The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009300	Bacillus cereus D17 chromosome, complete genome	5379685	641640	715680	5379685	capsid,tRNA,head,portal,tail,integrase,protease,terminase	Bacillus_phage(72.92%)	83	645201:645216	656764:656779
WP_042512226.1|641640_642771_-|integrase	site-specific integrase	integrase	A0A0U4JNS1	Bacillus_phage	39.1	2.1e-65
WP_042512227.1|643109_643919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512228.1|643919_644783_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_042512229.1|644871_645216_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	38.4	7.2e-17
645201:645216	attL	CTCCAAATGTATTCAT	NA	NA	NA	NA
WP_042512230.1|645653_646751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000153814.1|647175_647544_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	39.6	4.1e-10
WP_000516834.1|647762_647990_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000284333.1|648041_648242_+	helix-turn-helix domain-containing protein	NA	A0A0U4IIS1	Bacillus_phage	48.0	3.9e-07
WP_042512233.1|648675_649551_+	DnaD domain protein	NA	A0A1B1P7T6	Bacillus_phage	98.1	5.7e-50
WP_042512234.1|649519_650317_+	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	98.9	8.1e-144
WP_042512235.1|650338_650533_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	98.4	6.5e-31
WP_000805174.1|650558_650732_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	100.0	1.2e-25
WP_000811866.1|650746_651001_+	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	94.0	6.5e-39
WP_042512236.1|651013_651439_+	hypothetical protein	NA	A0A1B1P8B9	Bacillus_phage	41.6	3.8e-15
WP_042512237.1|651950_652361_+	hypothetical protein	NA	Q2LI92	Bacillus_phage	68.4	1.6e-50
WP_042512238.1|652589_653309_+	hypothetical protein	NA	D2XR55	Bacillus_phage	82.4	9.3e-115
WP_042512239.1|653347_653722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512240.1|653838_654210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512241.1|654236_654566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803282.1|654774_654897_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_042512243.1|655211_655694_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	1.9e-71
WP_042512244.1|655693_656236_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.1	2.5e-88
WP_042512245.1|656811_657561_+	site-specific DNA-methyltransferase	NA	A0A0H3UZL7	Geobacillus_virus	58.9	2.2e-79
656764:656779	attR	CTCCAAATGTATTCAT	NA	NA	NA	NA
WP_000778977.1|657709_657922_+	hypothetical protein	NA	A0A1B1P8F3	Bacillus_phage	100.0	3.5e-30
WP_000376884.1|658055_658247_+	hypothetical protein	NA	Q3HKW9	Bacillus_phage	76.2	7.3e-19
WP_042512246.1|658266_658521_+	hypothetical protein	NA	A0A2H4J3B1	uncultured_Caudovirales_phage	95.2	7.4e-43
WP_042512247.1|658510_658888_+	HNH endonuclease	NA	A0A2H4J3B4	uncultured_Caudovirales_phage	98.4	6.8e-69
WP_042512248.1|659026_659527_+|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	74.7	8.0e-65
WP_042512249.1|659523_661218_+|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	64.2	8.1e-210
WP_042512250.1|661406_662660_+|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	97.4	9.8e-237
WP_001259166.1|662646_663357_+|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	95.3	2.2e-124
WP_042512251.1|663394_664567_+|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	93.3	3.4e-199
WP_000244596.1|664587_664866_+|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	94.6	5.8e-41
WP_029440521.1|664862_665186_+|head	phage head closure protein	head	H0USW8	Bacillus_phage	92.5	7.0e-54
WP_000763222.1|665178_665616_+	HK97 gp10 family phage protein	NA	A0A288WGM7	Bacillus_phage	100.0	4.6e-77
WP_042512252.1|665612_665972_+	DUF3168 domain-containing protein	NA	A0A288WFU0	Bacillus_phage	100.0	3.5e-62
WP_001982989.1|665972_666581_+|tail	tail protein	tail	Q2I8F2	Bacillus_phage	100.0	1.4e-108
WP_042512253.1|666630_666948_+	hypothetical protein	NA	A0A288WFU2	Bacillus_phage	99.0	7.5e-53
WP_000344052.1|666977_667154_+	hypothetical protein	NA	A0A288WFY6	Bacillus_phage	100.0	3.4e-15
WP_042512254.1|667168_671020_+|tail	phage tail tape measure protein	tail	Q2I8F0	Bacillus_phage	98.6	0.0e+00
WP_042512255.1|671034_672525_+|tail	phage tail protein	tail	Q2LIB8	Bacillus_phage	98.6	2.2e-291
WP_042512256.1|672521_676451_+	peptidase S74	NA	A0A288WFW2	Bacillus_phage	83.7	0.0e+00
WP_042512257.1|676572_676797_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	85.1	1.6e-25
WP_029440514.1|676861_677098_+	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	97.4	1.2e-18
WP_042512258.1|677097_677337_+	hypothetical protein	NA	A0A2H4J378	uncultured_Caudovirales_phage	97.5	5.0e-33
WP_042512259.1|677333_678389_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A288WFQ3	Bacillus_phage	93.2	1.6e-192
WP_042512260.1|678427_678970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512262.1|679353_680202_+	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	37.9	1.0e-19
WP_042512263.1|680631_680829_-	helix-turn-helix domain-containing protein	NA	A0A1B1P7S8	Bacillus_phage	68.8	3.5e-16
WP_042512264.1|680990_681293_+	hypothetical protein	NA	Q2I8E3	Bacillus_phage	93.0	2.4e-48
WP_042512265.1|681295_681478_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	95.0	2.7e-23
WP_042512266.1|681595_682777_+	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	85.0	4.2e-197
WP_042512267.1|682718_683336_+	phage protein	NA	Q2LIA9	Bacillus_phage	88.1	2.1e-99
WP_000872145.1|683620_684121_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_001984764.1|684182_684356_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_000246476.1|684485_684992_+	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	34.7	3.0e-11
WP_000506702.1|685026_685500_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001995047.1|685874_686762_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_001995077.1|686841_688458_+	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
WP_000481786.1|688827_689760_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_000067081.1|689775_690138_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_000600098.1|690210_692310_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_001266229.1|692391_694308_+	stage V sporulation protein D	NA	NA	NA	NA	NA
WP_001995054.1|694516_695992_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000893058.1|696014_696989_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_042512268.1|696989_698342_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_000753510.1|698432_699524_+	stage V sporulation protein E	NA	NA	NA	NA	NA
WP_001995057.1|699629_700724_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_001995034.1|700785_701691_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000798225.1|701789_702560_+	cell division protein DivIB	NA	NA	NA	NA	NA
WP_001087551.1|702960_704268_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_042512269.1|704307_705462_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_000261988.1|705774_706692_+	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_000976948.1|706711_707431_+	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	3.3e-19
WP_000197753.1|707588_708368_+	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.5	5.8e-46
WP_000619397.1|708542_708821_+	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_001209022.1|708938_709757_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_000218170.1|709753_710428_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000119136.1|710447_710918_+	cell division protein SepF	NA	NA	NA	NA	NA
WP_000450918.1|710924_711188_+	YggT family protein	NA	NA	NA	NA	NA
WP_000029721.1|711203_711971_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_001131611.1|712060_712567_+	septum site-determining protein DivIVA	NA	NA	NA	NA	NA
WP_000455931.1|712914_715680_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2P1ELB8	Moumouvirus	27.1	2.7e-85
>prophage 2
NZ_CP009300	Bacillus cereus D17 chromosome, complete genome	5379685	2054853	2087340	5379685	holin,portal,tail,terminase	Bacillus_phage(73.91%)	42	NA	NA
WP_042512714.1|2054853_2056317_-	recombinase family protein	NA	Q2XVV3	Bacillus_phage	54.1	2.4e-141
WP_042512715.1|2056662_2056881_-	hypothetical protein	NA	A0A0U3TKC9	Bacillus_phage	50.8	1.1e-07
WP_042512717.1|2057120_2057744_-	phage protein	NA	H0USY2	Bacillus_phage	78.2	1.9e-92
WP_042512718.1|2057685_2058876_-	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	64.4	7.8e-143
WP_042512719.1|2058991_2059174_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	1.5e-21
WP_042512720.1|2059170_2059473_-	hypothetical protein	NA	A0A288WG38	Bacillus_phage	56.1	5.2e-27
WP_042512721.1|2059472_2059739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512722.1|2059924_2060125_+	helix-turn-helix transcriptional regulator	NA	Q2I8E4	Bacillus_phage	54.5	8.2e-13
WP_139303532.1|2060769_2060892_-	DUF3961 domain-containing protein	NA	Q3HKZ4	Bacillus_phage	62.2	1.3e-08
WP_042512723.1|2060879_2061242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033694537.1|2061421_2061661_+	helix-turn-helix transcriptional regulator	NA	A0A288WFZ7	Bacillus_phage	67.1	2.0e-21
WP_042512724.1|2061737_2062070_+	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	47.2	4.8e-18
WP_042512725.1|2062093_2062291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512726.1|2062292_2063639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512727.1|2064604_2064835_-|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	73.3	1.2e-23
WP_042512728.1|2064849_2065134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512729.1|2065227_2065503_-	hypothetical protein	NA	A0A1B1P7E8	Bacillus_phage	72.9	1.4e-31
WP_080334514.1|2065522_2067901_-	hypothetical protein	NA	A0A1B1P7E6	Bacillus_phage	35.2	6.9e-183
WP_042512730.1|2067897_2069409_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	58.6	5.1e-163
WP_042513567.1|2069421_2073210_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	40.3	9.4e-41
WP_042512731.1|2073246_2073501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512732.1|2073590_2073968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512733.1|2074020_2074536_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_042512734.1|2074549_2074957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512735.1|2074963_2075326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512736.1|2075325_2075700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512737.1|2075703_2076510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512738.1|2076514_2076856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512739.1|2076885_2077110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512740.1|2077160_2077568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512741.1|2077666_2078791_-	DUF5309 family protein	NA	NA	NA	NA	NA
WP_042512742.1|2078853_2079636_-	scaffolding protein	NA	Q4ZC70	Staphylococcus_virus	40.9	4.4e-09
WP_042512743.1|2079694_2081212_-|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	30.4	1.6e-68
WP_042512744.1|2081228_2082944_-|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	52.9	5.0e-151
WP_042512745.1|2082960_2083389_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	50.4	2.6e-32
WP_042512746.1|2084158_2084548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512747.1|2084808_2085135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512748.1|2085124_2085307_-	hypothetical protein	NA	A0A1B1P7M4	Bacillus_phage	48.0	4.4e-05
WP_042512749.1|2085469_2086669_+	protein kinase	NA	J2YXI2	Acanthamoeba_polyphaga_lentillevirus	28.0	1.3e-07
WP_042512750.1|2086665_2086863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512751.1|2086859_2087057_-	hypothetical protein	NA	A0A1L2JY50	Aeribacillus_phage	47.4	8.6e-07
WP_042512752.1|2087061_2087340_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	62.3	1.0e-13
>prophage 3
NZ_CP009300	Bacillus cereus D17 chromosome, complete genome	5379685	2543811	2553129	5379685		Bacillus_phage(71.43%)	9	NA	NA
WP_042512871.1|2543811_2544684_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	45.1	7.9e-68
WP_042512872.1|2544818_2545490_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	86.9	6.5e-62
WP_000818985.1|2545639_2546359_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000823559.1|2546554_2547142_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_042512873.1|2547166_2548240_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	88.2	2.7e-171
WP_000254054.1|2548236_2548923_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	93.9	1.3e-118
WP_042512874.1|2549002_2550763_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.7	5.7e-267
WP_001194301.1|2551003_2551768_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755546.1|2551866_2553129_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	6.8e-12
>prophage 4
NZ_CP009300	Bacillus cereus D17 chromosome, complete genome	5379685	2919542	2928887	5379685		Bacillus_phage(85.71%)	15	NA	NA
WP_080334529.1|2919542_2920997_-	recombinase family protein	NA	Q3HKZ2	Bacillus_phage	98.1	3.1e-274
WP_042512998.1|2921063_2921927_-	helix-turn-helix domain-containing protein	NA	A0A288WFX4	Bacillus_phage	99.7	4.5e-156
WP_142337077.1|2921942_2922062_-	DUF3961 domain-containing protein	NA	Q3HKZ4	Bacillus_phage	74.4	4.7e-08
WP_042512999.1|2922225_2922462_+	helix-turn-helix domain-containing protein	NA	A0A288WFZ7	Bacillus_phage	100.0	1.2e-34
WP_042513000.1|2922494_2923112_-	phage protein	NA	Q2LIA9	Bacillus_phage	98.5	1.2e-110
WP_042513001.1|2923053_2924235_-	cell division protein FtsK	NA	Q3HKZ7	Bacillus_phage	99.7	1.7e-227
WP_001982935.1|2924352_2924535_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	100.0	4.2e-24
WP_042513002.1|2924531_2924840_-	hypothetical protein	NA	Q2I8E3	Bacillus_phage	90.2	6.6e-46
WP_042513003.1|2924999_2925197_+	helix-turn-helix domain-containing protein	NA	A0A288WG80	Bacillus_phage	95.4	8.3e-26
WP_042513004.1|2925201_2925786_+	type IV secretory system conjugative DNA transfer family protein	NA	A0A288WFT6	Bacillus_phage	99.0	6.8e-108
WP_042513005.1|2925853_2926183_+	hypothetical protein	NA	A0A288WGP7	Bacillus_phage	96.3	1.0e-52
WP_042513006.1|2926304_2927303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513007.1|2927359_2928415_-	N-acetylmuramoyl-L-alanine amidase	NA	D3WK93	Bacillus_phage	97.7	3.6e-200
WP_016716828.1|2928411_2928651_-	hypothetical protein	NA	A0A2H4J378	uncultured_Caudovirales_phage	98.7	1.7e-33
WP_029440514.1|2928650_2928887_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	97.4	1.2e-18
>prophage 5
NZ_CP009300	Bacillus cereus D17 chromosome, complete genome	5379685	2932787	2996834	5379685	capsid,head,portal,tail,protease,transposase,coat,terminase	Bacillus_phage(92.31%)	61	NA	NA
WP_042513008.1|2932787_2934278_-|tail	phage tail protein	tail	A0A288WFS2	Bacillus_phage	99.4	2.3e-293
WP_042513009.1|2934292_2938144_-|tail	phage tail tape measure protein	tail	A0A288WG36	Bacillus_phage	96.1	0.0e+00
WP_042513010.1|2938366_2938684_-	hypothetical protein	NA	A0A288WFU6	Bacillus_phage	100.0	4.4e-53
WP_001982989.1|2938733_2939342_-|tail	tail protein	tail	Q2I8F2	Bacillus_phage	100.0	1.4e-108
WP_001983061.1|2939342_2939702_-	DUF3168 domain-containing protein	NA	Q2I8F3	Bacillus_phage	100.0	5.9e-62
WP_001983159.1|2939698_2940139_-	phage protein, HK97 gp10 family	NA	Q2I8F4	Bacillus_phage	100.0	4.2e-78
WP_001983098.1|2940131_2940455_-|head	phage head closure protein	head	Q2I8F5	Bacillus_phage	100.0	6.7e-57
WP_042513011.1|2940451_2940742_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A288WFX0	Bacillus_phage	100.0	1.1e-47
WP_042513012.1|2940759_2941938_-|capsid	phage major capsid protein	capsid	Q2I8F7	Bacillus_phage	99.7	1.9e-213
WP_001982892.1|2941976_2942597_-|head,protease	HK97 family phage prohead protease	head,protease	Q2I8F8	Bacillus_phage	100.0	4.8e-112
WP_001983089.1|2942559_2943858_-|portal	phage portal protein	portal	Q2LIC9	Bacillus_phage	100.0	4.1e-246
WP_042513013.1|2943873_2945571_-|terminase	terminase large subunit	terminase	A0A288WFW5	Bacillus_phage	99.8	0.0e+00
WP_042513014.1|2945567_2946053_-|terminase	phage terminase small subunit P27 family	terminase	A0A288WFZ9	Bacillus_phage	100.0	7.7e-81
WP_042513015.1|2946153_2946537_-	HNH endonuclease	NA	Q2I8B2	Bacillus_phage	97.6	2.0e-68
WP_080334540.1|2946605_2946968_-	hypothetical protein	NA	A0A288WG64	Bacillus_phage	74.8	2.4e-39
WP_042513016.1|2947210_2947465_-	hypothetical protein	NA	A0A288WG25	Bacillus_phage	97.6	3.7e-42
WP_042513592.1|2947484_2947676_-	hypothetical protein	NA	A0A288WFV5	Bacillus_phage	100.0	9.5e-27
WP_042513017.1|2947704_2947947_-	hypothetical protein	NA	A0A288WG15	Bacillus_phage	100.0	1.5e-40
WP_042513018.1|2947951_2948173_-	hypothetical protein	NA	A0A288WG47	Bacillus_phage	98.6	1.0e-32
WP_042513019.1|2948179_2948404_-	hypothetical protein	NA	Q3HKX2	Bacillus_phage	82.4	2.5e-26
WP_052494330.1|2948436_2949183_-	site-specific DNA-methyltransferase	NA	A0A0H3UZL7	Geobacillus_virus	60.1	1.1e-78
WP_001982886.1|2949376_2949772_-	sigma-70 family RNA polymerase sigma factor	NA	A0A288WFT8	Bacillus_phage	100.0	2.0e-66
WP_144402435.1|2949945_2950068_-	DUF3983 domain-containing protein	NA	A0A288WG42	Bacillus_phage	97.5	6.9e-15
WP_042513020.1|2950220_2950409_-	hypothetical protein	NA	A0A288WG27	Bacillus_phage	90.3	8.2e-23
WP_042513021.1|2950444_2950987_-	hypothetical protein	NA	A0A288WG53	Bacillus_phage	100.0	7.5e-101
WP_042513022.1|2951044_2951521_-	hypothetical protein	NA	A0A288WFT9	Bacillus_phage	99.4	7.0e-95
WP_042513023.1|2951517_2952264_-	sigma-70 family RNA polymerase sigma factor	NA	A0A288WFV7	Bacillus_phage	100.0	1.3e-135
WP_001982974.1|2952256_2952490_-	hypothetical protein	NA	Q3HKY5	Bacillus_phage	100.0	8.9e-35
WP_042513024.1|2952508_2953420_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	99.0	2.2e-169
WP_042513025.1|2953435_2954371_-	chromosomal replication initiator protein DnaA	NA	A0A288WFS8	Bacillus_phage	95.0	1.5e-141
WP_042513026.1|2954499_2955150_-	hypothetical protein	NA	A0A288WGQ2	Bacillus_phage	98.1	1.7e-120
WP_042513027.1|2955560_2956307_-	antirepressor	NA	A0A288WG93	Bacillus_phage	99.6	3.6e-138
WP_042513028.1|2956749_2956977_-	helix-turn-helix transcriptional regulator	NA	A0A288WG39	Bacillus_phage	100.0	2.3e-35
WP_015980883.1|2957136_2957493_+	helix-turn-helix transcriptional regulator	NA	Q2I8D5	Bacillus_phage	100.0	3.9e-58
WP_052494350.1|2957833_2959168_-	hypothetical protein	NA	A0A288WGA2	Bacillus_phage	99.3	1.7e-247
WP_001228046.1|2969370_2969511_-	FbpB family small basic protein	NA	NA	NA	NA	NA
WP_000757056.1|2969695_2970562_-	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	33.6	4.2e-21
WP_042513029.1|2970692_2971418_-	magnesium transporter	NA	NA	NA	NA	NA
WP_000606864.1|2972110_2972497_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000084951.1|2972493_2973729_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	23.3	5.3e-09
WP_000169023.1|2973732_2974044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235536.1|2974127_2974595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513030.1|2974859_2976215_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	32.5	1.5e-44
WP_000637547.1|2977245_2978085_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_000451813.1|2978087_2978360_-	YpbS family protein	NA	NA	NA	NA	NA
WP_000117682.1|2978381_2978849_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000369736.1|2978921_2979176_+	DUF3931 domain-containing protein	NA	NA	NA	NA	NA
WP_042513031.1|2979179_2982839_-	GTPase	NA	NA	NA	NA	NA
WP_000193104.1|2983388_2984552_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_000809214.1|2984624_2985947_-	xanthine permease	NA	NA	NA	NA	NA
WP_000866488.1|2985950_2986544_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000628422.1|2986869_2987616_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_001091345.1|2988150_2989047_+	macrolide 2'-phosphotransferase MphL	NA	NA	NA	NA	NA
WP_000386777.1|2989101_2989575_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042513032.1|2989619_2991137_-	carboxypeptidase	NA	NA	NA	NA	NA
WP_000493715.1|2991241_2993179_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_000376886.1|2993316_2993499_-	DUF3921 domain-containing protein	NA	NA	NA	NA	NA
WP_000521234.1|2993560_2994700_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_000622430.1|2995358_2995697_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_042513033.1|2995794_2996349_-	DUF1273 domain-containing protein	NA	A0A1P8CWY2	Bacillus_phage	27.0	4.8e-10
WP_000546294.1|2996405_2996834_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 6
NZ_CP009300	Bacillus cereus D17 chromosome, complete genome	5379685	4203075	4211452	5379685		Synechococcus_phage(33.33%)	8	NA	NA
WP_000088592.1|4203075_4203663_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	1.2e-27
WP_001262436.1|4203659_4204700_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.4	9.4e-68
WP_000879029.1|4204806_4206222_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
WP_000055577.1|4206206_4208426_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.7e-162
WP_000666792.1|4208409_4209093_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278823.1|4209089_4209344_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170540.1|4209336_4210056_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	2.0e-48
WP_000625683.1|4210144_4211452_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
>prophage 7
NZ_CP009300	Bacillus cereus D17 chromosome, complete genome	5379685	5040616	5127097	5379685	capsid,tRNA,head,portal,tail,bacteriocin,protease,integrase,coat,terminase	uncultured_Caudovirales_phage(31.58%)	98	5059315:5059334	5132481:5132500
WP_002003767.1|5040616_5041432_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001241000.1|5041517_5042249_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000744208.1|5042286_5042862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435948.1|5042980_5043289_+	YutD family protein	NA	NA	NA	NA	NA
WP_042513424.1|5043334_5043832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000392606.1|5044204_5044471_-	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
WP_000439090.1|5044488_5045460_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000274012.1|5045607_5046048_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_042513425.1|5046119_5046752_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000276472.1|5046861_5047626_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_042513426.1|5047850_5048432_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001021173.1|5048633_5049422_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	6.7e-34
WP_042513427.1|5049405_5051979_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_000351173.1|5052481_5052961_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000665104.1|5052981_5053473_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.1	7.9e-41
WP_042513428.1|5053593_5054595_+|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_001125503.1|5054656_5054872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000431159.1|5055188_5055425_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_000248594.1|5055631_5055940_+	YuzD family protein	NA	NA	NA	NA	NA
WP_000494420.1|5055908_5056787_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_000379272.1|5056885_5057563_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_042513429.1|5057893_5058688_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000212737.1|5058923_5059265_+	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
5059315:5059334	attL	TTTTGTCGGTAAGTCGATAT	NA	NA	NA	NA
WP_042513430.1|5059445_5060243_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000470281.1|5060226_5060886_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	2.0e-23
WP_000994518.1|5060940_5061114_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000682073.1|5061344_5062415_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000595027.1|5062766_5063006_+	YuzB family protein	NA	NA	NA	NA	NA
WP_000077386.1|5063249_5064116_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000573825.1|5064157_5064511_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	3.7e-16
WP_042513431.1|5064738_5065092_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	38.7	5.0e-13
WP_042513432.1|5065179_5066241_-|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	97.2	9.2e-196
WP_042513433.1|5066320_5066953_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	99.0	1.1e-116
WP_042513434.1|5067111_5067339_+	helix-turn-helix transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	93.3	1.2e-33
WP_042513435.1|5067480_5067669_+	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	85.5	2.6e-21
WP_042513436.1|5067854_5068082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513437.1|5068082_5068433_+	hypothetical protein	NA	A0A1B2AQ59	Phage_Wrath	75.9	3.2e-44
WP_042513438.1|5068699_5068915_+	hypothetical protein	NA	A0A2H4JCV1	uncultured_Caudovirales_phage	93.0	1.4e-29
WP_042513439.1|5068899_5069103_+	hypothetical protein	NA	A0A2H4J979	uncultured_Caudovirales_phage	83.6	4.7e-24
WP_042513440.1|5069102_5069384_+	hypothetical protein	NA	A0A1B2AQ09	Phage_Wrath	58.7	2.5e-23
WP_042513441.1|5069361_5069910_+	hypothetical protein	NA	A0A1B2AQ11	Phage_Wrath	95.6	1.1e-91
WP_042513442.1|5069917_5070586_+	hypothetical protein	NA	A0A2H4JB05	uncultured_Caudovirales_phage	60.8	3.0e-67
WP_042513443.1|5070591_5071284_+	AAA family ATPase	NA	A0A2H4J9A0	uncultured_Caudovirales_phage	94.1	1.6e-116
WP_042513444.1|5071283_5071757_+	DUF669 domain-containing protein	NA	A0A2H4J986	uncultured_Caudovirales_phage	100.0	6.6e-85
WP_042513445.1|5071864_5072071_+	hypothetical protein	NA	O64170	Bacillus_phage	70.3	1.7e-21
WP_042513446.1|5072104_5074459_+	DNA primase	NA	A0A1B2AQ05	Phage_Wrath	86.7	0.0e+00
WP_042513447.1|5074724_5075153_+	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	95.1	3.9e-76
WP_042513448.1|5075155_5075539_+	hypothetical protein	NA	A0A0A7RWK2	Clostridium_phage	39.1	6.0e-12
WP_042513449.1|5075535_5076075_+	nuclease	NA	A0A0S2SXQ1	Bacillus_phage	53.7	3.9e-49
WP_042513450.1|5076076_5076361_+	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	51.1	3.0e-16
WP_042513451.1|5076442_5076787_+	hypothetical protein	NA	A0A1B1P7N6	Bacillus_phage	58.5	5.0e-26
WP_042513452.1|5076846_5077383_+	dUTPase	NA	A0A2H4J4W9	uncultured_Caudovirales_phage	73.6	1.1e-72
WP_042513453.1|5077417_5077717_+	hypothetical protein	NA	Q3HKX6	Bacillus_phage	70.7	4.3e-34
WP_042513621.1|5078152_5078275_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_042513454.1|5078312_5078699_+	phage protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	76.8	1.1e-48
WP_042513456.1|5079120_5079441_+	phage protein	NA	A0A1B0T6C6	Bacillus_phage	84.9	1.2e-42
WP_042513457.1|5079437_5079803_+	HNH endonuclease	NA	A0A2H4JA38	uncultured_Caudovirales_phage	66.1	2.4e-42
WP_042513458.1|5079923_5080358_+	hypothetical protein	NA	A0A1B2APW6	Phage_Wrath	89.6	2.0e-64
WP_042513459.1|5080354_5082079_+|terminase	terminase large subunit	terminase	A0A1B2AQ28	Phage_Wrath	97.9	0.0e+00
WP_042513460.1|5082183_5083389_+|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	95.5	2.0e-218
WP_001140505.1|5083357_5083936_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	82.5	4.2e-86
WP_042513461.1|5083937_5085287_+|capsid	phage major capsid protein	capsid	A0A2H4JFZ3	uncultured_Caudovirales_phage	69.9	2.8e-128
WP_042513462.1|5085288_5085549_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J865	uncultured_Caudovirales_phage	95.3	5.4e-41
WP_042513463.1|5085529_5085859_+	hypothetical protein	NA	A0A2H4J9Y9	uncultured_Caudovirales_phage	95.4	3.0e-52
WP_042513464.1|5085848_5086178_+	hypothetical protein	NA	A0A1C8E981	Bacillus_phage	96.3	2.2e-55
WP_042513465.1|5086177_5086555_+	hypothetical protein	NA	A0A1B2APW9	Phage_Wrath	97.6	9.6e-63
WP_042513466.1|5086566_5087196_+|tail	phi13 family phage major tail protein	tail	A0A2H4JEZ7	uncultured_Caudovirales_phage	88.5	4.9e-104
WP_042513467.1|5087206_5087593_+	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	90.6	3.5e-60
WP_078386944.1|5087836_5091118_+|tail	phage tail tape measure protein	tail	A0A1B2APW4	Phage_Wrath	74.1	3.5e-217
WP_052494354.1|5091121_5091835_+	hypothetical protein	NA	A0A1B2APY0	Phage_Wrath	80.6	1.4e-110
WP_042513469.1|5091835_5093371_+	lysin	NA	A0A1B2APX2	Phage_Wrath	62.9	4.3e-178
WP_042513470.1|5093363_5095223_+	hypothetical protein	NA	Q0E5W5	Pseudomonas_phage	62.7	1.7e-11
WP_052494338.1|5095219_5095519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158319614.1|5095531_5095672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513471.1|5096008_5096272_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	59.8	2.4e-20
WP_042513472.1|5096268_5097315_+	SH3 domain-containing protein	NA	A0A2H4JEZ1	uncultured_Caudovirales_phage	89.4	1.2e-179
WP_042513473.1|5097358_5097856_-	hypothetical protein	NA	A0A1B2APY6	Phage_Wrath	87.9	5.8e-76
WP_042513474.1|5097889_5098222_-	hypothetical protein	NA	A0A2H4J846	uncultured_Caudovirales_phage	96.4	1.0e-47
WP_158319615.1|5098281_5098452_-	hypothetical protein	NA	A0A2H4JCU3	uncultured_Caudovirales_phage	78.6	2.2e-19
WP_042513475.1|5098479_5099310_-	cytosolic protein	NA	A0A1B2APY5	Phage_Wrath	95.7	3.2e-111
WP_001982685.1|5099633_5100095_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_042513476.1|5100173_5101061_+	decarboxylase	NA	NA	NA	NA	NA
WP_000391912.1|5101071_5102319_-	MFS transporter	NA	NA	NA	NA	NA
WP_001994481.1|5102494_5102971_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_042513477.1|5103416_5114153_+	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000829779.1|5114271_5115261_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_000856618.1|5115723_5116932_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042513478.1|5117055_5117562_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000027007.1|5117558_5117876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513479.1|5117962_5118589_+	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	42.1	2.3e-13
WP_000487987.1|5118734_5120219_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.6	1.3e-57
WP_001158741.1|5120301_5120907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104191.1|5121050_5122775_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.4	5.2e-180
WP_000832654.1|5122883_5123771_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	53.1	7.7e-79
WP_001252159.1|5123816_5124410_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_000810351.1|5124460_5125204_-	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001140609.1|5125299_5125683_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000287154.1|5125720_5127097_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	28.1	3.4e-49
5132481:5132500	attR	ATATCGACTTACCGACAAAA	NA	NA	NA	NA
>prophage 1
NZ_CP009299	Bacillus cereus D17 plasmid unnamed, complete sequence	210673	0	27096	210673	transposase,integrase	Bacillus_phage(80.0%)	25	NA	NA
WP_001027747.1|752_1034_+	adhesin	NA	NA	NA	NA	NA
WP_033695785.1|1061_1490_+	protein phosphatase	NA	NA	NA	NA	NA
WP_000631828.1|2427_4572_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001285624.1|4564_6205_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000888139.1|6211_8095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512059.1|9047_9971_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_042512154.1|10185_10374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052494310.1|10530_10944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233525.1|11010_11361_+	PrgI family protein	NA	NA	NA	NA	NA
WP_000892015.1|11361_12276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000765113.1|12278_14378_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_042512060.1|14408_18389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512061.1|18385_20596_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A7KUS1	Bacillus_phage	40.7	3.0e-15
WP_042512063.1|20612_21188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512064.1|21352_21736_+	membrane protein	NA	NA	NA	NA	NA
WP_000426064.1|21726_22032_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_042512066.1|22116_22419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512067.1|22575_23256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512068.1|23274_24516_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	25.8	3.8e-23
WP_042512069.1|24675_24858_+	hypothetical protein	NA	A0A0U3B243	Bacillus_phage	83.3	6.5e-25
WP_080334501.1|24946_25354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001091677.1|25386_25581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512070.1|25658_26012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512071.1|26246_26651_+	hypothetical protein	NA	A0A0A7AR60	Bacillus_phage	33.1	1.3e-09
WP_000804598.1|26682_27096_+	hypothetical protein	NA	A0A1B1P7B4	Bacillus_phage	83.2	3.9e-65
>prophage 2
NZ_CP009299	Bacillus cereus D17 plasmid unnamed, complete sequence	210673	32997	37645	210673	transposase	Streptococcus_phage(33.33%)	3	NA	NA
WP_000383879.1|32997_33843_-	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	42.9	4.4e-23
WP_001226074.1|33955_34531_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.3	4.6e-16
WP_000861527.1|34678_37645_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	40.3	3.5e-216
>prophage 3
NZ_CP009299	Bacillus cereus D17 plasmid unnamed, complete sequence	210673	45513	45786	210673		Bacillus_phage(100.0%)	1	NA	NA
WP_042512080.1|45513_45786_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	67.8	1.1e-23
>prophage 4
NZ_CP009299	Bacillus cereus D17 plasmid unnamed, complete sequence	210673	49416	52422	210673		Bacillus_phage(50.0%)	6	NA	NA
WP_000021286.1|49416_49644_+	hypothetical protein	NA	A0A217ERD4	Bacillus_phage	55.4	3.4e-07
WP_001123650.1|49671_49875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000843050.1|49889_50168_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	47.8	2.7e-14
WP_033656436.1|50341_50554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512087.1|50818_51160_-	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	38.9	7.2e-09
WP_042512088.1|51156_52422_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.9	9.9e-104
>prophage 5
NZ_CP009299	Bacillus cereus D17 plasmid unnamed, complete sequence	210673	59164	65353	210673	integrase	Bacillus_phage(66.67%)	5	53708:53725	73868:73885
53708:53725	attL	CAATGAAAGTTTTTAATT	NA	NA	NA	NA
WP_042512097.1|59164_60388_+	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	62.4	3.6e-143
WP_042512098.1|60742_61786_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	24.1	6.9e-10
WP_000149387.1|62016_62367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001108537.1|62388_62901_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000107145.1|64120_65353_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	58.0	4.8e-63
73868:73885	attR	AATTAAAAACTTTCATTG	NA	NA	NA	NA
>prophage 6
NZ_CP009299	Bacillus cereus D17 plasmid unnamed, complete sequence	210673	76634	77729	210673		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_042512099.1|76634_77729_-	tyrosine recombinase XerS	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.1	3.3e-07
>prophage 7
NZ_CP009299	Bacillus cereus D17 plasmid unnamed, complete sequence	210673	84239	86348	210673		Pelagibacter_phage(100.0%)	1	NA	NA
WP_042512105.1|84239_86348_-	hypothetical protein	NA	M1ICZ5	Pelagibacter_phage	29.0	8.3e-47
>prophage 8
NZ_CP009299	Bacillus cereus D17 plasmid unnamed, complete sequence	210673	93597	106246	210673	transposase	uncultured_Caudovirales_phage(20.0%)	12	NA	NA
WP_042512112.1|93597_94692_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	48.2	5.6e-95
WP_000751014.1|94688_94820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042512113.1|95011_95197_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000207868.1|95504_95798_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042512114.1|95870_96308_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000084559.1|96351_96639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512115.1|96712_96916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042512116.1|96967_97612_-	thermonuclease family protein	NA	A0A2P1JU10	Anoxybacillus_phage	33.3	8.3e-06
WP_042512118.1|98040_100704_-	type IA DNA topoisomerase	NA	A0A1V0SIB2	Klosneuvirus	21.4	9.9e-13
WP_002073819.1|101934_103296_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A142F1Q5	Bacillus_phage	38.1	1.4e-79
WP_042512119.1|103421_105251_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_000866031.1|105607_106246_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	34.6	1.1e-21
>prophage 9
NZ_CP009299	Bacillus cereus D17 plasmid unnamed, complete sequence	210673	122130	123078	210673	integrase	Bacillus_phage(100.0%)	1	119155:119169	129565:129579
119155:119169	attL	TTGGCATATATTTCT	NA	NA	NA	NA
WP_042512125.1|122130_123078_+|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	32.0	5.4e-38
WP_042512125.1|122130_123078_+|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	32.0	5.4e-38
129565:129579	attR	TTGGCATATATTTCT	NA	NA	NA	NA
>prophage 10
NZ_CP009299	Bacillus cereus D17 plasmid unnamed, complete sequence	210673	127820	129761	210673		Pseudomonas_phage(100.0%)	1	NA	NA
WP_048520063.1|127820_129761_-	maturase	NA	A0A0U4J920	Pseudomonas_phage	28.7	5.2e-27
>prophage 11
NZ_CP009299	Bacillus cereus D17 plasmid unnamed, complete sequence	210673	137243	142388	210673		Pseudomonas_phage(33.33%)	7	NA	NA
WP_002019929.1|137243_139142_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.7	9.5e-26
WP_042512126.1|139903_140260_-	hypothetical protein	NA	Q0ILF6	Lactococcus_phage	43.9	3.8e-21
WP_001055070.1|140282_140678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002081521.1|141077_141260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633806.1|141327_141612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001100171.1|141872_142097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000675279.1|142115_142388_-	hypothetical protein	NA	D2XR50	Bacillus_phage	39.1	9.8e-09
>prophage 12
NZ_CP009299	Bacillus cereus D17 plasmid unnamed, complete sequence	210673	147541	149188	210673		Pseudomonas_phage(100.0%)	1	NA	NA
WP_042512127.1|147541_149188_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.9	5.5e-78
>prophage 13
NZ_CP009299	Bacillus cereus D17 plasmid unnamed, complete sequence	210673	158398	159511	210673		Streptococcus_phage(100.0%)	1	NA	NA
WP_042512128.1|158398_159511_-	helix-turn-helix domain-containing protein	NA	A0A286QQB7	Streptococcus_phage	45.0	2.0e-79
>prophage 14
NZ_CP009299	Bacillus cereus D17 plasmid unnamed, complete sequence	210673	184299	187975	210673		Stx2-converting_phage(50.0%)	3	NA	NA
WP_042512146.1|184299_186075_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	39.5	1.4e-23
WP_042512147.1|186064_187378_+	DUF3854 domain-containing protein	NA	NA	NA	NA	NA
WP_042512149.1|187654_187975_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	37.0	4.1e-06
>prophage 15
NZ_CP009299	Bacillus cereus D17 plasmid unnamed, complete sequence	210673	193886	201409	210673		uncultured_Caudovirales_phage(50.0%)	9	NA	NA
WP_000229539.1|193886_195350_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.6	1.3e-142
WP_000904931.1|195530_196073_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	28.8	1.8e-09
WP_000536398.1|196345_196699_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000021465.1|196700_197141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214613.1|197272_199036_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	1.6e-38
WP_000426344.1|199122_199647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000077294.1|199688_199928_+	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_000067663.1|200063_200405_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_000616114.1|200992_201409_+	FosB family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	85.3	5.8e-53
>prophage 16
NZ_CP009299	Bacillus cereus D17 plasmid unnamed, complete sequence	210673	206371	208234	210673		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000416301.1|206371_206719_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	40.9	1.7e-10
WP_000072354.1|206747_207803_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_000428325.1|207829_208234_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	64.3	5.3e-43
