The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009792	Yersinia pseudotuberculosis YPIII chromosome, complete genome	4689436	853506	904613	4689436	transposase,protease,plate,integrase,tail	Pseudomonas_phage(33.33%)	56	882479:882493	905438:905452
WP_002216348.1|853506_854343_-|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_002218928.1|854360_854690_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_002208926.1|855064_857776_-	HTH-type transcriptional regulator MalT	NA	NA	NA	NA	NA
WP_012105894.1|858093_860499_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.1	4.0e-13
WP_012303379.1|860511_862608_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_002208924.1|862792_863368_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_002208923.1|863427_864129_-	DNA utilization protein GntX	NA	NA	NA	NA	NA
WP_002208922.1|864215_864992_+	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_002208921.1|865161_865431_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002208920.1|865568_865826_-	ferrous iron transporter C	NA	NA	NA	NA	NA
WP_012303380.1|865861_868177_-	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_002208918.1|868268_868496_-	ferrous iron transporter A	NA	NA	NA	NA	NA
WP_012303381.1|869019_871395_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_002208915.1|871928_872444_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_002208914.1|872579_873299_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	2.7e-29
WP_002208913.1|873295_874648_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.1	1.6e-11
WP_011193240.1|874986_876606_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.0	1.6e-138
WP_012303382.1|876802_877684_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_002208910.1|877846_878254_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_002208909.1|878282_878963_-	GMP/IMP nucleotidase	NA	NA	NA	NA	NA
WP_011193239.1|879106_881254_-	intracellular growth attenuator family protein	NA	NA	NA	NA	NA
WP_002208907.1|881840_882386_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
882479:882493	attL	TCTATTCTGCACAAT	NA	NA	NA	NA
WP_012303383.1|882506_883262_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	65.1	9.1e-97
WP_012303384.1|883393_883831_-|tail	tail assembly chaperone	tail	B6SCW7	Bacteriophage	35.4	4.0e-12
WP_112473240.1|885069_885621_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	34.8	4.0e-25
WP_012303387.1|885635_886697_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	46.0	1.6e-75
WP_032466774.1|886696_887047_-	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	62.6	1.7e-29
WP_012303389.1|887101_887752_-|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	48.2	2.5e-50
WP_012303390.1|887741_888965_-|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	36.0	2.8e-71
WP_112473238.1|888948_890250_-	multidrug DMT transporter permease	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	30.9	1.4e-41
WP_012303392.1|890269_892477_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	41.8	3.5e-96
WP_012303395.1|892914_893112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303396.1|893104_893605_-	DUF1804 family protein	NA	A0A0A1IX73	Pseudomonas_phage	59.0	1.3e-51
WP_012303397.1|893607_893895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303398.1|893891_894134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112473237.1|894130_894670_-	hypothetical protein	NA	A0A2D1GNR2	Pseudomonas_phage	44.3	1.5e-24
WP_012303400.1|894695_894950_-	hypothetical protein	NA	A0A2D1GNW8	Pseudomonas_phage	47.6	1.8e-12
WP_041176032.1|894940_895573_-	glycoside hydrolase family 19 protein	NA	F1C5D2	Cronobacter_phage	61.1	4.1e-66
WP_012303402.1|895670_895940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032466757.1|895951_896386_-	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	50.7	3.8e-31
WP_012303404.1|896385_896787_-	regulatory protein GemA	NA	A0A0A7DJY7	Pseudomonas_phage	42.7	2.3e-22
WP_112473235.1|896771_897236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303406.1|897237_897630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123767121.1|897622_897835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303408.1|897831_898374_-	hypothetical protein	NA	J9Q748	Salmonella_phage	52.9	5.6e-48
WP_012303409.1|898363_898606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303410.1|898602_898824_-	hypothetical protein	NA	A0A2D1GNI2	Pseudomonas_phage	54.5	9.1e-13
WP_012303411.1|898820_899321_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012303412.1|899320_900019_-	DUF2786 domain-containing protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	33.5	1.7e-17
WP_012303413.1|900101_900293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303414.1|900294_900933_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	56.5	1.6e-62
WP_012303415.1|900922_901123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303416.1|901129_901363_-	hypothetical protein	NA	A0A2D1GNI5	Pseudomonas_phage	55.3	1.5e-18
WP_012303417.1|901381_902272_-	ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	52.1	5.9e-79
WP_112473233.1|902314_904357_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	51.7	3.6e-188
WP_032898438.1|904370_904613_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	59.4	1.1e-16
905438:905452	attR	ATTGTGCAGAATAGA	NA	NA	NA	NA
>prophage 2
NZ_CP009792	Yersinia pseudotuberculosis YPIII chromosome, complete genome	4689436	1612387	1712377	4689436	transposase,capsid,protease,tRNA,portal,integrase,tail,head,holin,terminase	Cronobacter_phage(57.63%)	98	1686108:1686125	1696988:1697005
WP_012104670.1|1612387_1612900_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209971.1|1613091_1614246_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002209969.1|1615452_1617432_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_012303654.1|1617631_1618090_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
WP_002213775.1|1618343_1618802_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
WP_012303655.1|1619115_1619868_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011192968.1|1620341_1622336_+	transketolase	NA	NA	NA	NA	NA
WP_002209964.1|1622750_1623767_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002209963.1|1623869_1625033_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_002209962.1|1625152_1626232_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002209961.1|1626669_1627539_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_012303656.1|1627784_1628402_+	arginine exporter ArgO	NA	NA	NA	NA	NA
WP_011192966.1|1628591_1629371_+	oxidative stress defense protein	NA	NA	NA	NA	NA
WP_002209958.1|1629381_1630290_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_002209957.1|1630631_1631288_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_002209956.1|1631594_1632836_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	46.5	2.1e-98
WP_011192965.1|1633100_1633697_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002209954.1|1634060_1634390_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_002209953.1|1634726_1635305_+	YecA family protein	NA	NA	NA	NA	NA
WP_011192964.1|1635392_1636706_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_002209951.1|1636842_1638021_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_002209950.1|1638193_1639414_+	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
WP_012303660.1|1640134_1641232_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_002209948.1|1641300_1641687_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_002209947.1|1641898_1644778_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.3	1.7e-268
WP_002209946.1|1645155_1645593_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_012303661.1|1646652_1648803_+	autotransporter adhesin YapN	NA	NA	NA	NA	NA
WP_012104675.1|1648906_1650010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303662.1|1650211_1650913_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002209941.1|1651204_1651702_+	DUF2165 family protein	NA	NA	NA	NA	NA
WP_002209940.1|1651774_1652767_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_002209939.1|1653083_1653350_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_002215144.1|1653330_1653756_+	membrane protein	NA	NA	NA	NA	NA
WP_002209937.1|1653755_1654454_+	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_012104678.1|1654478_1655912_+	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_012303664.1|1655996_1657454_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_002209934.1|1657538_1658057_-	flavodoxin FldB	NA	NA	NA	NA	NA
WP_041175955.1|1658127_1659174_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	54.1	2.4e-103
WP_012303666.1|1659203_1659767_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	36.0	2.6e-32
WP_012303667.1|1659905_1660136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041176057.1|1660162_1660672_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	51.8	1.8e-43
WP_012303669.1|1660681_1660867_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_012303670.1|1660878_1661196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303671.1|1661262_1662135_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	53.1	9.0e-72
WP_041175956.1|1662131_1662401_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_012303673.1|1662412_1662685_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	44.3	2.0e-14
WP_012303674.1|1662688_1663693_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	42.6	1.8e-63
WP_012303675.1|1663689_1665969_+	replication endonuclease	NA	Q858T4	Yersinia_virus	56.0	9.4e-238
WP_041176059.1|1665988_1666348_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	42.5	1.1e-18
WP_012303677.1|1666547_1666763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041175957.1|1666739_1667060_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	65.3	1.0e-33
WP_112473340.1|1667056_1668028_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	69.2	5.6e-139
WP_012303680.1|1668078_1669866_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	68.6	1.1e-236
WP_012303681.1|1670032_1670887_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	49.1	1.3e-67
WP_012303682.1|1670941_1671973_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	75.8	6.1e-144
WP_012303683.1|1671983_1672682_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.2	1.1e-64
WP_012303684.1|1672777_1673230_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	56.7	2.3e-39
WP_012303685.1|1673226_1673715_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	43.0	3.9e-32
WP_041175959.1|1673714_1674389_+	phage protein	NA	F1BUL6	Cronobacter_phage	67.3	5.3e-80
WP_012303687.1|1674415_1675555_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	65.7	4.0e-136
WP_012303688.1|1675551_1676004_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	59.5	2.4e-44
WP_012303689.1|1676013_1676304_+|holin	holin	holin	Q6K1I2	Salmonella_virus	52.8	2.2e-14
WP_024063639.1|1676300_1676642_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	82.2	1.5e-43
WP_012303691.1|1676641_1676983_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	40.9	6.3e-13
WP_012303692.1|1677132_1677399_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	54.9	1.0e-18
WP_012303693.1|1677586_1679563_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	48.5	3.5e-172
WP_012303694.1|1679562_1679895_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	68.3	1.5e-35
WP_012303695.1|1679887_1681072_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	65.7	2.3e-150
WP_012303696.1|1681064_1681700_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	57.5	9.2e-58
WP_012303697.1|1681710_1683480_+|tail	tail fiber protein	tail	F1BUK3	Cronobacter_phage	47.5	2.2e-69
WP_012303698.1|1683490_1683919_+|tail	tail assembly protein	tail	F1BUK2	Cronobacter_phage	45.3	1.5e-08
WP_012303699.1|1683908_1684640_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	44.6	1.7e-39
WP_012303700.1|1684605_1685154_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	63.7	6.3e-55
WP_012303701.1|1685150_1686806_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	52.8	4.1e-166
1686108:1686125	attL	GGCATGTTCCAGTTCCCG	NA	NA	NA	NA
WP_012303702.1|1686981_1687179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209933.1|1687601_1688501_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	8.5e-33
WP_002209932.1|1688531_1689248_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_012303703.1|1689254_1690988_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.8	1.2e-64
WP_002228062.1|1691166_1692264_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_002209930.1|1692274_1693792_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.0	1.1e-85
WP_011192954.1|1694224_1695439_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	58.8	3.7e-132
WP_012303704.1|1696261_1697959_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	48.9	2.4e-129
1696988:1697005	attR	CGGGAACTGGAACATGCC	NA	NA	NA	NA
WP_012303705.1|1697955_1698510_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	51.1	1.0e-36
WP_012303706.1|1698502_1699213_-	hypothetical protein	NA	Q94MX8	Haemophilus_virus	28.1	4.2e-11
WP_012303707.1|1699209_1699728_-|tail	tail assembly chaperone	tail	A9DEL3	Yersinia_phage	50.6	8.3e-41
WP_012303708.1|1699727_1701323_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	40.2	1.8e-54
WP_011192948.1|1701332_1701956_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	57.9	1.2e-57
WP_012303709.1|1701948_1703133_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	59.0	3.0e-134
WP_011192946.1|1703129_1703459_-	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	60.4	4.6e-29
WP_012303712.1|1703903_1705070_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	52.6	1.1e-101
WP_012303713.1|1705066_1705768_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	43.8	3.3e-40
WP_012303714.1|1705727_1706234_-	hypothetical protein	NA	F1BUL7	Cronobacter_phage	38.9	2.7e-20
WP_012303715.1|1706230_1706683_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	52.7	2.8e-37
WP_012303716.1|1706802_1707546_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.6	1.4e-65
WP_012303717.1|1707563_1708736_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	46.7	2.0e-82
WP_012303718.1|1708818_1709754_-|capsid	phage capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	54.3	3.5e-37
WP_012303719.1|1709931_1712025_+|terminase	terminase	terminase	Q94MZ6	Haemophilus_virus	49.7	2.0e-170
WP_123767123.1|1712041_1712377_+	hypothetical protein	NA	F1BUM7	Cronobacter_phage	67.4	2.9e-34
>prophage 3
NZ_CP009792	Yersinia pseudotuberculosis YPIII chromosome, complete genome	4689436	1980895	2020521	4689436	head,holin,terminase	Burkholderia_phage(35.14%)	50	NA	NA
WP_012303784.1|1980895_1982287_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	70.6	2.0e-198
WP_041176066.1|1982333_1983071_-	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	48.9	1.5e-32
WP_012303786.1|1983135_1983318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303787.1|1983444_1983756_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_012303788.1|1983758_1983896_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_012303789.1|1983892_1984162_-	VRR-NUC domain-containing protein	NA	Q3LZN4	Bacteriophage	71.9	3.4e-30
WP_012303790.1|1984145_1984376_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012303791.1|1984380_1986462_-	DNA polymerase	NA	Q775A3	Bordetella_phage	65.1	3.1e-264
WP_012303792.1|1986558_1987338_-	DUF2303 family protein	NA	A0A291AUR3	Sinorhizobium_phage	31.3	2.5e-20
WP_012303793.1|1987395_1987773_-	hypothetical protein	NA	A0A142K8T9	Gordonia_phage	45.7	4.4e-07
WP_012303794.1|1987825_1988374_-	DUF2815 family protein	NA	Q3LZQ2	Bacteriophage	56.3	1.1e-51
WP_012303795.1|1988386_1989697_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	54.4	2.3e-127
WP_012303796.1|1989699_1990434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303797.1|1990892_1991522_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	42.2	2.1e-38
WP_012303798.1|1991667_1991883_+	helix-turn-helix transcriptional regulator	NA	A0A220NRR8	Escherichia_phage	64.8	7.4e-20
WP_012303799.1|1991886_1994064_+	virulence-associated E family protein	NA	B6SCU2	Bacteriophage	32.0	1.4e-105
WP_012303800.1|1994342_1994555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303801.1|1994636_1995062_+	hypothetical protein	NA	B6SCY2	Bacteriophage	38.6	9.6e-19
WP_012303802.1|1995433_1995814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303803.1|1996076_1996508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303804.1|1996712_1997045_+|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	41.0	7.0e-17
WP_041176069.1|1997037_1997427_+	M15 family metallopeptidase	NA	A0A060DAL8	Salmonella_phage	78.0	2.6e-55
WP_012303806.1|1997423_1997801_+	exotoxin	NA	B6SD18	Bacteriophage	33.3	2.8e-06
WP_012303807.1|1998020_1998572_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	61.3	3.1e-54
WP_012303808.1|1998595_1998955_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	41.7	1.9e-12
WP_041175966.1|1999006_1999267_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	40.7	3.6e-08
WP_012303809.1|1999410_2001015_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	71.6	1.8e-235
WP_123772596.1|2001264_2002806_+	DUF1073 domain-containing protein	NA	Q6IWU2	Burkholderia_phage	44.6	2.2e-113
WP_042593175.1|2002843_2003644_+|head	head morphogenesis protein SPP1	head	Q6IWU3	Burkholderia_phage	41.1	1.6e-51
WP_012303812.1|2003636_2004785_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	42.3	3.2e-53
WP_012303813.1|2004784_2005276_+	hypothetical protein	NA	A1Z022	Burkholderia_virus	30.0	7.7e-12
WP_012303814.1|2005289_2006423_+	DUF2184 domain-containing protein	NA	I6ZXX2	Escherichia_phage	48.4	1.5e-90
WP_012303815.1|2006481_2006850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303816.1|2006859_2007291_+	DUF4054 domain-containing protein	NA	B7VFH0	Pseudomonas_phage	41.9	9.1e-25
WP_012303817.1|2007290_2007788_+	hypothetical protein	NA	A0A088C495	Shewanella_sp._phage	33.0	1.5e-15
WP_012303818.1|2007787_2008171_+	hypothetical protein	NA	Q6IWV0	Burkholderia_phage	38.1	1.9e-13
WP_012303819.1|2008160_2008700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303820.1|2008712_2010227_+	DUF3383 family protein	NA	I7B2P4	Escherichia_phage	40.9	4.5e-95
WP_012303821.1|2010238_2010679_+	hypothetical protein	NA	A0A0F6SJB3	Pseudomonas_phage	50.0	2.0e-35
WP_012303822.1|2010678_2011134_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	54.7	6.6e-34
WP_012303823.1|2011219_2012791_+	hypothetical protein	NA	Q4L1H3	Burkholderia_phage	29.1	4.8e-31
WP_012303824.1|2012790_2013300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303825.1|2013301_2013604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303826.1|2013607_2014447_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	41.6	1.3e-51
WP_012303827.1|2014428_2015106_+	hypothetical protein	NA	Q6IWQ1	Burkholderia_phage	43.2	1.1e-40
WP_012303828.1|2015102_2015462_+	hypothetical protein	NA	Q6IWQ2	Burkholderia_phage	47.8	5.6e-20
WP_012303829.1|2015445_2016645_+	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	46.0	2.3e-81
WP_012303830.1|2016710_2018522_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	37.2	5.3e-34
WP_012303831.1|2018525_2018747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303832.1|2018739_2020521_+	hypothetical protein	NA	H9C1B7	Pectobacterium_phage	59.6	3.5e-195
>prophage 4
NZ_CP009792	Yersinia pseudotuberculosis YPIII chromosome, complete genome	4689436	2616093	2657290	4689436	transposase,protease,coat	Moraxella_phage(16.67%)	33	NA	NA
WP_011192561.1|2616093_2617083_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_012304005.1|2617288_2619736_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210856.1|2619838_2620591_-	molecular chaperone	NA	NA	NA	NA	NA
WP_012304006.1|2620621_2621179_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|2621199_2621730_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210852.1|2621735_2622290_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_012304007.1|2622770_2625401_-	PqiB family protein	NA	NA	NA	NA	NA
WP_012105007.1|2625369_2626617_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002210850.1|2626848_2627346_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002210849.1|2627441_2628155_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_011192556.1|2628174_2630253_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210847.1|2630708_2631590_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_012105009.1|2632248_2632791_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_012304009.1|2632926_2633706_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002210844.1|2633787_2636400_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_012304010.1|2636396_2637560_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210843.1|2637556_2638360_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002210842.1|2638413_2639781_-	MFS transporter	NA	NA	NA	NA	NA
WP_011192552.1|2640147_2641314_+	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210840.1|2641500_2642292_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_012304011.1|2642658_2643510_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.7e-11
WP_012105013.1|2643723_2645115_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210837.1|2645318_2645867_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_002210836.1|2646364_2647075_-	porin	NA	NA	NA	NA	NA
WP_002210835.1|2647372_2648665_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210834.1|2648680_2649808_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210833.1|2649821_2650742_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210832.1|2650734_2651625_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_012304012.1|2651665_2653333_-	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_002210830.1|2653677_2654439_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_012105015.1|2654530_2655367_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_012105016.1|2655702_2656035_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_012304013.1|2656081_2657290_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 5
NZ_CP009792	Yersinia pseudotuberculosis YPIII chromosome, complete genome	4689436	3128394	3236173	4689436	transposase,capsid,plate,integrase,portal,tail,head,lysis,holin	Salmonella_phage(38.0%)	110	3202198:3202257	3236326:3236448
WP_002213775.1|3128394_3128853_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
WP_002212037.1|3129031_3129820_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	73.8	2.5e-89
WP_012304141.1|3129879_3130158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002367661.1|3130596_3131307_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002212041.1|3131791_3132259_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_002224456.1|3132255_3133590_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_002212043.1|3133579_3135601_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_012304143.1|3135613_3138088_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011192365.1|3138756_3139974_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_002212046.1|3140114_3141002_-	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_002227951.1|3141174_3141486_-	cytochrome c	NA	NA	NA	NA	NA
WP_002212048.1|3141485_3141983_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_012304144.1|3141972_3142686_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	1.6e-18
WP_012105178.1|3142689_3143820_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002212051.1|3143860_3145153_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002212052.1|3145155_3146565_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_002212053.1|3146849_3147377_-	iron transporter	NA	NA	NA	NA	NA
WP_011192362.1|3147580_3149500_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_002213976.1|3150099_3151740_-	MFS transporter	NA	NA	NA	NA	NA
WP_002212056.1|3151850_3152858_-	glutaminase A	NA	NA	NA	NA	NA
WP_002213974.1|3153309_3153516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212058.1|3154068_3154839_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	64.7	3.1e-84
WP_002212059.1|3155603_3157133_+	L-asparagine permease	NA	NA	NA	NA	NA
WP_012304146.1|3157328_3158513_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_002212061.1|3158864_3159464_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit E	NA	NA	NA	NA	NA
WP_012304147.1|3159768_3160713_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012304148.1|3160824_3161694_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_012304149.1|3163208_3163769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212066.1|3163793_3164267_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_012105184.1|3164341_3165220_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012105185.1|3165314_3166157_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_002212069.1|3166221_3166749_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_162484090.1|3166768_3168094_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_002212073.1|3168920_3169553_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.3	2.7e-09
WP_071820246.1|3170983_3173527_+	response regulator	NA	A0A1V0SGX0	Hokovirus	29.6	9.1e-40
WP_002213971.1|3173908_3174439_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_011192355.1|3174531_3175263_+	molecular chaperone	NA	NA	NA	NA	NA
WP_012105191.1|3175338_3177903_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002221882.1|3177990_3179268_+	fimbrial protein	NA	NA	NA	NA	NA
WP_002227954.1|3179264_3180005_+	molecular chaperone	NA	NA	NA	NA	NA
WP_011192353.1|3180692_3181835_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	30.4	1.1e-21
WP_012105193.1|3181859_3182687_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002213188.1|3182679_3183540_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_012304152.1|3183606_3184875_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011192351.1|3184904_3185918_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_155115698.1|3186337_3186541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213201.1|3186581_3187379_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012304154.1|3188347_3188782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304155.1|3188793_3189363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304157.1|3191026_3192103_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_002213209.1|3192168_3192459_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	39.4	1.8e-05
WP_012304158.1|3192460_3192712_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_038399917.1|3192847_3193102_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	62.5	8.2e-18
WP_012304160.1|3193098_3193398_+	lysozyme	NA	A0A218M4K8	Erwinia_phage	64.9	2.6e-23
WP_002215413.1|3193414_3193702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304161.1|3194138_3194657_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_012304162.1|3195080_3196250_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	79.2	5.6e-178
WP_012304163.1|3196261_3196777_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	66.9	8.5e-62
WP_011192297.1|3196830_3197178_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	51.6	8.6e-18
WP_071819140.1|3197192_3197312_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_012304164.1|3197304_3200220_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	52.3	7.5e-155
WP_012304165.1|3200231_3200696_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	56.2	7.2e-44
WP_012304166.1|3200692_3201787_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	65.2	2.1e-126
WP_012105206.1|3201861_3202077_+	phage transcriptional activator, Ogr/Delta	NA	S4TNZ3	Salmonella_phage	60.6	1.1e-18
3202198:3202257	attL	ACAAAAAAACCGCCTCTCGGCGGTTAACGACATACTCGTACTACTTTGTTTTACTTAGAA	NA	NA	NA	NA
WP_012304167.1|3202427_3203435_-|integrase	tyrosine-type recombinase/integrase	integrase	P79671	Haemophilus_phage	59.3	3.4e-107
WP_012304168.1|3203442_3203955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304169.1|3204016_3204655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304170.1|3204672_3205065_-	transcriptional regulator	NA	A4JWN8	Burkholderia_virus	47.2	3.2e-21
WP_012304171.1|3205143_3205335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304172.1|3205347_3205551_+	hypothetical protein	NA	U3PFJ1	Vibrio_phage	41.1	9.8e-06
WP_012304173.1|3205562_3205769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304174.1|3205765_3206080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304176.1|3206221_3206482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304177.1|3206512_3206818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304178.1|3206900_3207662_+	hypothetical protein	NA	K7ZRM8	Xanthomonas_citri_phage	49.3	1.9e-09
WP_012304179.1|3207718_3208372_+	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	61.2	1.5e-55
WP_012304180.1|3208368_3209187_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	55.9	1.1e-76
WP_012304181.1|3209183_3210047_+	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	59.7	8.0e-105
WP_012304182.1|3210043_3212599_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	37.4	3.8e-126
WP_012304183.1|3212579_3212810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304184.1|3212806_3213151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304185.1|3213833_3214865_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	65.8	3.5e-131
WP_012304186.1|3214861_3215587_-	hypothetical protein	NA	F1BUR2	Erwinia_phage	31.8	2.1e-26
WP_011192317.1|3215586_3217350_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	63.6	3.1e-228
WP_012304187.1|3217520_3218336_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	71.1	9.6e-76
WP_012304188.1|3218372_3219428_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	63.0	8.5e-125
WP_011192314.1|3219434_3220088_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.8	1.7e-43
WP_011192313.1|3220321_3220813_+|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	48.4	7.9e-33
WP_011192312.1|3220812_3221016_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	70.1	1.8e-23
WP_011192311.1|3221045_3221432_+|holin	holin	holin	NA	NA	NA	NA
WP_012304189.1|3221418_3221814_+	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.0	1.2e-47
WP_012304190.1|3221818_3222241_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	48.6	4.9e-23
WP_072083431.1|3222128_3222353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192308.1|3222339_3222807_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	57.2	1.8e-42
WP_012304191.1|3222803_3223250_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	51.4	3.4e-35
WP_012304193.1|3223581_3224283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304195.1|3224613_3225249_+|plate	phage baseplate assembly protein V	plate	O80314	Escherichia_phage	62.0	7.8e-65
WP_011192304.1|3225245_3225599_+|plate	baseplate assembly protein	plate	A0A218M4K8	Erwinia_phage	59.3	2.4e-31
WP_011192303.1|3225601_3226510_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	73.2	1.3e-118
WP_011192302.1|3226502_3227111_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	75.0	1.7e-85
WP_012304196.1|3227107_3228547_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	77.8	3.8e-75
WP_012304197.1|3228557_3229037_+|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	41.9	2.0e-28
WP_012304198.1|3229170_3230346_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	79.3	3.9e-179
WP_012105203.1|3230357_3230873_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	67.4	2.9e-62
WP_011192297.1|3230926_3231274_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	51.6	8.6e-18
WP_071819140.1|3231288_3231408_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_012304199.1|3231400_3234316_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	52.3	1.5e-155
WP_012304200.1|3234327_3234792_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	56.2	7.2e-44
WP_012304201.1|3234788_3235883_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	66.0	1.2e-126
WP_012304202.1|3235957_3236173_+	transcriptional activator Ogr/delta	NA	S4TNZ3	Salmonella_phage	62.0	4.8e-19
3236326:3236448	attR	ACAAAAAAACCGCCTCTCGGCGGTTAACGACATACTCGTACTACTTTGTTTTACTTAGAATATTTTCCATGGTGCCCGGGGCGGGACTTGAACCCGCACAGCCATAAGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 6
NZ_CP009792	Yersinia pseudotuberculosis YPIII chromosome, complete genome	4689436	3746202	3767674	4689436	protease,tail,plate	Pseudomonas_phage(20.0%)	24	NA	NA
WP_012304333.1|3746202_3746622_-|tail	tail assembly protein	tail	F1BUK2	Cronobacter_phage	33.9	1.4e-06
WP_011192007.1|3746623_3747340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011192006.1|3747436_3748039_-	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.6	2.0e-33
WP_011192005.1|3748035_3749172_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	3.5e-31
WP_002208848.1|3749175_3749631_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002215460.1|3749627_3750224_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208850.1|3750239_3751295_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_012304334.1|3751291_3752698_-	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_012304335.1|3752964_3754458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208854.1|3754578_3754878_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208855.1|3754879_3755248_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012105440.1|3755269_3756778_-|tail	tail protein	tail	B5TK67	Pseudomonas_phage	44.6	1.3e-105
WP_002208857.1|3756774_3756969_-	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_012304336.1|3756973_3757591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304337.1|3757636_3757927_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	49.3	1.3e-11
WP_012304338.1|3758591_3759386_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208861.1|3759361_3760174_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_032466639.1|3760176_3760848_-	aldolase	NA	A0A077SK32	Escherichia_phage	54.9	1.3e-57
WP_012304340.1|3760904_3762209_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.2	2.6e-91
WP_002215470.1|3762419_3762899_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208864.1|3763172_3763895_+	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002208866.1|3764100_3764343_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_012304341.1|3764514_3765450_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_002208868.1|3765886_3767674_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
>prophage 7
NZ_CP009792	Yersinia pseudotuberculosis YPIII chromosome, complete genome	4689436	4021871	4117638	4689436	transposase,capsid,protease,tRNA,plate,integrase,tail	Enterobacteria_phage(18.75%)	95	4044059:4044096	4094713:4094750
WP_012304013.1|4021871_4023080_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_011191911.1|4023227_4024100_-	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_012304416.1|4024499_4026707_+	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_011191909.1|4026699_4027230_+	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_012304417.1|4027385_4029767_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_012304418.1|4029845_4031474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011191906.1|4031946_4032798_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	5.5e-50
WP_002209763.1|4032823_4033813_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002209764.1|4033867_4034761_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002215253.1|4035063_4035369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209765.1|4035465_4035867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012105549.1|4035848_4037168_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_012304419.1|4037160_4038924_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002209768.1|4038920_4039553_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011191901.1|4039562_4040492_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002209770.1|4040484_4041087_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_002354559.1|4041486_4041693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080513694.1|4041904_4042183_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	73.8	8.4e-32
WP_002215266.1|4042265_4042604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304420.1|4042588_4043236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215268.1|4043349_4043550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215270.1|4043808_4043991_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
4044059:4044096	attL	CCCTACAGGGCTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_112473254.1|4044250_4044619_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	32.0	9.5e-07
WP_012304424.1|4046098_4047097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304428.1|4049071_4049704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304429.1|4049964_4050675_-	peptidase P60	NA	K7P6F5	Enterobacteria_phage	77.3	8.8e-110
WP_012304430.1|4050677_4051430_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_012304431.1|4051446_4051788_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.4	3.1e-28
WP_012304432.1|4051790_4051997_-	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	74.4	2.5e-09
WP_012304433.1|4052101_4052824_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	55.5	2.3e-65
WP_012304434.1|4052960_4053383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041176002.1|4053495_4054194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304436.1|4054190_4054772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304437.1|4054840_4055077_-	DUF2767 family protein	NA	NA	NA	NA	NA
WP_050756397.1|4055469_4056090_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	34.5	6.9e-18
WP_012304439.1|4056163_4056406_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	70.1	2.5e-24
WP_012304440.1|4056419_4056665_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	45.0	1.5e-11
WP_012304441.1|4057051_4057489_-|tail	tail assembly chaperone gp38	tail	B6SCW7	Bacteriophage	34.7	6.8e-12
WP_012304442.1|4057498_4058590_-	hypothetical protein	NA	Q76YB0	Aeromonas_virus	38.6	4.8e-06
WP_012304443.1|4058640_4059237_-	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.3	1.1e-33
WP_012304444.1|4059233_4060370_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	31.7	3.7e-33
WP_012304445.1|4060373_4060811_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	46.2	2.3e-20
WP_012304446.1|4060807_4061401_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_012304447.1|4061400_4062471_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	30.9	3.1e-42
WP_012304448.1|4062467_4063874_-	hypothetical protein	NA	A0A192Y5U9	Salmonella_phage	27.7	2.3e-24
WP_012304449.1|4063950_4064481_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	59.8	4.2e-24
WP_012304450.1|4064584_4066531_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	24.0	2.3e-14
WP_012304451.1|4066653_4066953_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012304452.1|4066954_4067329_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012304454.1|4068771_4069116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304455.1|4069115_4069508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304456.1|4069509_4070556_-|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	31.4	2.6e-41
WP_123767129.1|4070665_4071076_-	hypothetical protein	NA	K7PH49	Enterobacterial_phage	47.0	2.4e-11
WP_050756398.1|4071246_4071576_+	hypothetical protein	NA	H6WRV0	Salmonella_phage	43.3	8.5e-07
WP_012304459.1|4071746_4072901_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	70.7	3.6e-161
WP_012304460.1|4073106_4073955_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_012304462.1|4074621_4075005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304463.1|4075068_4075398_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_012304464.1|4075410_4075881_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_012304465.1|4075951_4076773_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	4.0e-45
WP_012304466.1|4076861_4077200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304467.1|4077220_4077685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304468.1|4078185_4079073_-	HSR1-like GTP-binding protein	NA	NA	NA	NA	NA
WP_050320373.1|4079164_4080538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304470.1|4081101_4081689_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_012304471.1|4081786_4081993_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_012304473.1|4082563_4083259_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_012304474.1|4083581_4084328_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_012304475.1|4084410_4086459_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012304476.1|4086469_4088392_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012304477.1|4088656_4088986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304478.1|4088985_4092258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304480.1|4093301_4094510_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.5	6.1e-135
WP_002209774.1|4094997_4095864_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
4094713:4094750	attR	CCCTACAGGGCTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_002209775.1|4095878_4096091_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_012304481.1|4096312_4097698_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.9	2.6e-41
WP_002208567.1|4097908_4098403_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_002208568.1|4098413_4099136_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_002208569.1|4099451_4099976_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_002208570.1|4099972_4101037_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_012304482.1|4101080_4103510_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011191895.1|4103506_4104193_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.1e-31
WP_002208573.1|4104163_4104799_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_002208574.1|4105185_4105962_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002208575.1|4106038_4106908_+	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_002208576.1|4107102_4108017_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_002208577.1|4108019_4108469_+	NfeD family protein	NA	NA	NA	NA	NA
WP_002208578.1|4108648_4109068_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_011191893.1|4109274_4112160_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.8	7.8e-112
WP_002208580.1|4112432_4113242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011191892.1|4113505_4113985_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_002208583.1|4114321_4114561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024063205.1|4114664_4115288_-	putative 5'-nucleotidase	NA	NA	NA	NA	NA
WP_080513695.1|4115281_4116319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|4117179_4117638_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
>prophage 8
NZ_CP009792	Yersinia pseudotuberculosis YPIII chromosome, complete genome	4689436	4123255	4130712	4689436		Bacillus_phage(16.67%)	6	NA	NA
WP_012304486.1|4123255_4124629_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	29.1	2.8e-35
WP_012304487.1|4124932_4125892_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2D2W2D2	Stenotrophomonas_phage	29.3	4.7e-05
WP_012304488.1|4126239_4126989_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.0	1.8e-07
WP_012304489.1|4127023_4128412_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.1e-52
WP_002223297.1|4128619_4129585_-	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	47.9	2.1e-82
WP_011191888.1|4129590_4130712_-	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.4	5.8e-132
