The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009997	Yersinia kristensenii strain Y231 chromosome, complete genome	4496569	198030	225957	4496569	coat,protease,transposase	Shigella_phage(50.0%)	24	NA	NA
WP_098087190.1|198030_199205_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	72.5	5.9e-135
WP_038632469.1|199639_199834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038632471.1|199939_200785_-	EamA family transporter	NA	NA	NA	NA	NA
WP_038632472.1|201041_201290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038632473.1|201396_202446_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_120011630.1|202982_204134_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_038632477.1|204596_204830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038632479.1|205567_205957_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_038632480.1|206072_206315_-	YebV family protein	NA	NA	NA	NA	NA
WP_038632482.1|206430_208140_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_038632484.1|208359_209364_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_038632487.1|209414_211856_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_038632489.1|211942_212710_-	molecular chaperone	NA	NA	NA	NA	NA
WP_038632491.1|212756_213314_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_038632493.1|213326_213884_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_038632495.1|213889_214426_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_038632497.1|214753_216208_-	MFS transporter	NA	NA	NA	NA	NA
WP_038632499.1|216336_217233_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038632501.1|217267_219898_-	PqiB family protein	NA	NA	NA	NA	NA
WP_038632503.1|219866_221114_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_038632505.1|221333_221831_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_038632507.1|221926_222655_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_038632508.1|222674_224747_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	35.3	7.3e-88
WP_025378445.1|225075_225957_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 2
NZ_CP009997	Yersinia kristensenii strain Y231 chromosome, complete genome	4496569	879400	891219	4496569		Paramecium_bursaria_Chlorella_virus(16.67%)	7	NA	NA
WP_038633822.1|879400_882103_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	26.6	5.0e-44
WP_004392115.1|882319_883018_-	MgtC family protein	NA	G3MA03	Bacillus_virus	41.0	1.4e-14
WP_038633826.1|883953_885693_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.7	1.8e-10
WP_071841804.1|885826_886090_-	protein DsrB	NA	NA	NA	NA	NA
WP_002210893.1|886276_886489_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_038633830.1|886873_887908_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	50.9	9.9e-86
WP_038633832.1|888066_891219_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	61.9	0.0e+00
>prophage 3
NZ_CP009997	Yersinia kristensenii strain Y231 chromosome, complete genome	4496569	1506062	1548565	4496569	integrase,holin,terminase,tail	Salmonella_phage(18.92%)	51	1504304:1504318	1547048:1547062
1504304:1504318	attL	ATGAGCAATACGAGC	NA	NA	NA	NA
WP_051957687.1|1506062_1506581_-	hypothetical protein	NA	A0A1I9KF71	Aeromonas_phage	29.5	2.5e-05
WP_042562349.1|1506580_1506922_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	77.2	2.1e-40
WP_038635295.1|1506924_1507200_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	47.4	2.8e-19
WP_052488188.1|1507186_1507567_-	hypothetical protein	NA	A0A0F6R7N0	Escherichia_coli_O157_typing_phage	39.4	9.8e-15
WP_042562348.1|1507671_1508796_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	30.6	6.9e-32
WP_042562347.1|1508902_1511089_-	hypothetical protein	NA	T1S9Y2	Salmonella_phage	45.6	1.8e-44
WP_038635306.1|1511261_1511531_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	40.7	1.2e-11
WP_038635309.1|1511573_1511879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038635315.1|1512115_1514614_-	phage protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	58.9	2.2e-288
WP_038635317.1|1514615_1516406_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	38.9	3.7e-104
WP_038635320.1|1516402_1518913_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	46.3	6.2e-198
WP_038635323.1|1518925_1519468_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	59.3	4.2e-43
WP_042562346.1|1519460_1519931_-	hypothetical protein	NA	T1SA73	Salmonella_phage	57.6	2.0e-46
WP_038635330.1|1519932_1522392_-	hypothetical protein	NA	T1S9I3	Salmonella_phage	69.5	0.0e+00
WP_038635333.1|1522391_1522997_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	68.7	9.0e-79
WP_038635336.1|1522996_1523317_-	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	51.9	4.1e-22
WP_038635339.1|1523366_1523750_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	45.5	4.7e-17
WP_038635342.1|1523761_1524196_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	80.4	3.8e-55
WP_038635345.1|1524251_1525235_-	phage protein	NA	G9L6C5	Escherichia_phage	83.5	4.4e-160
WP_038635349.1|1525245_1525968_-	peptidase	NA	A0A193GYS7	Enterobacter_phage	71.8	1.7e-52
WP_038635352.1|1525964_1526273_-	hypothetical protein	NA	Q2A090	Sodalis_phage	58.8	4.1e-19
WP_038635355.1|1526269_1527931_-|tail	tail protein	tail	T1S9Z7	Salmonella_phage	71.5	2.1e-231
WP_038635358.1|1527942_1528149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051957690.1|1528628_1529378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038635361.1|1529436_1530909_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.3	8.2e-227
WP_038635363.1|1530905_1531463_-|terminase	terminase small subunit	terminase	Q858H4	Salmonella_phage	53.8	3.5e-45
WP_038635366.1|1531541_1532048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051957692.1|1532196_1532841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038635369.1|1532840_1533479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038635372.1|1533540_1533750_-	TraR/DksA family transcriptional regulator	NA	A5X9I2	Aeromonas_virus	46.8	2.4e-07
WP_038635375.1|1533742_1534219_-	hypothetical protein	NA	A0A193GYM2	Enterobacter_phage	75.3	9.6e-60
WP_038635378.1|1534215_1534428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051957694.1|1534608_1535085_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	35.9	1.9e-23
WP_051957695.1|1535065_1536313_-	hypothetical protein	NA	A0A1J0MCP9	Streptomyces_phage	36.5	4.8e-10
WP_038635381.1|1536312_1536570_-	hypothetical protein	NA	A0A1I9KFG5	Aeromonas_phage	63.2	6.6e-07
WP_038635383.1|1536566_1536770_-	hypothetical protein	NA	A0A1I9SES5	Klebsiella_phage	51.9	3.6e-08
WP_038635386.1|1536919_1537147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038635389.1|1537291_1537900_+	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	49.3	5.9e-46
WP_167335054.1|1538383_1538527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167335063.1|1538563_1540276_+	hypothetical protein	NA	K7PJT5	Enterobacteria_phage	61.7	4.2e-105
WP_038635395.1|1540288_1541449_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	59.2	1.1e-125
WP_038635398.1|1541509_1541785_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	59.6	9.6e-12
WP_051957696.1|1541824_1542070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144242883.1|1542077_1542407_+	hypothetical protein	NA	A0A2P0PA76	Pectobacterium_phage	39.4	4.1e-09
WP_038635402.1|1542403_1542607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038635406.1|1542599_1543235_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	75.0	2.9e-88
WP_038635408.1|1543315_1543522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038635411.1|1543514_1543913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038635414.1|1543916_1545119_-|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	64.0	8.2e-140
WP_038635417.1|1545351_1546929_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_038639720.1|1547101_1548565_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	37.7	1.1e-85
1547048:1547062	attR	ATGAGCAATACGAGC	NA	NA	NA	NA
>prophage 4
NZ_CP009997	Yersinia kristensenii strain Y231 chromosome, complete genome	4496569	1749396	1757316	4496569		Escherichia_phage(66.67%)	7	NA	NA
WP_038635844.1|1749396_1750461_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.3	2.4e-111
WP_038635847.1|1750568_1751063_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.7	1.1e-29
WP_032819236.1|1751299_1752625_+	MFS transporter	NA	NA	NA	NA	NA
WP_038635851.1|1752790_1753396_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.3	1.5e-25
WP_038635854.1|1753392_1754244_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	32.2	2.4e-21
WP_032819231.1|1754245_1754863_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.0	2.3e-74
WP_038635857.1|1754871_1757316_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	1.3e-216
>prophage 5
NZ_CP009997	Yersinia kristensenii strain Y231 chromosome, complete genome	4496569	2802466	2882674	4496569	tRNA,plate,head,tail,integrase,holin,capsid,lysis,portal	Salmonella_phage(27.45%)	90	2828464:2828482	2859966:2859984
WP_038637827.1|2802466_2802904_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_038637829.1|2802976_2803900_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_038637833.1|2804305_2804551_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.2	2.0e-16
WP_038637836.1|2804563_2805250_+	PAS domain-containing protein	NA	A2I306	Vibrio_virus	30.9	1.7e-20
WP_038637839.1|2805279_2805969_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038637842.1|2806074_2807784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038637845.1|2807930_2809316_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	80.0	1.4e-55
WP_038637848.1|2809554_2810769_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_038637849.1|2810819_2812901_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_038637852.1|2812901_2813594_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_038637855.1|2813599_2815702_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	3.6e-10
WP_004392061.1|2815720_2815996_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_038637858.1|2816050_2816674_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	37.5	3.7e-19
WP_038637861.1|2816960_2818655_+	NAD-dependent DNA ligase LigB	NA	A0A1Y0SVC9	Pseudomonas_phage	23.3	1.4e-23
WP_038637865.1|2818670_2819291_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_038637867.1|2821021_2821888_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_038637870.1|2821897_2823892_-	cyclic di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	34.1	4.1e-19
WP_038637873.1|2824333_2824570_-	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	45.1	9.7e-05
WP_038637876.1|2824689_2825523_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_038637879.1|2826742_2827606_-	YicC family protein	NA	NA	NA	NA	NA
WP_038637882.1|2827733_2828450_+	ribonuclease PH	NA	NA	NA	NA	NA
2828464:2828482	attL	CTTGCTAGTCGCCTTTTTT	NA	NA	NA	NA
WP_042562656.1|2828599_2828860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562525.1|2829061_2829277_-	late control protein B	NA	S4TNZ3	Salmonella_phage	60.6	1.8e-18
WP_144404296.1|2829351_2830452_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	67.5	1.3e-128
WP_042562523.1|2830454_2830919_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	64.6	3.8e-45
WP_042562522.1|2830930_2833858_-|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	47.1	7.8e-160
WP_042562521.1|2833850_2833970_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	56.4	1.4e-07
WP_004705492.1|2833984_2834263_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	53.6	1.2e-17
WP_042562520.1|2834414_2834930_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	68.0	3.2e-61
WP_042562519.1|2834943_2836119_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	80.1	1.3e-179
WP_071841754.1|2836244_2836724_-	hypothetical protein	NA	F1BUP0	Erwinia_phage	48.4	3.9e-37
WP_080868727.1|2836723_2837734_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	72.3	1.2e-88
WP_042562518.1|2837730_2838339_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	74.6	5.3e-87
WP_042562517.1|2838331_2839240_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.2	3.0e-118
WP_042562516.1|2839239_2839596_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	58.3	1.3e-32
WP_042562515.1|2839592_2840228_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	62.4	1.4e-66
WP_042562514.1|2840414_2840861_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	48.0	2.1e-32
WP_042562513.1|2840857_2841325_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	55.3	2.8e-40
WP_042562512.1|2841423_2841849_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	45.9	1.0e-20
WP_042562511.1|2841853_2842249_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.0	3.5e-47
WP_071841755.1|2842235_2842622_-|holin	holin	holin	NA	NA	NA	NA
WP_042562510.1|2842652_2842856_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	64.2	5.7e-22
WP_042562509.1|2842855_2843347_-|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	49.0	8.7e-32
WP_042562508.1|2843445_2844102_-	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.1	8.6e-43
WP_042562507.1|2844107_2845163_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	63.8	4.7e-123
WP_080868732.1|2845199_2846105_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	53.1	2.6e-53
WP_042562505.1|2846180_2847944_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	63.2	2.6e-227
WP_042562504.1|2847943_2848669_+	hypothetical protein	NA	A0A077K8Q7	Ralstonia_phage	35.8	6.4e-31
WP_042562503.1|2848665_2849697_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	65.5	6.3e-133
WP_042562501.1|2850378_2850723_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	38.9	1.1e-17
WP_042562500.1|2850736_2851057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562499.1|2851080_2851311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052488216.1|2851291_2853916_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	35.6	2.3e-123
WP_042562496.1|2854549_2855371_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	55.0	4.5e-73
WP_144404290.1|2855367_2856015_-	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	63.4	1.0e-59
WP_052488214.1|2856008_2856446_-	DUF3850 domain-containing protein	NA	A0A1P8DUQ0	Escherichia_phage	50.7	5.2e-12
WP_042562648.1|2856528_2856834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158502693.1|2856837_2857005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562495.1|2857040_2857322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167335061.1|2857356_2857515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562494.1|2857499_2857814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562493.1|2857810_2858020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562492.1|2858016_2858391_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	60.3	1.7e-32
WP_042562491.1|2858500_2858800_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	61.6	7.9e-28
WP_042562490.1|2858866_2859862_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	70.7	3.1e-137
WP_038637885.1|2860062_2860704_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
2859966:2859984	attR	CTTGCTAGTCGCCTTTTTT	NA	NA	NA	NA
WP_004392079.1|2860778_2861375_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_038637890.1|2861496_2861955_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	58.1	3.1e-47
WP_038637892.1|2861932_2863165_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.4	3.3e-43
WP_038637895.1|2863359_2864028_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_005164747.1|2864291_2864528_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_004392084.1|2864539_2864707_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_038637899.1|2864792_2865602_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	30.0	6.1e-22
WP_038637901.1|2865685_2866165_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.2	3.7e-27
WP_038637905.1|2866161_2866944_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_038637908.1|2866944_2868222_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_038637911.1|2868779_2869745_-	lipopolysaccharide heptosyltransferase RfaC	NA	NA	NA	NA	NA
WP_038637914.1|2869744_2870809_-	ADP-heptose--LPS heptosyltransferase RfaF	NA	NA	NA	NA	NA
WP_038637918.1|2870839_2871772_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	36.9	4.4e-32
WP_038637920.1|2872015_2873227_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.9	8.5e-36
WP_038639959.1|2873266_2874292_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	4.7e-19
WP_038637927.1|2874497_2875523_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_038637930.1|2875546_2876917_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.8	3.1e-10
WP_038637933.1|2876926_2878474_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_038637936.1|2878715_2879150_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_038637938.1|2879199_2879448_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	48.7	9.2e-14
WP_032820633.1|2879538_2880015_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_038637943.1|2880014_2881034_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_004392219.1|2881166_2881988_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_038637947.1|2882155_2882674_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP009997	Yersinia kristensenii strain Y231 chromosome, complete genome	4496569	3587334	3649848	4496569	plate	Escherichia_phage(20.0%)	52	NA	NA
WP_038630745.1|3587334_3589104_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_038630747.1|3589067_3590150_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_038630749.1|3590185_3590698_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_042562474.1|3590702_3593165_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_038630762.1|3593170_3594145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038639277.1|3594191_3594533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080723376.1|3595123_3595807_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_038630764.1|3595889_3596432_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_038630766.1|3596434_3598222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038630768.1|3598324_3598690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038630773.1|3599528_3599978_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_038630778.1|3600001_3601408_+	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_038630786.1|3602184_3603195_-	MsnO8 family LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_038630788.1|3603213_3604167_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_158501186.1|3604184_3604907_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.7	8.9e-25
WP_038630792.1|3604920_3605688_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_038630798.1|3606286_3607138_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.4	1.8e-48
WP_038630800.1|3607246_3608134_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042562472.1|3608165_3609239_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_038630804.1|3610587_3611607_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_038630806.1|3611899_3612964_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_042562471.1|3613059_3614424_+	MFS transporter	NA	NA	NA	NA	NA
WP_004722488.1|3615239_3615479_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	46.5	2.7e-10
WP_038630815.1|3615513_3615837_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	O64357	Escherichia_phage	48.0	2.8e-18
WP_038630817.1|3616036_3616903_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_038630819.1|3616989_3617322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038630821.1|3617327_3617693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051957643.1|3617748_3618081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038639288.1|3618074_3618548_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_038630823.1|3618580_3619012_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.6	5.5e-14
WP_038639291.1|3619581_3619812_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_038630827.1|3620821_3621322_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004876065.1|3621360_3622914_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_038630830.1|3622925_3624263_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_071841778.1|3624259_3624913_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_038630832.1|3624916_3626629_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004877984.1|3626644_3627136_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_038630835.1|3627317_3629957_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.0	3.1e-83
WP_038630837.1|3630051_3630507_+	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	39.3	1.1e-15
WP_032815323.1|3630500_3630824_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_038630842.1|3630925_3633649_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.5	1.2e-13
WP_038630844.1|3633649_3634255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080723377.1|3634560_3636477_+	lipase family protein	NA	A0A1M7XUB5	Cedratvirus	31.6	1.6e-09
WP_072103624.1|3636764_3637238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051957711.1|3638283_3639717_+	lipase family protein	NA	G9E505	Ostreococcus_lucimarinus_virus	30.5	3.2e-10
WP_051957647.1|3639700_3640447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038630853.1|3640575_3640842_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_038630856.1|3640845_3642021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562470.1|3642004_3645406_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_038630858.1|3645405_3646992_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_038630860.1|3647023_3648787_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_038630863.1|3648741_3649848_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 7
NZ_CP009997	Yersinia kristensenii strain Y231 chromosome, complete genome	4496569	4095632	4155022	4496569	tRNA,head,integrase,holin,terminase,protease	Cronobacter_phage(23.21%)	84	4105534:4105579	4155233:4155278
WP_038631634.1|4095632_4096271_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004390643.1|4096241_4096928_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	2.5e-32
WP_038631637.1|4096924_4099357_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_038631640.1|4099395_4100460_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_038631642.1|4100456_4100981_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_038631644.1|4101159_4101882_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_038631646.1|4101892_4102387_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_038631649.1|4102599_4103988_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	1.9e-39
WP_038631651.1|4104194_4104407_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_038631653.1|4104406_4105288_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.6	8.3e-33
4105534:4105579	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAGCCCTGTAGGGCGTACCAT	NA	NA	NA	NA
WP_042562455.1|4105611_4106766_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	71.4	4.7e-161
WP_042562453.1|4107352_4107895_-	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	68.9	7.6e-61
WP_042562452.1|4107891_4108095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167335059.1|4108094_4108271_-	hypothetical protein	NA	A0A2H4A350	Salmonella_phage	50.0	6.5e-06
WP_042562451.1|4108501_4108777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562450.1|4108760_4108982_-	hypothetical protein	NA	C0LP33	Escherichia_virus	52.5	8.8e-08
WP_042562449.1|4108971_4109517_-	hypothetical protein	NA	R9TPQ7	Aeromonas_phage	50.3	5.3e-38
WP_038636089.1|4109506_4109893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052488208.1|4109892_4110537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562448.1|4110581_4110764_-	DUF1317 family protein	NA	A0A193GYJ8	Enterobacter_phage	56.9	7.0e-11
WP_042562447.1|4110760_4111468_-	exonuclease	NA	Q9T1N7	Enterobacteria_phage	51.5	9.2e-67
WP_042562446.1|4111460_4112360_-	recombinase RecT	NA	A0A2I7RGR8	Vibrio_phage	75.8	2.8e-92
WP_042562445.1|4112359_4112653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071841786.1|4112913_4113096_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_052488205.1|4113099_4113321_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	46.3	6.9e-05
WP_144404292.1|4113394_4113970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562443.1|4113991_4114252_-	hypothetical protein	NA	Q8LTB2	Lactobacillus_phage	54.3	2.5e-14
WP_042562442.1|4114414_4114996_+	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	50.3	1.1e-46
WP_042562440.1|4115612_4115810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042562439.1|4116453_4116663_+	DUF2767 family protein	NA	NA	NA	NA	NA
WP_042562438.1|4116722_4117754_-	hypothetical protein	NA	A0A0N7KZA9	Stx2-converting_phage	57.6	7.8e-99
WP_042562437.1|4117888_4118611_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	55.2	4.0e-65
WP_042562436.1|4118715_4118910_+	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	85.5	4.2e-22
WP_042562435.1|4119025_4119322_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	62.1	6.9e-24
WP_042562434.1|4119333_4119750_+	hypothetical protein	NA	G8C7U4	Escherichia_phage	55.5	2.8e-39
WP_158502691.1|4119746_4119911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562433.1|4119903_4120770_+	replication protein	NA	Q76H52	Enterobacteria_phage	51.9	1.1e-45
WP_042562432.1|4120771_4122109_+	AAA family ATPase	NA	A0A2I7S0U1	Vibrio_phage	39.0	3.5e-83
WP_042562431.1|4122124_4122400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562430.1|4122396_4122699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562429.1|4122695_4123169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562428.1|4123165_4123612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562427.1|4123615_4124065_+	DUF1367 family protein	NA	A0A096XEN2	Escherichia_phage	63.1	2.2e-53
WP_042562426.1|4124152_4124500_+	DUF2591 family protein	NA	R9U6T9	Vibrio_phage	52.8	4.0e-23
WP_042562425.1|4124601_4124892_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	76.8	5.7e-39
WP_042562424.1|4124888_4125251_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	65.0	2.5e-36
WP_042562423.1|4125247_4125853_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	40.8	7.4e-41
WP_042562422.1|4126258_4126582_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	62.2	6.6e-28
WP_038639772.1|4126699_4126900_+|holin	holin	holin	A0A1V0E5H9	Salmonella_phage	65.1	7.2e-17
WP_042562421.1|4126877_4127360_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	65.4	7.7e-57
WP_042562420.1|4127344_4127737_+	hypothetical protein	NA	U5P0U9	Shigella_phage	41.3	2.5e-13
WP_042562419.1|4128379_4129081_+	antirepressor	NA	G0ZND1	Cronobacter_phage	77.3	6.3e-100
WP_071841788.1|4129168_4129441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562418.1|4129566_4129998_+|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	82.5	3.1e-57
WP_042562417.1|4129981_4131280_+|terminase	terminase	terminase	A0A1V0E5Q3	Salmonella_phage	89.2	3.5e-229
WP_042562416.1|4131290_4132754_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	64.5	1.3e-168
WP_144404293.1|4132785_4133700_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.1	5.3e-115
WP_042562415.1|4133742_4135140_+	phage protein	NA	F1C5D9	Cronobacter_phage	63.0	8.3e-152
WP_042562414.1|4135143_4135584_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	64.4	1.3e-42
WP_042562413.1|4135594_4136671_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	75.1	8.6e-157
WP_042562412.1|4136680_4137046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562411.1|4137048_4137420_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	75.8	1.2e-46
WP_042562627.1|4137422_4137734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562410.1|4137730_4138072_+	hypothetical protein	NA	A0A1B1W262	Salmonella_phage	47.6	7.7e-19
WP_042562409.1|4138073_4138445_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	67.2	8.6e-40
WP_042562408.1|4138441_4138657_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	52.4	2.2e-11
WP_042562407.1|4138653_4139028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042562406.1|4139085_4139829_+	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	55.0	8.2e-58
WP_042562405.1|4139881_4140622_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	46.2	1.6e-53
WP_042562404.1|4140668_4143809_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	44.4	1.6e-179
WP_042562403.1|4143805_4144273_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	61.5	1.7e-56
WP_042562402.1|4144272_4144743_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	54.9	8.9e-42
WP_042562401.1|4144749_4145169_+	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	59.8	2.6e-45
WP_042562400.1|4145128_4147606_+	hypothetical protein	NA	F1C5A7	Cronobacter_phage	55.4	4.0e-266
WP_042562399.1|4147825_4148149_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	52.3	5.8e-16
WP_167335058.1|4148250_4148409_+	hypothetical protein	NA	A0A077KAX5	Edwardsiella_phage	67.3	2.3e-10
WP_042562626.1|4148482_4149385_+	antirepressor	NA	A5VW58	Enterobacteria_phage	76.9	1.8e-91
WP_042562398.1|4149460_4150165_+	Rha family transcriptional regulator	NA	A0A0P0ZDC0	Stx2-converting_phage	36.4	2.9e-36
WP_042562397.1|4150267_4150732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144404297.1|4150818_4151445_-	hypothetical protein	NA	Q0H8C7	Salmonella_phage	36.9	9.4e-31
WP_042562395.1|4151722_4151929_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_042562394.1|4152020_4152305_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	54.3	1.4e-05
WP_042562625.1|4152361_4152748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052488197.1|4152847_4155022_+	SGNH/GDSL hydrolase family protein	NA	C6ZR19	Salmonella_phage	40.0	5.0e-103
4155233:4155278	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAGCCCTGTAGGGCGTACCAT	NA	NA	NA	NA
