The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009483	Mycobacterium kansasii 824, complete genome	6402301	515358	592647	6402301	tRNA,integrase,transposase	Gordonia_phage(22.22%)	52	591306:591365	594672:594762
WP_023364695.1|515358_516201_-|tRNA	tRNA (adenine-N1)-methyltransferase	tRNA	NA	NA	NA	NA
WP_023364696.1|516274_517144_+	RecB family exonuclease	NA	NA	NA	NA	NA
WP_023364697.1|517140_517944_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_023364698.1|518307_519687_-	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	33.3	1.5e-60
WP_036395983.1|519683_520169_-	membrane protein	NA	NA	NA	NA	NA
WP_036393190.1|520294_521149_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023364701.1|521151_521433_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_042313214.1|521616_522447_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036393185.1|522741_524229_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	42.8	5.1e-107
WP_023364704.1|524248_526603_+	arylsulfatase	NA	NA	NA	NA	NA
WP_042313221.1|526701_527949_-	PPE family protein	NA	NA	NA	NA	NA
WP_023364706.1|528266_531845_-	methionine synthase	NA	NA	NA	NA	NA
WP_042313224.1|531964_532819_+	PAC2 family protein	NA	NA	NA	NA	NA
WP_080674189.1|532815_533994_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023364709.1|534022_534916_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023364710.1|534940_536185_-	cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase	NA	A0A1V0SAQ2	Catovirus	25.4	1.5e-27
WP_023364711.1|536606_537395_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_023364712.1|537899_538715_-	phosphatidylinositol kinase	NA	NA	NA	NA	NA
WP_023364713.1|538698_539286_-	DUF3090 domain-containing protein	NA	NA	NA	NA	NA
WP_023364714.1|539348_540077_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_023364715.1|540073_540904_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_023364716.1|540965_541268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036393495.1|541390_542440_+	lipoprotein	NA	NA	NA	NA	NA
WP_042311690.1|542493_542700_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_042313227.1|542726_543809_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_080673987.1|549520_549979_+	PPE domain-containing protein	NA	NA	NA	NA	NA
WP_080773664.1|549673_551629_-	PE family protein	NA	NA	NA	NA	NA
WP_023364722.1|552068_562223_+	PPE family protein	NA	NA	NA	NA	NA
WP_023364723.1|562401_563652_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_023364724.1|563746_564394_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_023364725.1|564706_565111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023364726.1|565080_565722_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023364727.1|565768_566299_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_036393176.1|566333_567686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023364729.1|567881_569528_-	serine recombinase	NA	NA	NA	NA	NA
WP_042311693.1|571207_572650_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_041327080.1|572738_573074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042311696.1|574439_575180_+	creatininase	NA	NA	NA	NA	NA
WP_023364735.1|575816_577211_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_036393174.1|577207_577912_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_023364740.1|578519_580463_-|integrase	integrase	integrase	A0A1B1P7C7	Bacillus_phage	24.4	4.3e-05
WP_036393475.1|580459_581494_-|integrase	integrase	integrase	A0A166YH27	Gordonia_phage	26.3	4.9e-08
WP_023364744.1|581565_582627_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.8	5.3e-66
WP_036393171.1|583127_583367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080773665.1|583736_584237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080673988.1|584544_585381_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_023364748.1|585881_586601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080673989.1|586864_588301_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	22.4	8.5e-27
WP_080673990.1|588677_590225_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023364752.1|590443_590752_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	38.5	4.2e-08
WP_023364754.1|590748_591390_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	31.3	1.1e-13
591306:591365	attL	CGATTATGCCGAGGTCTGTGTTAAGCCGAGGATCTGCGGAGATGTCCTGCGCTCGTGGGG	NA	NA	NA	NA
WP_023364757.1|591447_592647_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_023364757.1|591447_592647_+|integrase	integrase	integrase	NA	NA	NA	NA
594672:594762	attR	CCCCACGAGCGCAGGACATCTCCGCAGATCCTCGGCTTAACACAGACCTCGGCATAATCGGCGTTAAGCCGAATTCGGCTTAACTCCGACC	NA	NA	NA	NA
>prophage 2
NZ_CP009483	Mycobacterium kansasii 824, complete genome	6402301	2361670	2392391	6402301	tRNA,integrase,transposase	Bacillus_phage(33.33%)	24	2381028:2381087	2392656:2392979
WP_023367953.1|2361670_2362861_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_023367957.1|2365218_2365887_+	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
WP_023367959.1|2365897_2366674_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	1.1e-17
WP_023367961.1|2366687_2367602_-	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
WP_080674221.1|2367598_2368591_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_023367965.1|2368697_2369822_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A2R8FEI2	Cedratvirus	41.5	5.5e-05
WP_023367967.1|2369940_2370882_-	mycothiol synthase	NA	NA	NA	NA	NA
WP_023367969.1|2370878_2371643_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.6	8.9e-15
WP_023367971.1|2371755_2371989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023367973.1|2372815_2373616_+	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_036393799.1|2373908_2374376_+	DUF4395 domain-containing protein	NA	NA	NA	NA	NA
WP_023367977.1|2374414_2375257_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_023367979.1|2375258_2375561_+	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_023367983.1|2375693_2376365_+	FABP family protein	NA	NA	NA	NA	NA
WP_042312135.1|2376487_2378890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023367989.1|2378999_2380511_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
2381028:2381087	attL	GGTCAAGTCCAGGGACGTGGTGTACGACGTCGATCGTGTGATTCTTCGATTTTGTGATTT	NA	NA	NA	NA
WP_023364740.1|2381351_2383295_-|integrase	integrase	integrase	A0A1B1P7C7	Bacillus_phage	24.4	4.3e-05
WP_036393475.1|2383291_2384326_-|integrase	integrase	integrase	A0A166YH27	Gordonia_phage	26.3	4.9e-08
WP_023364744.1|2384397_2385459_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.8	5.3e-66
WP_023367992.1|2385549_2386287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023367994.1|2386532_2386769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023364744.1|2388283_2389345_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.8	5.3e-66
WP_036393475.1|2389416_2390451_+|integrase	integrase	integrase	A0A166YH27	Gordonia_phage	26.3	4.9e-08
WP_023364740.1|2390447_2392391_+|integrase	integrase	integrase	A0A1B1P7C7	Bacillus_phage	24.4	4.3e-05
2392656:2392979	attR	AAATCACAAAATCGAAGAATCACACGATCGACGTCGTACACCACGTCCCTGGACTTGACCAAATCGTTTGGGTCGCGTGCGGTTGGGTCGATTACGCGCACATGTTGGCGTTCTTGGCCGGCCTGAGCGACAGGTCGCGGGCGACTAGACGGCTAGCGTGGCAGGTGCTGATGGCGGTGCTGGATTACGCTGAGGCGGATGGTGCTTTGGCCGCTAATCCTGGGCGCGGGGTGGGGCGTAATGCGGTGCCGGCCACAGCGCCCCGCGAGCACCGCCCGCTTACCGGCCCGCAGGTTGCAGCACTTGCGCAACATGTGGCTGCAC	NA	NA	NA	NA
