The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009364	Yersinia frederiksenii Y225 chromosome, complete genome	4495532	26602	34522	4495532		Escherichia_phage(66.67%)	7	NA	NA
WP_038635857.1|26602_29047_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	1.3e-216
WP_032819231.1|29055_29673_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.0	2.3e-74
WP_038635854.1|29674_30526_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	32.2	2.4e-21
WP_038635851.1|30522_31128_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.3	1.5e-25
WP_032819236.1|31293_32619_-	MFS transporter	NA	NA	NA	NA	NA
WP_038635847.1|32855_33350_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.7	1.1e-29
WP_038635844.1|33457_34522_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.3	2.4e-111
>prophage 2
NZ_CP009364	Yersinia frederiksenii Y225 chromosome, complete genome	4495532	227548	277871	4495532	terminase,holin,tRNA,tail,lysis,integrase	Escherichia_phage(18.42%)	58	214240:214254	255957:255971
214240:214254	attL	TGCCGCTGGTGGATG	NA	NA	NA	NA
WP_038635437.1|227548_228823_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_038635435.1|228836_229457_+	YfgM family protein	NA	NA	NA	NA	NA
WP_038635430.1|229468_230650_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_004391234.1|230848_232333_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_038635426.1|232441_233398_+	AEC family transporter	NA	NA	NA	NA	NA
WP_038635423.1|233427_233652_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_038635420.1|233822_235199_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	39.5	2.8e-43
WP_038639720.1|235368_236832_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	37.7	1.1e-85
WP_038635417.1|237004_238582_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_038635414.1|238814_240017_+|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	64.0	8.2e-140
WP_038635411.1|240020_240419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038635408.1|240411_240618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038635406.1|240698_241334_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	75.0	2.9e-88
WP_038635402.1|241326_241530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144242883.1|241526_241856_-	hypothetical protein	NA	A0A2P0PA76	Pectobacterium_phage	39.4	4.1e-09
WP_051957696.1|241863_242109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038635398.1|242148_242424_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	59.6	9.6e-12
WP_038635395.1|242484_243645_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	59.2	1.1e-125
WP_167335063.1|243657_245370_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7PJT5	Enterobacteria_phage	61.7	4.2e-105
WP_167335054.1|245406_245550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038635389.1|246033_246642_-	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	49.3	5.9e-46
WP_038635386.1|246786_247014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038635383.1|247163_247367_+	hypothetical protein	NA	A0A1I9SES5	Klebsiella_phage	51.9	3.6e-08
WP_038635381.1|247363_247621_+	hypothetical protein	NA	A0A1I9KFG5	Aeromonas_phage	63.2	6.6e-07
WP_051957695.1|247620_248868_+	HNH endonuclease	NA	A0A1J0MCP9	Streptomyces_phage	36.5	4.8e-10
WP_051957694.1|248848_249325_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	35.9	1.9e-23
WP_038635378.1|249505_249718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038635375.1|249714_250191_+	hypothetical protein	NA	A0A193GYM2	Enterobacter_phage	75.3	9.6e-60
WP_038635372.1|250183_250393_+	TraR/DksA family transcriptional regulator	NA	A5X9I2	Aeromonas_virus	46.8	2.4e-07
WP_038635369.1|250454_251093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051957692.1|251092_251737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038635366.1|251885_252392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038635363.1|252470_253028_+|terminase	terminase small subunit	terminase	Q858H4	Salmonella_phage	53.8	3.5e-45
WP_038635361.1|253024_254497_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.3	8.2e-227
WP_051957690.1|254555_255305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038635358.1|255784_255991_+	hypothetical protein	NA	NA	NA	NA	NA
255957:255971	attR	CATCCACCAGCGGCA	NA	NA	NA	NA
WP_038635355.1|256002_257664_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	71.5	2.1e-231
WP_038635352.1|257660_257969_+	hypothetical protein	NA	Q2A090	Sodalis_phage	58.8	4.1e-19
WP_038635349.1|257965_258688_+	peptidase	NA	A0A193GYS7	Enterobacter_phage	71.8	1.7e-52
WP_038635345.1|258698_259682_+	phage protein	NA	G9L6C5	Escherichia_phage	83.5	4.4e-160
WP_038635342.1|259737_260172_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	80.4	3.8e-55
WP_038635339.1|260183_260567_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	45.5	4.7e-17
WP_038635336.1|260616_260937_+	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	51.9	4.1e-22
WP_038635333.1|260936_261542_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	68.7	9.0e-79
WP_038635330.1|261541_264001_+	hypothetical protein	NA	T1S9I3	Salmonella_phage	69.5	0.0e+00
WP_042562346.1|264002_264473_+	hypothetical protein	NA	T1SA73	Salmonella_phage	57.6	2.0e-46
WP_038635323.1|264465_265008_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	59.3	4.2e-43
WP_038635320.1|265020_267531_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	46.3	6.2e-198
WP_038635317.1|267527_269318_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	38.9	3.7e-104
WP_038635315.1|269319_271818_+	phage protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	58.9	2.2e-288
WP_038635309.1|272054_272360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038635306.1|272402_272672_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	40.7	1.2e-11
WP_042562347.1|272844_275031_+	hypothetical protein	NA	T1S9Y2	Salmonella_phage	45.6	1.8e-44
WP_042562348.1|275137_276262_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	30.6	6.9e-32
WP_052488188.1|276366_276747_+	hypothetical protein	NA	A0A0F6R7N0	Escherichia_coli_O157_typing_phage	39.4	9.8e-15
WP_038635295.1|276733_277009_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	47.4	2.8e-19
WP_042562349.1|277011_277353_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	77.2	2.1e-40
WP_051957687.1|277352_277871_+|lysis	lysis protein	lysis	A0A1I9KF71	Aeromonas_phage	29.5	2.5e-05
>prophage 3
NZ_CP009364	Yersinia frederiksenii Y225 chromosome, complete genome	4495532	892182	904001	4495532		Herpes_simplex_virus(16.67%)	7	NA	NA
WP_038633832.1|892182_895335_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	61.9	0.0e+00
WP_038633830.1|895493_896528_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	50.9	9.9e-86
WP_002210893.1|896912_897125_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_071841804.1|897311_897575_+	protein DsrB	NA	NA	NA	NA	NA
WP_038633826.1|897708_899448_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.7	1.8e-10
WP_004392115.1|900383_901082_+	MgtC family protein	NA	G3MA03	Bacillus_virus	41.0	1.4e-14
WP_038633822.1|901298_904001_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	26.6	5.0e-44
>prophage 4
NZ_CP009364	Yersinia frederiksenii Y225 chromosome, complete genome	4495532	1514568	1570297	4495532	tRNA,protease,coat,transposase,integrase	Tupanvirus(15.38%)	51	1511909:1511924	1541354:1541369
1511909:1511924	attL	CCCCAATAAAACAGCC	NA	NA	NA	NA
WP_038632577.1|1514568_1516956_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	26.8	1.1e-07
WP_004393358.1|1516970_1517954_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
WP_152414234.1|1518301_1518349_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004706556.1|1518417_1518774_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004713020.1|1518811_1519009_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_011816226.1|1519105_1519657_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_038632573.1|1519660_1521589_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	1.4e-128
WP_158501190.1|1522115_1522313_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JX31	Burkholderia_virus	48.4	1.3e-07
WP_167335056.1|1526884_1527043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038632569.1|1527075_1527288_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	43.5	2.6e-09
WP_038632567.1|1527407_1528121_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_038632565.1|1528640_1528823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038632563.1|1528878_1529121_-	Pathogenicity locus	NA	NA	NA	NA	NA
WP_038632561.1|1529165_1529504_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_038632559.1|1529601_1529853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038632557.1|1530286_1530970_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_038632555.1|1531050_1531713_-	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	43.1	5.5e-05
WP_038639472.1|1531924_1532893_+	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_038632553.1|1532889_1533780_+	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	28.4	7.7e-10
WP_038632551.1|1533779_1534664_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_038632549.1|1534660_1535554_+	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_038632547.1|1535876_1536746_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_038632545.1|1536878_1537433_-	YniB family protein	NA	NA	NA	NA	NA
WP_038632543.1|1537682_1538348_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_038632541.1|1538417_1538750_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_038632538.1|1538982_1539819_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_004393262.1|1539929_1540691_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.5e-19
WP_038632536.1|1541019_1542687_+	pectate lyase	NA	NA	NA	NA	NA
1541354:1541369	attR	GGCTGTTTTATTGGGG	NA	NA	NA	NA
WP_038632534.1|1542727_1543618_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_032821132.1|1543610_1544531_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_038632531.1|1544544_1545672_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	3.0e-11
WP_038632530.1|1545687_1546980_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038632528.1|1547285_1547984_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_038632526.1|1548391_1548940_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	33.3	1.7e-07
WP_038632525.1|1549159_1550551_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_038632522.1|1550762_1551614_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_042562377.1|1551889_1552681_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_038632518.1|1552866_1554033_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_038632514.1|1554367_1555735_+	MFS transporter	NA	NA	NA	NA	NA
WP_042562378.1|1555852_1557046_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	64.5	9.2e-144
WP_025378445.1|1557096_1557978_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_038632508.1|1558306_1560379_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	35.3	7.3e-88
WP_038632507.1|1560398_1561127_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_038632505.1|1561222_1561720_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_038632503.1|1561939_1563187_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_038632501.1|1563155_1565786_+	PqiB family protein	NA	NA	NA	NA	NA
WP_038632499.1|1565820_1566717_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038632497.1|1566845_1568300_+	MFS transporter	NA	NA	NA	NA	NA
WP_038632495.1|1568627_1569164_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_038632493.1|1569169_1569727_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_038632491.1|1569739_1570297_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 5
NZ_CP009364	Yersinia frederiksenii Y225 chromosome, complete genome	4495532	2124600	2183990	4495532	terminase,holin,protease,integrase,head,tRNA	Cronobacter_phage(23.21%)	84	2124345:2124390	2174044:2174089
2124345:2124390	attL	ATGGTACGCCCTACAGGGCTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_052488197.1|2124600_2126775_-	SGNH/GDSL hydrolase family protein	NA	C6ZR19	Salmonella_phage	40.0	5.0e-103
WP_042562625.1|2126874_2127261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562394.1|2127317_2127602_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	54.3	1.4e-05
WP_042562395.1|2127693_2127900_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_144404297.1|2128177_2128804_+	hypothetical protein	NA	Q0H8C7	Salmonella_phage	36.9	9.4e-31
WP_042562397.1|2128890_2129355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562398.1|2129457_2130162_-	Rha family transcriptional regulator	NA	A0A0P0ZDC0	Stx2-converting_phage	36.4	2.9e-36
WP_042562626.1|2130237_2131140_-	phage antirepressor N-terminal domain-containing protein	NA	A5VW58	Enterobacteria_phage	76.9	1.8e-91
WP_167335058.1|2131213_2131372_-	hypothetical protein	NA	A0A077KAX5	Edwardsiella_phage	67.3	2.3e-10
WP_042562399.1|2131473_2131797_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	52.3	5.8e-16
WP_042562400.1|2132016_2134494_-	hypothetical protein	NA	F1C5A7	Cronobacter_phage	55.4	4.0e-266
WP_042562401.1|2134453_2134873_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	59.8	2.6e-45
WP_042562402.1|2134879_2135350_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	54.9	8.9e-42
WP_042562403.1|2135349_2135817_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	61.5	1.7e-56
WP_042562404.1|2135813_2138954_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	44.4	1.6e-179
WP_042562405.1|2139000_2139741_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	46.2	1.6e-53
WP_042562406.1|2139793_2140537_-	Ig-like domain-containing protein	NA	G0ZNE6	Cronobacter_phage	55.0	8.2e-58
WP_042562407.1|2140594_2140969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562408.1|2140965_2141181_-	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	52.4	2.2e-11
WP_042562409.1|2141177_2141549_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	67.2	8.6e-40
WP_042562410.1|2141550_2141892_-	hypothetical protein	NA	A0A1B1W262	Salmonella_phage	47.6	7.7e-19
WP_042562627.1|2141888_2142200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562411.1|2142202_2142574_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	75.8	1.2e-46
WP_042562412.1|2142576_2142942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562413.1|2142951_2144028_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	75.1	8.6e-157
WP_042562414.1|2144038_2144479_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	64.4	1.3e-42
WP_042562415.1|2144482_2145880_-	phage protein	NA	F1C5D9	Cronobacter_phage	63.0	8.3e-152
WP_144404293.1|2145922_2146837_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.1	5.3e-115
WP_042562416.1|2146868_2148332_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	64.5	1.3e-168
WP_042562417.1|2148342_2149641_-|terminase	terminase	terminase	A0A1V0E5Q3	Salmonella_phage	89.2	3.5e-229
WP_042562418.1|2149624_2150056_-|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	82.5	3.1e-57
WP_071841788.1|2150181_2150454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562419.1|2150541_2151243_-	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	77.3	6.3e-100
WP_042562420.1|2151885_2152278_-	hypothetical protein	NA	U5P0U9	Shigella_phage	41.3	2.5e-13
WP_042562421.1|2152262_2152745_-	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	65.4	7.7e-57
WP_038639772.1|2152722_2152923_-|holin	phage holin family protein	holin	A0A1V0E5H9	Salmonella_phage	65.1	7.2e-17
WP_042562422.1|2153040_2153364_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	62.2	6.6e-28
WP_042562423.1|2153769_2154375_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	40.8	7.4e-41
WP_042562424.1|2154371_2154734_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	65.0	2.5e-36
WP_042562425.1|2154730_2155021_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	76.8	5.7e-39
WP_042562426.1|2155122_2155470_-	DUF2591 family protein	NA	R9U6T9	Vibrio_phage	52.8	4.0e-23
WP_042562427.1|2155557_2156007_-	DUF1367 family protein	NA	A0A096XEN2	Escherichia_phage	63.1	2.2e-53
WP_042562428.1|2156010_2156457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562429.1|2156453_2156927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562430.1|2156923_2157226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562431.1|2157222_2157498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562432.1|2157513_2158851_-	AAA family ATPase	NA	A0A2I7S0U1	Vibrio_phage	39.0	3.5e-83
WP_042562433.1|2158852_2159719_-	replication protein	NA	Q76H52	Enterobacteria_phage	51.9	1.1e-45
WP_158502691.1|2159711_2159876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562434.1|2159872_2160289_-	hypothetical protein	NA	G8C7U4	Escherichia_phage	55.5	2.8e-39
WP_042562435.1|2160300_2160597_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	62.1	6.9e-24
WP_042562436.1|2160712_2160907_-	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	85.5	4.2e-22
WP_042562437.1|2161011_2161734_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	55.2	4.0e-65
WP_042562438.1|2161868_2162900_+	P63C domain-containing protein	NA	A0A0N7KZA9	Stx2-converting_phage	57.6	7.8e-99
WP_042562439.1|2162959_2163169_-	DUF2767 family protein	NA	NA	NA	NA	NA
WP_042562440.1|2163812_2164010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562442.1|2164626_2165208_-	superinfection exclusion B family protein	NA	Q76H59	Enterobacteria_phage	50.3	1.1e-46
WP_042562443.1|2165370_2165631_+	hypothetical protein	NA	Q8LTB2	Lactobacillus_phage	54.3	2.5e-14
WP_144404292.1|2165652_2166228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052488205.1|2166301_2166523_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	46.3	6.9e-05
WP_071841786.1|2166526_2166709_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_042562445.1|2166969_2167263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562446.1|2167262_2168162_+	recombinase RecT	NA	A0A2I7RGR8	Vibrio_phage	75.8	2.8e-92
WP_042562447.1|2168154_2168862_+	YqaJ viral recombinase family protein	NA	Q9T1N7	Enterobacteria_phage	51.5	9.2e-67
WP_042562448.1|2168858_2169041_+	DUF1317 family protein	NA	A0A193GYJ8	Enterobacter_phage	56.9	7.0e-11
WP_052488208.1|2169085_2169730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038636089.1|2169729_2170116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562449.1|2170105_2170651_+	HNH endonuclease	NA	R9TPQ7	Aeromonas_phage	50.3	5.3e-38
WP_042562450.1|2170640_2170862_+	hypothetical protein	NA	C0LP33	Escherichia_virus	52.5	8.8e-08
WP_042562451.1|2170845_2171121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167335059.1|2171351_2171528_+	hypothetical protein	NA	A0A2H4A350	Salmonella_phage	50.0	6.5e-06
WP_042562452.1|2171527_2171731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562453.1|2171727_2172270_+	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	68.9	7.6e-61
WP_042562455.1|2172856_2174011_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	71.4	4.7e-161
WP_038631653.1|2174334_2175216_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.6	8.3e-33
2174044:2174089	attR	ATGGTACGCCCTACAGGGCTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_038631651.1|2175215_2175428_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_038631649.1|2175634_2177023_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	1.9e-39
WP_038631646.1|2177235_2177730_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_038631644.1|2177740_2178463_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_038631642.1|2178641_2179166_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_038631640.1|2179162_2180227_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_038631637.1|2180265_2182698_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004390643.1|2182694_2183381_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	2.5e-32
WP_038631634.1|2183351_2183990_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 6
NZ_CP009364	Yersinia frederiksenii Y225 chromosome, complete genome	4495532	2588075	2630969	4495532	tRNA,protease,transposase,plate,integrase	Shigella_phage(40.0%)	42	2613008:2613058	2618676:2618726
WP_042562469.1|2588075_2589269_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	64.7	2.9e-145
WP_038631018.1|2589382_2589802_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_038631016.1|2589818_2590250_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_038631014.1|2590246_2590576_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038631012.1|2590702_2591221_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_038631010.1|2591310_2592018_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_038631009.1|2592063_2592795_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_038631007.1|2592820_2593774_+	glutathione synthase	NA	NA	NA	NA	NA
WP_004391007.1|2593976_2594540_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_005157116.1|2594539_2594962_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_038631004.1|2595142_2596027_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.4	6.3e-81
WP_038631002.1|2596030_2597155_+	agmatine deiminase	NA	A7RCL2	Paramecium_bursaria_Chlorella_virus	50.3	4.2e-98
WP_038631000.1|2597316_2598456_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_038630998.1|2598475_2599171_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_038630996.1|2599413_2600235_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_038630994.1|2600363_2600918_+	YggT family protein	NA	NA	NA	NA	NA
WP_038630992.1|2600914_2601205_+	YggU family protein	NA	NA	NA	NA	NA
WP_038630988.1|2601256_2601850_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_038630986.1|2601842_2602973_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_038630984.1|2603309_2604050_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_038639332.1|2604152_2605079_-	glutaminase B	NA	NA	NA	NA	NA
WP_038630982.1|2605207_2605534_-	YggL family protein	NA	NA	NA	NA	NA
WP_032820017.1|2605533_2606253_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_038630980.1|2606619_2607696_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_004391023.1|2607759_2608032_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_038630978.1|2608111_2609188_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_038630976.1|2609345_2610095_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_038630974.1|2610156_2612319_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
2613008:2613058	attL	GGGATTGAAAATCCCCGTGTCCTTGGTTCGATTCCGAGTCCGGGCACCACT	NA	NA	NA	NA
WP_038630973.1|2613278_2614241_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_098087190.1|2614542_2615716_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	72.5	5.9e-135
WP_080868736.1|2615720_2616410_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_038630890.1|2616399_2617743_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	53.3	1.9e-121
WP_038630888.1|2617739_2618615_-	ParA family protein	NA	NA	NA	NA	NA
WP_038630882.1|2619179_2619740_-	hypothetical protein	NA	NA	NA	NA	NA
2618676:2618726	attR	GGGATTGAAAATCCCCGTGTCCTTGGTTCGATTCCGAGTCCGGGCACCACT	NA	NA	NA	NA
WP_038630880.1|2621908_2622856_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_038630876.1|2625110_2625794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038630874.1|2626150_2626801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038630872.1|2626898_2628299_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_051957654.1|2628418_2628835_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
WP_038630870.1|2628903_2629344_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_038630865.1|2629345_2629888_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_038630863.1|2629862_2630969_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 7
NZ_CP009364	Yersinia frederiksenii Y225 chromosome, complete genome	4495532	3396727	3476935	4495532	holin,capsid,tRNA,portal,tail,lysis,plate,head,integrase	Salmonella_phage(27.45%)	90	3419418:3419436	3450920:3450938
WP_038637947.1|3396727_3397246_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_004392219.1|3397413_3398235_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_038637943.1|3398367_3399387_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032820633.1|3399386_3399863_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_038637938.1|3399953_3400202_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	48.7	9.2e-14
WP_038637936.1|3400251_3400686_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_038637933.1|3400927_3402475_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_038637930.1|3402484_3403855_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.8	3.1e-10
WP_038637927.1|3403878_3404904_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_038639959.1|3405109_3406135_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	4.7e-19
WP_038637920.1|3406174_3407386_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.9	8.5e-36
WP_038637918.1|3407629_3408562_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	36.9	4.4e-32
WP_038637914.1|3408592_3409657_+	ADP-heptose--LPS heptosyltransferase RfaF	NA	NA	NA	NA	NA
WP_038637911.1|3409656_3410622_+	lipopolysaccharide heptosyltransferase RfaC	NA	NA	NA	NA	NA
WP_038637908.1|3411179_3412457_+	lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_038637905.1|3412457_3413240_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_038637901.1|3413236_3413716_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.2	3.7e-27
WP_038637899.1|3413799_3414609_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	30.0	6.1e-22
WP_004392084.1|3414694_3414862_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_005164747.1|3414873_3415110_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_038637895.1|3415373_3416042_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_038637892.1|3416236_3417469_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.4	3.3e-43
WP_038637890.1|3417446_3417905_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	58.1	3.1e-47
WP_004392079.1|3418026_3418623_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_038637885.1|3418697_3419339_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
3419418:3419436	attL	AAAAAAGGCGACTAGCAAG	NA	NA	NA	NA
WP_042562490.1|3419539_3420535_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	70.7	3.1e-137
WP_042562491.1|3420601_3420901_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	61.6	7.9e-28
WP_042562492.1|3421010_3421385_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	60.3	1.7e-32
WP_042562493.1|3421381_3421591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562494.1|3421587_3421902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167335061.1|3421886_3422045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562495.1|3422079_3422361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158502693.1|3422396_3422564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562648.1|3422567_3422873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052488214.1|3422955_3423393_+	DUF3850 domain-containing protein	NA	A0A1P8DUQ0	Escherichia_phage	50.7	5.2e-12
WP_144404290.1|3423386_3424034_+	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	63.4	1.0e-59
WP_042562496.1|3424030_3424852_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	55.0	4.5e-73
WP_052488216.1|3425485_3428110_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	35.6	2.3e-123
WP_042562499.1|3428090_3428321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562500.1|3428344_3428665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562501.1|3428678_3429023_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	38.9	1.1e-17
WP_042562503.1|3429704_3430736_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	65.5	6.3e-133
WP_042562504.1|3430732_3431458_-	hypothetical protein	NA	A0A077K8Q7	Ralstonia_phage	35.8	6.4e-31
WP_042562505.1|3431457_3433221_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	63.2	2.6e-227
WP_080868732.1|3433296_3434202_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	53.1	2.6e-53
WP_042562507.1|3434238_3435294_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	63.8	4.7e-123
WP_042562508.1|3435299_3435956_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.1	8.6e-43
WP_042562509.1|3436054_3436546_+|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	49.0	8.7e-32
WP_042562510.1|3436545_3436749_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	64.2	5.7e-22
WP_071841755.1|3436779_3437166_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_042562511.1|3437152_3437548_+	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.0	3.5e-47
WP_042562512.1|3437552_3437978_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	45.9	1.0e-20
WP_042562513.1|3438076_3438544_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	55.3	2.8e-40
WP_042562514.1|3438540_3438987_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	48.0	2.1e-32
WP_042562515.1|3439173_3439809_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	62.4	1.4e-66
WP_042562516.1|3439805_3440162_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	58.3	1.3e-32
WP_042562517.1|3440161_3441070_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.2	3.0e-118
WP_042562518.1|3441062_3441671_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	74.6	5.3e-87
WP_080868727.1|3441667_3442678_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	72.3	1.2e-88
WP_071841754.1|3442677_3443157_+	hypothetical protein	NA	F1BUP0	Erwinia_phage	48.4	3.9e-37
WP_042562519.1|3443282_3444458_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	80.1	1.3e-179
WP_042562520.1|3444471_3444987_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	68.0	3.2e-61
WP_004705492.1|3445138_3445417_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	53.6	1.2e-17
WP_042562521.1|3445431_3445551_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	56.4	1.4e-07
WP_042562522.1|3445543_3448471_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	47.1	7.8e-160
WP_042562523.1|3448482_3448947_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	64.6	3.8e-45
WP_144404296.1|3448949_3450050_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	67.5	1.3e-128
WP_042562525.1|3450124_3450340_+	ogr/Delta-like zinc finger family protein	NA	S4TNZ3	Salmonella_phage	60.6	1.8e-18
WP_042562656.1|3450541_3450802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038637882.1|3450951_3451668_-	ribonuclease PH	NA	NA	NA	NA	NA
3450920:3450938	attR	AAAAAAGGCGACTAGCAAG	NA	NA	NA	NA
WP_038637879.1|3451795_3452659_+	YicC family protein	NA	NA	NA	NA	NA
WP_038637876.1|3453878_3454712_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_038637873.1|3454831_3455068_+	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	45.1	9.7e-05
WP_038637870.1|3455509_3457504_+	cyclic di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	34.1	4.1e-19
WP_038637867.1|3457513_3458380_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_038637865.1|3460110_3460731_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_038637861.1|3460746_3462441_-	NAD-dependent DNA ligase LigB	NA	A0A1Y0SVC9	Pseudomonas_phage	23.3	1.4e-23
WP_038637858.1|3462727_3463351_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	37.5	3.7e-19
WP_004392061.1|3463405_3463681_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_038637855.1|3463699_3465802_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	3.6e-10
WP_038637852.1|3465807_3466500_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_038637849.1|3466500_3468582_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_038637848.1|3468632_3469847_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_038637845.1|3470085_3471471_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	80.0	1.4e-55
WP_038637842.1|3471617_3473327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038637839.1|3473432_3474122_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038637836.1|3474151_3474838_-	PAS domain-containing protein	NA	A2I306	Vibrio_virus	30.9	1.7e-20
WP_038637833.1|3474850_3475096_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	61.2	2.0e-16
WP_038637829.1|3475501_3476425_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_038637827.1|3476497_3476935_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
