The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010344	Escherichia coli ECC-1470 chromosome, complete genome	4803751	557717	653489	4803751	capsid,integrase,transposase,tail,tRNA,protease,portal,lysis,head,terminase	Enterobacteria_phage(43.64%)	95	603261:603307	644963:645009
WP_001295836.1|557717_558341_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|558311_558998_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561869.1|558994_561409_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014664.1|561838_566128_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.5	2.1e-20
WP_000877768.1|566167_566536_+	immunity protein	NA	NA	NA	NA	NA
WP_001306947.1|566535_567246_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.2e-19
WP_000879780.1|567226_567718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157992.1|568719_569814_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460129.1|569882_570809_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776392.1|571038_571521_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|571598_572414_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096878.1|572503_574285_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
WP_000943556.1|574297_575074_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|575173_576052_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401121.1|576220_577675_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|577734_579096_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001298987.1|579152_580454_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000706355.1|580475_581621_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
WP_000540968.1|581749_582535_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001347861.1|582545_583781_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703879.1|583802_584852_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580856.1|585168_586836_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495410.1|586845_588105_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001306952.1|588115_588931_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855388.1|588927_589821_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815522.1|590015_591083_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|591079_591589_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|591706_592429_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|592431_592926_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|593099_594485_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|594520_595042_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|595149_595362_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|595363_596230_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|596710_597253_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|597472_598165_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001442278.1|598195_600805_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_023568095.1|600817_601825_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250423.1|601835_602351_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|602353_602986_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
603261:603307	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|603320_604484_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000488407.1|604682_604961_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|605008_605227_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|605325_605607_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|605617_605809_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|605781_605964_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|605960_606641_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|606637_607423_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995467.1|607428_607725_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000372937.1|607799_607943_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|607911_608076_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_085949154.1|608189_609336_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_001099699.1|609637_610000_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	2.5e-60
WP_000971055.1|609996_610137_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|610222_610606_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737266.1|610795_611893_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|612466_612682_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_021534987.1|612681_613179_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	3.5e-89
WP_021537017.1|613175_613643_+|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	92.3	3.1e-71
WP_001139682.1|613630_613783_+	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_001059339.1|613985_614510_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_001537735.1|614812_615223_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
WP_001663509.1|615281_615515_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000453603.1|615902_616448_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
WP_023156388.1|616422_618348_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198149.1|618344_618551_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001324962.1|618547_620149_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.9e-309
WP_000123333.1|620129_621449_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	1.6e-234
WP_001549228.1|621458_621791_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_023156389.1|621846_622872_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	1.5e-187
WP_023566743.1|622913_623309_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	7.4e-58
WP_000752996.1|623320_623674_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_000975086.1|623685_624264_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.9e-79
WP_000683125.1|624260_624656_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	6.5e-70
WP_023566742.1|624663_625404_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	5.6e-131
WP_000479142.1|625419_625842_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_000459457.1|625823_626258_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001774776.1|626250_628830_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.5	0.0e+00
WP_000847379.1|628826_629156_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|629155_629854_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194783.1|629859_630603_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_000090895.1|630539_631172_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_041520804.1|631232_634646_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_001233071.1|634716_635316_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_000279163.1|635380_638341_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_000086514.1|639013_639604_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_023567798.1|639920_640154_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|640222_640336_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|640701_641370_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_023567799.1|641915_643400_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|643586_644540_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177469.1|645052_645814_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
644963:645009	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|645996_646887_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662366.1|646887_649860_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383946.1|649846_652084_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_041520806.1|652352_653489_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP010344	Escherichia coli ECC-1470 chromosome, complete genome	4803751	1633464	1731455	4803751	transposase,tail,protease,portal,lysis,terminase	Enterobacteria_phage(35.85%)	101	NA	NA
WP_085949154.1|1633464_1634612_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_023156471.1|1636873_1638466_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154340.1|1638544_1639498_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194889.1|1639746_1641282_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	2.1e-15
WP_000911143.1|1641275_1642304_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222721.1|1642303_1643296_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172479.1|1643307_1644330_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774189.1|1644356_1645232_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558520.1|1645255_1645546_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286566.1|1645602_1646361_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000637082.1|1646364_1647279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854633.1|1647485_1648937_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558044.1|1649163_1650582_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_001191027.1|1650720_1651080_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|1651079_1652006_-	glutaminase B	NA	NA	NA	NA	NA
WP_001296740.1|1652069_1653458_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366463.1|1653558_1654440_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000210799.1|1655781_1656972_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|1656996_1657662_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843419.1|1657873_1658308_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|1658327_1658711_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|1658742_1658961_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012618.1|1659017_1660457_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
WP_023566880.1|1660481_1662155_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_023156473.1|1662288_1662522_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000523802.1|1662549_1663872_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722571.1|1663986_1664298_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577184.1|1664496_1665195_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040079002.1|1665239_1666139_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054217.1|1666333_1667521_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|1667647_1667743_+	protein MgtS	NA	NA	NA	NA	NA
WP_023566885.1|1667961_1668852_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
WP_000671731.1|1669106_1669499_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024746.1|1669774_1670293_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001299399.1|1670336_1672382_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|1672518_1673265_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|1673353_1674040_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|1674217_1674421_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527781.1|1674456_1675917_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	8.6e-43
WP_041520817.1|1676005_1677289_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001421370.1|1678005_1678203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001613101.1|1679022_1679604_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.7	4.0e-100
WP_071886609.1|1679603_1683134_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	37.3	2.5e-11
WP_001534161.1|1683198_1683798_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	95.5	3.5e-107
WP_041520818.1|1683865_1687345_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.8	0.0e+00
WP_000090943.1|1687405_1688008_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	4.0e-87
WP_024170790.1|1687944_1688688_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	4.7e-146
WP_001152385.1|1688693_1689392_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_000447247.1|1689401_1689731_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
WP_032236622.1|1689730_1692796_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.3	0.0e+00
WP_023156369.1|1692767_1693097_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	98.2	8.4e-55
WP_001440689.1|1693105_1693492_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	6.1e-65
WP_000211099.1|1693552_1694296_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001079398.1|1694307_1694709_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677108.1|1694705_1695284_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_023156367.1|1695295_1695571_-	hypothetical protein	NA	K7PH43	Enterobacteria_phage	97.8	2.5e-44
WP_001097050.1|1695563_1695887_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001360054.1|1695973_1698001_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_077688660.1|1697945_1699526_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	2.4e-288
WP_001072975.1|1699453_1699666_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001700320.1|1699662_1701765_-|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.9	0.0e+00
WP_000373426.1|1701764_1702259_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	2.2e-83
WP_023567552.1|1702830_1703523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000700651.1|1703691_1704228_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	83.5	1.1e-72
WP_001101168.1|1704224_1704767_-	lysozyme	NA	Q08J98	Stx2-converting_phage	87.8	3.0e-94
WP_085949154.1|1705045_1706192_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_001378675.1|1706245_1706398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000192451.1|1706363_1706708_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_000839561.1|1706712_1706928_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_072162994.1|1707179_1707554_-	tolA family protein	NA	NA	NA	NA	NA
WP_000506936.1|1707725_1708154_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000562553.1|1708520_1708652_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_023567548.1|1709552_1710374_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	54.0	4.5e-81
WP_000904112.1|1710370_1710745_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_023567547.1|1710757_1711807_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.4e-108
WP_032140164.1|1711808_1712087_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_000980999.1|1712153_1712405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|1712621_1712834_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_001546200.1|1712878_1712986_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_022645725.1|1713848_1714871_-	hypothetical protein	NA	Q858S2	Enterobacteria_phage	62.4	2.5e-105
WP_001151189.1|1715070_1715472_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_000054505.1|1715512_1716478_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.9e-55
WP_023567544.1|1716458_1716980_-	phage regulatory protein CII	NA	NA	NA	NA	NA
WP_000476993.1|1716963_1717191_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|1717268_1717676_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379589.1|1717868_1718024_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000344950.1|1718025_1718601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1719087_1719276_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083276.1|1719272_1719464_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_041520819.1|1719557_1722029_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_000005552.1|1722101_1722353_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001459782.1|1722387_1723668_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	2.3e-156
WP_001389342.1|1723669_1723798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836057.1|1723855_1724875_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_023567537.1|1724886_1726101_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.8e-46
WP_000598292.1|1726306_1726633_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1726767_1727109_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1727143_1727704_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_023567536.1|1727706_1728417_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1728524_1728830_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041554.1|1729028_1731455_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
>prophage 3
NZ_CP010344	Escherichia coli ECC-1470 chromosome, complete genome	4803751	2247517	2286787	4803751	capsid,integrase,tail,tRNA,holin,plate,portal,lysis,head,terminase	Escherichia_phage(32.56%)	51	2252575:2252602	2284971:2284998
WP_000675157.1|2247517_2248921_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	1.6e-33
WP_000137873.1|2248917_2249640_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000929408.1|2249830_2250163_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2250371_2250668_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2250669_2250966_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_041520903.1|2251068_2252430_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	2.5e-217
2252575:2252602	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2252702_2252921_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_023567671.1|2253002_2254166_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.7	3.1e-205
WP_000978902.1|2254165_2254645_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_023567672.1|2254659_2257107_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	98.9	0.0e+00
WP_000785970.1|2257099_2257219_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031308.1|2257251_2257527_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	97.8	6.3e-40
WP_001251408.1|2257583_2258102_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_023156267.1|2258114_2259305_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_023156269.1|2259627_2260668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023156270.1|2260831_2261359_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	93.7	9.8e-90
WP_041520905.1|2261362_2263492_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	55.9	2.8e-143
WP_023156273.1|2263502_2264033_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	98.9	5.6e-101
WP_001121474.1|2264025_2264934_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_000127163.1|2264938_2265286_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_023156274.1|2265282_2265918_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	2.9e-112
WP_023156275.1|2265995_2266751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023156276.1|2266747_2267206_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	64.4	2.4e-44
WP_000917188.1|2267198_2267666_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.1e-81
WP_072134039.1|2267628_2267802_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	6.8e-24
WP_021038205.1|2267773_2268199_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	4.7e-66
WP_023567677.1|2268186_2268612_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	6.1e-58
WP_023567678.1|2268626_2269124_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
WP_000123123.1|2269123_2269405_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|2269408_2269612_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|2269611_2270121_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203439.1|2270220_2270964_-|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
WP_023567679.1|2270967_2272041_-|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.4	3.9e-202
WP_020233502.1|2272099_2272954_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	8.1e-134
WP_000156872.1|2273127_2274900_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_041520911.1|2274899_2275919_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	95.6	1.9e-190
WP_023567683.1|2275995_2276466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087891114.1|2276458_2276728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001288417.1|2277041_2278880_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	99.7	0.0e+00
WP_023567685.1|2279033_2281319_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.7	0.0e+00
WP_000027664.1|2281308_2281584_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|2281580_2281805_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277898.1|2281807_2282107_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557703.1|2282106_2282331_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217684.1|2282394_2282895_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
WP_001005162.1|2282891_2283062_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000043869.1|2283072_2283348_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|2283462_2283762_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985260.1|2283877_2284891_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000716757.1|2285155_2285473_-	hypothetical protein	NA	NA	NA	NA	NA
2284971:2284998	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2285887_2286787_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 4
NZ_CP010344	Escherichia coli ECC-1470 chromosome, complete genome	4803751	2324814	2334256	4803751		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292767.1|2324814_2325951_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
WP_001351453.1|2325947_2327948_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|2328072_2328534_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001442361.1|2328574_2329045_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	6.7e-82
WP_000598641.1|2329091_2329811_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2329807_2331493_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2331714_2332446_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|2332505_2332613_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2332593_2333325_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569327.1|2333329_2334256_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 5
NZ_CP010344	Escherichia coli ECC-1470 chromosome, complete genome	4803751	2533823	2587539	4803751	integrase,transposase,tail,tRNA,protease,plate	Shigella_phage(33.33%)	57	2562350:2562366	2590004:2590020
WP_001283581.1|2533823_2534636_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2534635_2535649_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|2535714_2536851_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|2536949_2537945_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127749.1|2537941_2539120_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2539403_2540624_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683799.1|2540782_2542789_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2542909_2543188_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|2543221_2543770_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447356.1|2543769_2544579_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043821.1|2544578_2545403_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2545406_2546492_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|2546526_2547459_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_023567769.1|2547624_2548176_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001356216.1|2548297_2549170_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730291.1|2549156_2549681_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|2549677_2550148_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000842082.1|2550144_2550693_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281615.1|2550667_2551420_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112828.1|2551439_2554082_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2554163_2554727_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2555401_2555887_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425062.1|2556089_2558234_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|2558233_2559544_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|2559723_2560008_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2560379_2561720_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937819.1|2562086_2563145_+	hypothetical protein	NA	NA	NA	NA	NA
2562350:2562366	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000776768.1|2563326_2564082_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2564375_2565308_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958707.1|2565619_2566777_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	98.4	3.8e-219
WP_000959491.1|2566970_2567558_+	DUF1919 domain-containing protein	NA	NA	NA	NA	NA
WP_000554702.1|2568137_2569061_-	hypothetical protein	NA	U5P0I1	Shigella_phage	84.0	2.4e-51
WP_000383556.1|2569064_2569649_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	5.4e-113
WP_000785301.1|2569639_2570698_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	4.3e-201
WP_000424728.1|2570684_2571110_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	1.5e-80
WP_000643722.1|2571109_2571658_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	96.2	1.8e-94
WP_000999503.1|2571657_2572737_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	3.4e-206
WP_000219916.1|2572733_2574062_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.2	3.0e-244
WP_000807204.1|2574122_2575958_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.0	1.4e-305
WP_000661047.1|2576099_2576369_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_085949154.1|2576530_2577678_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000065364.1|2577890_2578259_+	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	99.2	2.6e-65
WP_001198861.1|2578331_2578496_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2578464_2578608_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995467.1|2578682_2578979_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000100847.1|2578984_2579770_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_041520954.1|2579766_2580447_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.8	8.7e-131
WP_000149544.1|2580443_2580626_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|2580598_2580790_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|2580800_2581082_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763363.1|2581180_2581402_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120062.1|2581612_2582215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281200.1|2582457_2582802_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_001163428.1|2582926_2583127_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001197023.1|2583656_2584904_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274887.1|2584975_2585890_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|2586105_2587539_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
2590004:2590020	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 6
NZ_CP010344	Escherichia coli ECC-1470 chromosome, complete genome	4803751	2851528	2864836	4803751	integrase	Enterobacteria_phage(63.64%)	13	2858140:2858154	2875944:2875958
WP_000162574.1|2851528_2852011_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_021513174.1|2852772_2853960_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.6	1.3e-105
WP_021513175.1|2853991_2855800_-	DEAD/DEAH box helicase family protein	NA	J7KK96	Streptococcus_phage	28.0	1.6e-14
WP_000446132.1|2856118_2856691_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638628.1|2856764_2857265_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001606455.1|2857261_2857996_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.6	9.4e-131
2858140:2858154	attL	TTACTGTTTGTTTTT	NA	NA	NA	NA
WP_001149160.1|2858548_2858815_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980227.1|2858811_2859411_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001244665.1|2859403_2859691_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459315.1|2859683_2860139_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|2860274_2860595_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_021513178.1|2860609_2862934_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
WP_023567070.1|2863606_2864836_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	97.1	3.3e-229
2875944:2875958	attR	AAAAACAAACAGTAA	NA	NA	NA	NA
>prophage 7
NZ_CP010344	Escherichia coli ECC-1470 chromosome, complete genome	4803751	2957808	2964948	4803751		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|2957808_2960370_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|2960475_2961132_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|2961182_2961950_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2962145_2963054_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590391.1|2963050_2964313_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	9.8e-136
WP_001278994.1|2964309_2964948_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
NZ_CP010345	Escherichia coli ECC-1470 plasmid pECC-1470_100, complete sequence	100061	9178	61870	100061	transposase,protease,integrase	Macacine_betaherpesvirus(33.33%)	38	32577:32597	60318:60338
WP_001351566.1|9178_9511_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.3	2.0e-32
WP_000271664.1|9526_9769_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	60.8	2.6e-21
WP_000286435.1|10722_11415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064754734.1|12167_17105_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_041521550.1|17738_21854_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	36.4	2.5e-124
WP_001193612.1|22574_23522_+|protease	omptin family outer membrane protease OmpP	protease	NA	NA	NA	NA
WP_072170627.1|23626_25114_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001603634.1|25870_26611_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_000361611.1|26895_27873_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_041521552.1|29047_29689_-	hypothetical protein	NA	NA	NA	NA	NA
32577:32597	attL	GATGAAATAGGCTATCTGCCG	NA	NA	NA	NA
WP_160454829.1|33729_34113_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	29.5	6.6e-11
WP_041521554.1|34190_36635_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_041521555.1|37918_38662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041521556.1|38693_39110_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_041521557.1|39652_41791_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001441071.1|41960_42362_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261288.1|42385_42616_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000813639.1|43208_43427_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|43428_43734_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_050544099.1|43762_44542_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.6e-57
WP_000852146.1|45262_46018_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000772446.1|46605_47772_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|47771_48743_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_010892536.1|50514_50820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041521558.1|50896_51580_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_001104904.1|51580_51802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|51695_52250_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_072095193.1|53608_53911_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|53957_54380_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|54376_54568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032165621.1|54686_55076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290801.1|55364_55904_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.0	4.9e-44
WP_000005990.1|55960_56194_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117172.1|56259_58218_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	7.3e-21
WP_023566816.1|58272_58713_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001302184.1|59703_59862_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001297096.1|60068_60848_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
60318:60338	attR	CGGCAGATAGCCTATTTCATC	NA	NA	NA	NA
WP_000255956.1|60847_61870_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
