390235	2036353		Escherichia_phage(33.33%)	7	NA	NA
WP_003027711.1|1383163_1384090_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	47.4	5.1e-73
WP_003027712.1|1384219_1384810_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003027713.1|1385116_1386136_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	49.1	7.7e-91
WP_003039992.1|1386169_1387216_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	40.9	1.7e-61
WP_003027715.1|1387246_1387840_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	33.1	3.9e-10
WP_003027717.1|1387843_1388713_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.6	3.7e-102
WP_003027719.1|1389758_1390235_-	8-oxo-dGTP diphosphatase	NA	A0A1W6DX89	Sphingobium_phage	32.1	4.2e-07
>prophage 7
NZ_CP007573	Streptococcus anginosus strain SA1 chromosome, complete genome	2036353	1540593	1550763	2036353	protease,integrase	Streptococcus_phage(50.0%)	14	1540479:1540498	1550349:1550368
1540479:1540498	attL	AAAATTTCTTCAAATGTCAT	NA	NA	NA	NA
WP_022525189.1|1540593_1541739_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	50.8	2.1e-97
WP_080554321.1|1541859_1542474_-	helix-turn-helix domain-containing protein	NA	A0A1X9I723	Streptococcus_phage	64.8	1.4e-15
WP_003028264.1|1542706_1542889_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003028265.1|1542906_1543524_+	hypothetical protein	NA	R9QNB1	Lactococcus_phage	41.4	9.3e-31
WP_003028266.1|1543526_1543811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003028267.1|1544124_1544523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003028269.1|1544515_1544716_+	hypothetical protein	NA	A0A1X9I725	Streptococcus_phage	44.8	1.3e-05
WP_003028271.1|1545196_1545520_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	61.4	3.5e-21
WP_003028274.1|1545522_1546053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037582589.1|1546135_1547587_+	DNA primase	NA	Q9AZI5	Lactococcus_phage	39.1	8.2e-70
WP_003025520.1|1547899_1548058_+	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
WP_003028282.1|1548140_1548824_+|protease	Clp protease ClpP	protease	C8CH20	Staphylococcus_phage	47.4	6.2e-36
WP_003028283.1|1548847_1549744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003028284.1|1550559_1550763_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	79.7	3.0e-23
1550349:1550368	attR	AAAATTTCTTCAAATGTCAT	NA	NA	NA	NA
>prophage 8
NZ_CP007573	Streptococcus anginosus strain SA1 chromosome, complete genome	2036353	1573877	1582670	2036353		Streptococcus_phage(81.82%)	12	NA	NA
WP_003028316.1|1573877_1574705_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	76.6	9.0e-122
WP_003028317.1|1574729_1575353_-	endonuclease III	NA	NA	NA	NA	NA
WP_003028318.1|1575676_1576030_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	3.8e-37
WP_022525179.1|1576049_1576556_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	64.6	8.9e-56
WP_003028320.1|1576558_1577425_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	72.9	2.3e-112
WP_003043534.1|1577427_1577745_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	61.0	1.2e-29
WP_003028322.1|1577779_1578673_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	55.8	8.3e-81
WP_003028324.1|1578669_1579308_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	66.2	8.3e-75
WP_003028325.1|1579462_1580326_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	57.8	8.3e-94
WP_003028326.1|1580392_1581049_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	71.8	2.9e-83
WP_003028327.1|1581195_1581906_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	4.2e-19
WP_003028328.1|1581905_1582670_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.6e-16
>prophage 9
NZ_CP007573	Streptococcus anginosus strain SA1 chromosome, complete genome	2036353	1686592	1694418	2036353		Bacillus_virus(33.33%)	8	NA	NA
WP_022525420.1|1686592_1687504_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.5	1.1e-88
WP_003028431.1|1687567_1687792_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_003028433.1|1687902_1688646_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	1.1e-25
WP_003028435.1|1688645_1689455_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003028436.1|1689614_1690958_-	DEAD/DEAH box helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	1.5e-46
WP_037607644.1|1691115_1692351_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	23.6	4.9e-15
WP_037607642.1|1692743_1693199_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2H4N7M4	Lake_Baikal_phage	29.9	1.1e-09
WP_037607640.1|1693185_1694418_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.4	7.1e-107
