The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009906	Yersinia pestis Antiqua chromosome, complete genome	4708024	3098	63616	4708024	tail,tRNA,transposase,integrase	Escherichia_phage(15.15%)	62	35150:35180	63807:63837
WP_002211204.1|3098_4895_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.3	2.8e-11
WP_002211203.1|4894_5338_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211202.1|5395_6139_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002211201.1|6347_6869_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	32.4	6.5e-09
WP_002213759.1|7076_7535_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
WP_002211199.1|7862_8477_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002211198.1|8638_9643_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.8	4.7e-08
WP_002211197.1|9697_10483_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_002228434.1|10479_11238_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	30.3	1.2e-16
WP_002227944.1|11313_12270_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_002228437.1|12290_13607_+	murein DD-endopeptidase MepM	NA	G3MBP9	Bacillus_virus	44.5	2.4e-15
WP_002211194.1|13873_14836_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_002211193.1|15180_16623_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_002211192.1|16952_17822_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211191.1|18174_19659_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.6	1.2e-79
WP_002211190.1|19900_20542_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002211188.1|21256_21700_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_002211187.1|21686_22016_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_002211186.1|22147_22492_-	RidA family protein	NA	NA	NA	NA	NA
WP_002211185.1|22622_24527_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.6	4.5e-92
WP_002211184.1|24598_25297_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002211183.1|25433_26039_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_087768167.1|26039_26147_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002220632.1|26681_28370_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
WP_002211181.1|28529_29651_+	ribonuclease D	NA	NA	NA	NA	NA
WP_002211180.1|29887_30157_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211179.1|30160_30973_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002220631.1|30997_31684_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211743.1|32404_32677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215627.1|32817_33903_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211740.1|33973_34630_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002211739.1|34732_35179_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
35150:35180	attL	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211738.1|35205_36444_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_071883606.1|37535_37766_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	98.0	1.5e-18
WP_002211721.1|38428_39541_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002211720.1|39662_40436_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211719.1|40449_41655_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211718.1|41702_42185_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211717.1|42181_42436_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211716.1|42437_42788_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211715.1|42789_43374_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211714.1|43370_43778_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211713.1|43843_44764_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211712.1|44776_45088_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_071525538.1|45135_45396_+	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211711.1|45396_48900_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_002211710.1|48902_49244_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002211709.1|50125_50878_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002211708.1|50880_51591_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211707.1|51851_52484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211706.1|52562_52994_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211705.1|53117_53285_+	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211704.1|53358_54366_+	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002214482.1|54464_55016_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211701.1|55158_55374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|55429_56050_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002359202.1|56224_56446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|56621_59825_+	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002211697.1|59824_60823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211696.1|60839_61757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097608205.1|61818_62187_+|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002209743.1|62407_63616_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
63807:63837	attR	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
>prophage 2
NZ_CP009906	Yersinia pestis Antiqua chromosome, complete genome	4708024	376616	439634	4708024	protease,tRNA,transposase,coat	Tupanvirus(18.18%)	54	NA	NA
WP_002211831.1|376616_379004_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002220280.1|379017_380001_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
WP_152328947.1|380357_380405_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002211833.1|380499_380856_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002211834.1|380893_381091_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002227898.1|381187_381739_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_002211836.1|381742_383671_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.1e-127
WP_002216696.1|384061_384274_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_002211839.1|385032_385284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211840.1|385601_386285_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_002216686.1|386406_387069_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_002211842.1|387280_388249_+	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_002211843.1|388245_389136_+	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	27.5	2.9e-09
WP_002211844.1|389135_390020_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_002211845.1|390016_390910_+	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_002216683.1|390977_391190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211846.1|391214_392090_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002211847.1|392218_392773_-	yfeABCD regulator yfeE	NA	NA	NA	NA	NA
WP_002220277.1|393183_393849_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_002210828.1|395353_395704_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210829.1|396039_396876_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210830.1|396967_397729_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002220274.1|398064_398604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220836.1|400472_401690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210832.1|401730_402621_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210833.1|402613_403534_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210834.1|403547_404675_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210835.1|404690_405983_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|406280_406991_+	porin	NA	NA	NA	NA	NA
WP_002210837.1|407470_408019_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_002210838.1|408222_409614_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|409828_410680_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210840.1|411064_411856_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210841.1|412042_413209_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210842.1|413535_414903_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210843.1|414956_415760_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002210844.1|416915_419528_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215118.1|419609_420389_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210846.1|420541_421084_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210847.1|421741_422623_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002210848.1|423096_425169_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210849.1|425188_425902_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210850.1|425997_426495_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_032484561.1|426726_427965_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002220828.1|427942_430585_+	PqiB family protein	NA	NA	NA	NA	NA
WP_002210852.1|431063_431618_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|431623_432154_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216611.1|432174_432732_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210856.1|432762_433515_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002210857.1|433685_436133_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210858.1|436338_437328_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_002210859.1|437535_437775_+	YebV family protein	NA	NA	NA	NA	NA
WP_002215943.1|437884_438274_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_144405800.1|438680_439634_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.0	1.5e-165
>prophage 3
NZ_CP009906	Yersinia pestis Antiqua chromosome, complete genome	4708024	1050085	1058635	4708024	transposase	Bacillus_virus(33.33%)	7	NA	NA
WP_002212210.1|1050085_1051285_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.0	7.1e-27
WP_002212211.1|1051960_1052932_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	74.3	3.1e-137
WP_002212212.1|1053056_1055207_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.8	1.1e-211
WP_002215935.1|1055188_1055593_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	32.8	3.5e-10
WP_002212214.1|1055606_1055843_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	53.3	5.9e-18
WP_002212215.1|1056363_1056729_+	acid shock protein	NA	NA	NA	NA	NA
WP_002209743.1|1057426_1058635_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 4
NZ_CP009906	Yersinia pestis Antiqua chromosome, complete genome	4708024	2084442	2185973	4708024	protease,transposase,plate	Escherichia_phage(30.77%)	46	NA	NA
WP_002216348.1|2084442_2085279_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_002208930.1|2085313_2086072_+	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297096.1|2086838_2087618_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_042669198.1|2087617_2088640_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	2.7e-200
WP_002214014.1|2089773_2092140_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002214016.1|2092143_2092341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211643.1|2092779_2094057_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002211642.1|2094069_2097189_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002211641.1|2097323_2098814_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_002211640.1|2099091_2099679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011566339.1|2100532_2111650_+	autotransporter adhesin YapH	NA	A0A2L1IV18	Escherichia_phage	37.8	1.6e-133
WP_002211637.1|2111752_2113633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011055744.1|2114028_2114115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214025.1|2114195_2115071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|2115400_2115859_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
WP_002211636.1|2115990_2117808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211634.1|2118526_2120083_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_002211633.1|2120160_2121393_+	peptidase T	NA	A0A0K2CPK3	Brevibacillus_phage	39.1	1.2e-05
WP_002211632.1|2121780_2123853_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_071883611.1|2128948_2129230_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	97.8	9.7e-44
WP_002211387.1|2129437_2135896_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	8.5e-42
WP_002214915.1|2135903_2137592_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	3.1e-36
WP_011566340.1|2137604_2143388_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	31.3	1.3e-41
WP_002224891.1|2143384_2144455_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_002211390.1|2144451_2145579_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002214925.1|2145571_2146336_+	thioesterase	NA	NA	NA	NA	NA
WP_002211392.1|2146325_2147630_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211394.1|2149393_2151151_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.0	6.7e-34
WP_002231397.1|2151473_2152265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228079.1|2152783_2153182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002223676.1|2154721_2156065_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_002211399.1|2161484_2165255_+	autotransporter adhesin YapV	NA	NA	NA	NA	NA
WP_011566341.1|2165840_2168090_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.0	1.2e-27
WP_002211401.1|2168115_2169435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211402.1|2169448_2173765_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	49.6	1.8e-27
WP_097608211.1|2173895_2174282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211404.1|2174825_2175239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211405.1|2175418_2176789_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_002211406.1|2177070_2178090_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002211407.1|2178383_2179547_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_100067904.1|2179436_2180791_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002228704.1|2180841_2181585_+	type VI secretion protein ImpG	NA	NA	NA	NA	NA
WP_002213885.1|2181548_2182637_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002212103.1|2182762_2184079_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_002212104.1|2184078_2184624_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002212105.1|2184626_2185973_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 5
NZ_CP009906	Yersinia pestis Antiqua chromosome, complete genome	4708024	2957154	3033790	4708024	transposase,plate	Helicobacter_phage(13.33%)	57	NA	NA
WP_002213759.1|2957154_2957613_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
WP_002210051.1|2958017_2959193_+	DNA repair ATPase	NA	NA	NA	NA	NA
WP_002220957.1|2959299_2960646_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_002228699.1|2960899_2961751_+	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_002210048.1|2961940_2962546_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002210047.1|2962542_2964180_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_002210046.1|2964198_2965152_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210045.1|2965153_2966143_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210044.1|2966135_2967632_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.7	1.1e-13
WP_002210043.1|2967835_2968825_-	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210042.1|2969618_2970539_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	6.8e-78
WP_002210041.1|2970690_2971878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215816.1|2972095_2973745_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_002210039.1|2974093_2975449_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	74.0	4.1e-164
WP_002210038.1|2975902_2976106_+	DNA-damage-inducible protein J	NA	NA	NA	NA	NA
WP_002210036.1|2976724_2977540_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.2	2.6e-28
WP_002213853.1|2977536_2978331_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_002210034.1|2978342_2979491_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_002220949.1|2979509_2980646_-	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210032.1|2980660_2981242_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_002210030.1|2981712_2982414_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_002210028.1|2982570_2983500_+	ribokinase	NA	NA	NA	NA	NA
WP_002210027.1|2983505_2984009_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_002210026.1|2984170_2985037_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002210669.1|2989036_2990221_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
WP_002210670.1|2990471_2990855_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002210671.1|2990856_2991402_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
WP_002210672.1|2991592_2992021_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002210673.1|2992024_2992729_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002210674.1|2993093_2993591_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002210675.1|2993657_2994026_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002210676.1|2994368_2998397_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
WP_002210677.1|2998525_3002746_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
WP_002213759.1|3002872_3003331_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
WP_002210678.1|3003762_3004893_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002228257.1|3004885_3005701_-	thiazole synthase	NA	NA	NA	NA	NA
WP_002217275.1|3005702_3005918_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_002210680.1|3005914_3006712_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.8	1.6e-11
WP_002210681.1|3006701_3007376_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_002210682.1|3007362_3009408_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_002210683.1|3009783_3010293_-	sigma D regulator	NA	NA	NA	NA	NA
WP_002210684.1|3010389_3011172_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_002210685.1|3011264_3012050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210686.1|3012168_3013236_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_002210687.1|3013265_3014006_+	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_002210688.1|3014051_3014642_+	YjaG family protein	NA	NA	NA	NA	NA
WP_002210689.1|3014830_3015106_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
WP_002355296.1|3015155_3015809_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210691.1|3015956_3017243_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002210692.1|3017302_3018892_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.2e-68
WP_002218887.1|3019359_3019545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086016626.1|3025212_3026311_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	2.2e-46
WP_001297096.1|3026976_3027756_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210479.1|3029901_3030420_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002210478.1|3030493_3030937_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002210477.1|3030969_3032814_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002210476.1|3032806_3033790_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
NZ_CP009906	Yersinia pestis Antiqua chromosome, complete genome	4708024	3386100	3447583	4708024	protease,transposase,plate	Escherichia_phage(42.86%)	44	NA	NA
WP_042669233.1|3386100_3387123_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	2.7e-200
WP_001297096.1|3387122_3387902_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002228141.1|3388154_3388739_+	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_002208945.1|3388855_3389341_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_002208944.1|3389482_3390400_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002208943.1|3390635_3391967_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.8	1.2e-43
WP_002208942.1|3392037_3392562_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_002208941.1|3392661_3393507_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_002216730.1|3393572_3394601_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_002208938.1|3394953_3397152_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_002216737.1|3397393_3397609_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002208936.1|3398133_3398589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208935.1|3398937_3399255_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_002208934.1|3400794_3403230_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_002208933.1|3403462_3404347_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_100067904.1|3404524_3405879_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002211645.1|3406150_3407575_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211646.1|3407833_3410014_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_002211647.1|3410085_3411414_-	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_002211648.1|3411410_3413159_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_002211649.1|3413155_3414106_-	acetyltransferase	NA	NA	NA	NA	NA
WP_002211651.1|3416000_3417224_+	MFS transporter	NA	NA	NA	NA	NA
WP_002228661.1|3417171_3417366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211652.1|3417513_3418347_-	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_002211654.1|3418723_3420100_-	peptidase	NA	NA	NA	NA	NA
WP_002211655.1|3420661_3421405_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002215903.1|3421385_3422036_-	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
WP_002215902.1|3423210_3423861_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002215900.1|3424311_3424707_+	lipoprotein	NA	NA	NA	NA	NA
WP_002211662.1|3426982_3427483_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215896.1|3427525_3429070_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211664.1|3429081_3430434_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|3430430_3431117_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002228049.1|3431116_3432853_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|3432856_3433348_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_011566237.1|3433765_3436414_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.4	1.8e-91
WP_002210012.1|3436410_3438759_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	3.1e-18
WP_002210011.1|3438773_3440996_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_016257642.1|3441139_3441496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216110.1|3441669_3441864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210010.1|3443088_3443724_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210009.1|3443739_3446037_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210008.1|3446023_3446791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016632.1|3446886_3447583_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
>prophage 7
NZ_CP009906	Yersinia pestis Antiqua chromosome, complete genome	4708024	3488010	3551064	4708024	protease,tRNA,transposase,integrase	Escherichia_phage(25.0%)	53	3513909:3513923	3548136:3548150
WP_002228653.1|3488010_3488523_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209971.1|3488715_3489870_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002209969.1|3491076_3493056_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002213775.1|3493256_3493715_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
WP_002209968.1|3493925_3494246_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_071525520.1|3494279_3494390_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209967.1|3494535_3495288_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002209965.1|3495778_3497773_+	transketolase	NA	NA	NA	NA	NA
WP_002213759.1|3498079_3498538_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
WP_002209964.1|3498878_3499895_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002209963.1|3499997_3501161_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_002209962.1|3501280_3502360_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002209961.1|3502797_3503667_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_001297096.1|3504446_3505226_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_042669234.1|3505225_3506248_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	3.0e-199
WP_002209959.1|3506696_3507476_+	oxidative stress defense protein	NA	NA	NA	NA	NA
WP_002209958.1|3507486_3508395_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_002209957.1|3508736_3509393_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_002209956.1|3509699_3510941_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	46.5	2.1e-98
WP_002209955.1|3511205_3511802_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002209954.1|3512165_3512495_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_002209953.1|3512831_3513410_+	YecA family protein	NA	NA	NA	NA	NA
WP_002209952.1|3513497_3514811_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
3513909:3513923	attL	ATTGTTTTTGCTGCA	NA	NA	NA	NA
WP_002209951.1|3514879_3516058_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_002209950.1|3516230_3517451_+	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
WP_002209949.1|3518171_3519269_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_002209948.1|3519337_3519724_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_002209947.1|3519935_3522815_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.3	1.7e-268
WP_002209946.1|3523192_3523630_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002209943.1|3526919_3528023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209942.1|3528224_3528926_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002209941.1|3529183_3529681_+	DUF2165 family protein	NA	NA	NA	NA	NA
WP_002209940.1|3529753_3530746_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_002209939.1|3531062_3531329_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_002215144.1|3531309_3531735_+	membrane protein	NA	NA	NA	NA	NA
WP_002209937.1|3531734_3532433_+	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_002209936.1|3532457_3533876_+	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_002220113.1|3533996_3535454_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_002209934.1|3535543_3536062_-	flavodoxin FldB	NA	NA	NA	NA	NA
WP_002209933.1|3536168_3537068_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	8.5e-33
WP_002209932.1|3537098_3537815_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_002209931.1|3537821_3539555_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.7	3.6e-64
WP_002228062.1|3539733_3540831_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_002209930.1|3540841_3542359_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.0	1.1e-85
WP_001297096.1|3543048_3543828_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|3543827_3544850_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002220106.1|3544906_3545965_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.4	2.0e-113
WP_002209928.1|3546046_3546232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214785.1|3546829_3547090_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	36.0	7.4e-06
WP_002209925.1|3547152_3547515_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002214787.1|3547678_3547975_+	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_002209924.1|3547974_3548373_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
3548136:3548150	attR	TGCAGCAAAAACAAT	NA	NA	NA	NA
WP_002209923.1|3548772_3551064_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.5	7.2e-153
>prophage 8
NZ_CP009906	Yersinia pestis Antiqua chromosome, complete genome	4708024	3837228	3926388	4708024	protease,tRNA,transposase	Helicobacter_phage(10.71%)	61	NA	NA
WP_002211351.1|3837228_3839178_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	37.7	8.8e-35
WP_002211350.1|3839458_3839722_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	3.6e-16
WP_002211349.1|3840082_3840403_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_002211348.1|3840428_3842705_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.7	7.4e-166
WP_002213759.1|3842997_3843456_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
WP_002211347.1|3843827_3844046_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002211346.1|3844211_3844922_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211344.1|3845140_3846865_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	3.3e-17
WP_002217690.1|3846867_3848634_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.9	6.8e-26
WP_002211341.1|3849092_3850055_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.7	4.9e-63
WP_002211340.1|3850821_3851316_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002220033.1|3851438_3855338_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.8	1.5e-89
WP_002211338.1|3855530_3856139_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_002228009.1|3856149_3857493_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.4	5.4e-76
WP_002211336.1|3857734_3859027_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.5	4.0e-92
WP_002211334.1|3860568_3861303_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.4	3.6e-21
WP_002211333.1|3862289_3862964_+	glycosyltransferase family 25 protein	NA	A0A2H4UUT1	Bodo_saltans_virus	40.5	7.8e-31
WP_002211332.1|3863081_3865364_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	1.6e-157
WP_002211331.1|3865419_3866277_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_002211330.1|3866973_3868740_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_002211329.1|3868888_3869926_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_002211328.1|3870194_3871289_+	hemagglutinin	NA	B0FIT1	Escherichia_phage	32.7	3.7e-06
WP_002211327.1|3871309_3873157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211326.1|3873523_3874609_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.1	4.4e-84
WP_002211325.1|3874771_3876058_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002211324.1|3876370_3877063_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_002211323.1|3877236_3878910_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_002211322.1|3878970_3879255_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	2.4e-10
WP_002211321.1|3879801_3882093_+	ComEC family protein	NA	NA	NA	NA	NA
WP_002211320.1|3882128_3883877_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	31.5	8.7e-66
WP_002211319.1|3883873_3884860_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_042669235.1|3885910_3886690_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
WP_042669236.1|3886689_3887712_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	2.7e-200
WP_002211317.1|3889044_3889254_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.0	3.0e-10
WP_002211315.1|3889801_3889984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211314.1|3889980_3890733_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002211313.1|3891095_3891989_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_002211311.1|3892761_3893547_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_002211310.1|3893543_3894866_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_002211309.1|3894846_3895575_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_002211308.1|3895571_3900029_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_002213759.1|3900244_3900703_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
WP_002217987.1|3900986_3902843_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002211305.1|3903066_3903615_+	YcbK family protein	NA	A0A0K1LLY2	Rhodobacter_phage	34.7	7.8e-05
WP_002211304.1|3903675_3904323_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.3	2.2e-22
WP_002430096.1|3904476_3904593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211303.1|3904746_3905937_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002354007.1|3906193_3907273_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	56.5	3.2e-111
WP_002211301.1|3907573_3908974_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.2	6.5e-80
WP_002228013.1|3909472_3910678_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002220013.1|3911393_3914009_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002211296.1|3914644_3915655_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_002211295.1|3915837_3916389_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_002363919.1|3916414_3917524_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_002211293.1|3917626_3919747_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_002211292.1|3919752_3921666_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.5e-47
WP_002211291.1|3921794_3923081_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_002211290.1|3923067_3924720_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_002211289.1|3924716_3925295_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_002228015.1|3925564_3925732_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_002213775.1|3925929_3926388_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
>prophage 9
NZ_CP009906	Yersinia pestis Antiqua chromosome, complete genome	4708024	3931021	4004256	4708024	protease,transposase,plate	Helicobacter_phage(12.5%)	53	NA	NA
WP_002224683.1|3931021_3932773_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002226586.1|3932983_3933439_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002213775.1|3933606_3934065_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
WP_002213066.1|3934254_3935316_-	porin OmpA	NA	NA	NA	NA	NA
WP_002213065.1|3935673_3936180_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213064.1|3936408_3937044_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213063.1|3937145_3939284_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213062.1|3939313_3939760_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002221095.1|3939953_3942008_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.8	1.5e-16
WP_002213060.1|3942068_3942533_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213058.1|3942711_3943392_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213056.1|3943707_3944124_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213054.1|3944232_3944550_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213052.1|3944610_3945801_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213049.1|3945894_3946173_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002213046.1|3946224_3946554_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213039.1|3950199_3952617_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213038.1|3952770_3953517_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213036.1|3954247_3954466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213034.1|3954729_3955254_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213032.1|3955243_3956527_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|3956528_3957266_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213028.1|3957281_3958520_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213026.1|3958512_3959232_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213025.1|3959233_3959986_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_002213024.1|3959988_3960777_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002228570.1|3960863_3961304_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213017.1|3961341_3961590_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002213016.1|3961688_3962537_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002213014.1|3965478_3965979_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002214707.1|3966021_3967572_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213011.1|3967583_3968936_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002214568.1|3969616_3971353_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|3971356_3971848_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211927.1|3972235_3974878_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	1.6e-92
WP_002211928.1|3974880_3977229_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.1	4.5e-17
WP_002211929.1|3977244_3979545_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211930.1|3979541_3980315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211931.1|3980468_3980729_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002211932.1|3980744_3982928_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211935.1|3985734_3986967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211936.1|3986963_3990386_+	type VI secretion system membrane subunit	NA	NA	NA	NA	NA
WP_002211938.1|3992048_3993107_+	PAAR domain protein	NA	NA	NA	NA	NA
WP_002211939.1|3993121_3993577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211940.1|3993797_3995561_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211941.1|3995524_3996610_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002214552.1|3996584_3997166_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211943.1|3997165_3997618_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002211944.1|3997642_3999010_+	membrane protein	NA	NA	NA	NA	NA
WP_002211945.1|3999221_3999845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|4000527_4002123_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211947.1|4002350_4003004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|4003047_4004256_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 10
NZ_CP009906	Yersinia pestis Antiqua chromosome, complete genome	4708024	4162795	4208113	4708024	protease,tail,plate	Pseudomonas_phage(25.0%)	37	NA	NA
WP_002210815.1|4162795_4163305_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210816.1|4163339_4163597_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210817.1|4163600_4164731_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210818.1|4164893_4167182_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210820.1|4167675_4168404_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210821.1|4168665_4171341_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.0e-102
WP_002228028.1|4171528_4174402_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210824.1|4174469_4175123_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_002216094.1|4175125_4175698_-	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_002216093.1|4175865_4177818_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002210825.1|4177841_4178996_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210826.1|4180098_4181214_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002228026.1|4182644_4183811_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002208870.1|4184085_4185612_-	MFS transporter	NA	NA	NA	NA	NA
WP_002208869.1|4185988_4187017_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208868.1|4187090_4188878_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208867.1|4189284_4190220_-	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002264765.1|4190391_4190628_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	63.8	4.8e-20
WP_002208864.1|4190833_4191556_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002215470.1|4191829_4192309_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208862.1|4192519_4193824_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002208861.1|4194532_4195345_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208860.1|4195320_4196115_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208859.1|4196745_4197036_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208858.1|4197081_4197699_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208857.1|4197703_4197898_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208856.1|4197894_4199403_+|tail	tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208855.1|4199424_4199793_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002208854.1|4199794_4200094_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208852.1|4201973_4203380_+	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208850.1|4203376_4204432_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002215460.1|4204447_4205044_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208848.1|4205040_4205496_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208847.1|4205499_4206636_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002215458.1|4206632_4206893_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208846.1|4206889_4207237_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002208845.1|4207333_4208113_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
>prophage 11
NZ_CP009906	Yersinia pestis Antiqua chromosome, complete genome	4708024	4294873	4349729	4708024	protease,holin,transposase	Planktothrix_phage(13.33%)	50	NA	NA
WP_002210751.1|4294873_4295692_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002210753.1|4295908_4297399_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.8	2.8e-12
WP_002210754.1|4297508_4298300_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002217291.1|4298565_4298718_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_002210756.1|4298952_4299732_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210757.1|4299731_4300427_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002210758.1|4300420_4301500_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.1	1.4e-21
WP_002210759.1|4301555_4302377_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_002210760.1|4302667_4303672_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_002220188.1|4303856_4305137_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	32.1	2.4e-17
WP_002210762.1|4305235_4306273_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_002210763.1|4306272_4307424_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_002210764.1|4307407_4308211_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_002216554.1|4308203_4308926_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_002210766.1|4309077_4309788_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.3	3.5e-13
WP_002220186.1|4310877_4312893_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_002210768.1|4313184_4313430_+	DNA-binding protein VF530	NA	NA	NA	NA	NA
WP_002210769.1|4313560_4314484_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.8	3.7e-23
WP_002210771.1|4315015_4315996_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_002210772.1|4316096_4316576_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_002210773.1|4316572_4316818_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_002210774.1|4316820_4317273_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_002210775.1|4317415_4318126_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_002213775.1|4318360_4318819_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
WP_002220180.1|4319046_4320750_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	9.4e-57
WP_002218281.1|4320772_4322245_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002218278.1|4322302_4322899_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002228035.1|4323263_4325312_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002214199.1|4325543_4326437_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002214197.1|4326474_4327323_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002214195.1|4327668_4328532_+	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002213759.1|4329460_4329919_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
WP_002220173.1|4330724_4331198_-	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
WP_002220171.1|4331555_4333370_+	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.4	1.0e-16
WP_002220170.1|4333356_4334721_+	sigma 54-interacting transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.1	1.3e-05
WP_002220169.1|4335068_4336178_+	alkene reductase	NA	NA	NA	NA	NA
WP_002220168.1|4336178_4337090_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002220165.1|4337644_4337872_+	N5,N10-methylene tetrahydromethanopterin reductase	NA	NA	NA	NA	NA
WP_002220163.1|4337882_4338209_+	EthD family reductase	NA	NA	NA	NA	NA
WP_002220162.1|4338247_4339354_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002220159.1|4339366_4340542_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002220158.1|4340546_4342289_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.6	6.3e-24
WP_002220156.1|4342302_4343289_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_002220154.1|4343340_4344051_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_002220152.1|4344441_4345797_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.6	4.1e-55
WP_011566265.1|4347010_4347211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016256670.1|4347244_4347571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228617.1|4347711_4347948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002223532.1|4348031_4348346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|4348520_4349729_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 1
NZ_CP009905	Yersinia pestis Antiqua plasmid pCD, complete sequence	70290	25042	48441	70290	transposase,protease	Enterobacteria_phage(42.86%)	21	NA	NA
WP_002213294.1|25042_25450_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.2	4.7e-07
WP_042669180.1|25473_25791_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|25962_26421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144405798.1|26489_26708_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002220934.1|29368_31684_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.5	5.0e-279
WP_002213258.1|31847_32399_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002224338.1|32417_32882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229829.1|33020_33350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016640.1|33449_34548_+|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002213267.1|34696_35122_-	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_002220893.1|35895_37068_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.4	1.6e-220
WP_002213403.1|37877_38270_-	YopE transcriptional regulator YerA	NA	NA	NA	NA	NA
WP_002229754.1|38463_39123_+	type III secretion system effector GTPase activator YopE	NA	NA	NA	NA	NA
WP_002213360.1|39262_39562_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002224342.1|39554_39797_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_154020274.1|40661_40898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213354.1|41057_42023_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	3.1e-89
WP_002220902.1|42019_43186_-	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
WP_002229770.1|45197_45827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213007.1|46424_46973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213006.1|47472_48441_+|protease	T3SS effector cysteine protease YopT	protease	NA	NA	NA	NA
>prophage 1
NZ_CP009904	Yersinia pestis Antiqua plasmid pMT, complete sequence	96473	0	96115	96473	integrase,tail,transposase,terminase	Salmonella_phage(76.47%)	88	1878:1892	14732:14746
WP_002215095.1|413_665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213141.1|737_1301_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002425587.1|1330_1756_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002221186.1|1770_5295_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
1878:1892	attL	CATCCAGCTCTGGCA	NA	NA	NA	NA
WP_002211767.1|5475_6711_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_042669178.1|9510_10533_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_002228802.1|11721_12108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353208.1|12102_13206_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
WP_002216410.1|13965_14478_-	F1 capsule protein	NA	NA	NA	NA	NA
WP_002211763.1|14558_17060_-	F1 capsule-anchoring protein	NA	NA	NA	NA	NA
14732:14746	attR	TGCCAGAGCTGGATG	NA	NA	NA	NA
WP_002211762.1|17084_17861_-	chaperone Caf1M	NA	NA	NA	NA	NA
WP_002211761.1|18188_19094_+	F1 operon transcriptional regulator Caf1R	NA	NA	NA	NA	NA
WP_002221050.1|19442_20651_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211760.1|21119_22142_+|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002211758.1|24217_25981_-	phospholipase D	NA	NA	NA	NA	NA
WP_002211757.1|26058_26547_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211756.1|27285_27561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215065.1|27583_28525_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211754.1|28590_29211_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215068.1|29410_29737_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211753.1|29736_29964_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002211752.1|30265_31471_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002215070.1|31467_32439_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002228775.1|32817_34215_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002211750.1|34376_34577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|35077_35755_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211748.1|35754_35976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|35986_36406_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211747.1|36459_37239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211746.1|37637_38144_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211745.1|38856_39087_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211744.1|39159_41169_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_000255944.1|41292_42315_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|42314_43094_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|43227_43836_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|44137_47026_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|47106_47685_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002214118.1|47741_52373_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211773.1|52394_52982_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|52969_53767_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211775.1|53759_54458_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	7.1e-136
WP_002221062.1|54547_54883_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	96.4	1.1e-57
WP_000952684.1|59509_59734_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|59859_60177_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|60236_60983_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|61057_61441_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|61442_61916_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|61906_62251_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|62348_63182_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|63181_63616_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|63659_64322_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|64396_65272_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002211785.1|65298_66132_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	91.3	5.8e-137
WP_002211786.1|66154_67729_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	2.4e-301
WP_002211787.1|67762_69019_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|69021_69663_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|69858_70125_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|70134_71025_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|71030_71285_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|71277_71916_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|71912_72581_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|72580_73279_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|73343_74903_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|74905_75184_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|75243_75666_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|75670_76198_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|76520_77171_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|77255_77483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|77592_78051_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002214145.1|78259_78829_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213303.1|78841_79588_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_002213300.1|81723_82809_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002214156.1|83055_83328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002214160.1|84605_85250_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	1.8e-122
WP_002214164.1|85994_87059_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|87627_87840_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|87839_88175_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|88171_88351_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|88391_88667_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002221119.1|88734_89139_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.7	1.7e-70
WP_001297096.1|90229_91009_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002222868.1|91086_91458_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|91611_92442_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|92445_92646_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_161597819.1|92736_93768_-	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_000920226.1|93815_94082_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|94081_95026_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|95086_96115_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
