The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	0	6294	4523033		Bacillus_virus(66.67%)	6	NA	NA
WP_002211199.1|549_1164_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002211198.1|1325_2330_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.8	4.7e-08
WP_002211197.1|2384_3170_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_002228434.1|3166_3925_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	30.3	1.2e-16
WP_002227944.1|4000_4957_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_002228437.1|4977_6294_+	murein DD-endopeptidase MepM	NA	G3MBP9	Bacillus_virus	44.5	2.4e-15
>prophage 2
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	10861	118580	4523033	lysis,coat,tRNA,holin,tail,transposase	Escherichia_phage(14.81%)	109	NA	NA
WP_002211191.1|10861_12346_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.6	1.2e-79
WP_002211190.1|12587_13229_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002211188.1|13943_14387_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_002211187.1|14373_14703_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_002211186.1|14834_15179_-	RidA family protein	NA	NA	NA	NA	NA
WP_002211185.1|15309_17214_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.6	4.5e-92
WP_002211184.1|17285_17984_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002211183.1|18120_18726_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_087768167.1|18726_18834_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002220632.1|19368_21057_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
WP_002211181.1|21216_22338_+	ribonuclease D	NA	NA	NA	NA	NA
WP_002211180.1|22574_22844_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211179.1|22847_23660_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002220631.1|23684_24371_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211743.1|25091_25364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002232866.1|25659_26589_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211740.1|26659_27316_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002211739.1|27418_27865_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000255944.1|29198_30221_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_042468497.1|30220_31000_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_002215632.1|31167_31428_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_071525537.1|31727_32477_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_042666027.1|32452_32899_+	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	61.8	8.7e-47
WP_002211735.1|32972_33578_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002215636.1|33578_33968_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002215638.1|33971_34190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|34238_34802_+	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002211731.1|35225_35435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215644.1|35431_35707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071588306.1|36008_36149_+|holin	holin	holin	B6SD15	Bacteriophage	64.3	7.0e-11
WP_002211730.1|36179_36692_+	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002211729.1|36676_37135_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211727.1|37680_38394_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211725.1|38850_39486_+	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211724.1|39516_39966_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002209743.1|40600_41809_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211722.1|41813_42788_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	81.1	2.3e-153
WP_002228445.1|42787_43516_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002228446.1|43534_44176_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002211721.1|44176_45289_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002211720.1|45410_46184_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211719.1|46197_47403_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211718.1|47450_47933_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211717.1|47929_48184_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211716.1|48185_48536_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211715.1|48537_49122_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211714.1|49118_49526_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211713.1|49591_50512_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211712.1|50524_50836_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_071525538.1|50883_51144_+	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211711.1|51144_54648_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_002211710.1|54650_54992_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002211709.1|55165_55918_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_015683627.1|55920_56631_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.4	3.7e-108
WP_002211707.1|56891_57524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211706.1|57602_58034_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211705.1|58157_58325_+	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211704.1|58398_59406_+	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002214482.1|59504_60056_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211701.1|60198_60414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|60469_61090_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002359202.1|61264_61486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|61661_64865_+	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002211697.1|64864_65863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211696.1|65879_66797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097608205.1|66858_67227_+|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002209743.1|67447_68656_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002214492.1|68960_70133_-	MFS transporter	NA	NA	NA	NA	NA
WP_002211693.1|70136_71336_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002211692.1|71352_72093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214494.1|73184_73541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002227934.1|73957_74488_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002211689.1|74723_76298_-	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002211688.1|76541_77261_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211687.1|77478_79014_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211686.1|79479_80784_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002216508.1|80799_82002_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211685.1|82266_83136_-	pirin family protein	NA	NA	NA	NA	NA
WP_002211684.1|83333_84239_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211683.1|84273_85392_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002216501.1|85499_86774_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211681.1|86923_88858_-	protein kinase YeaG	NA	NA	NA	NA	NA
WP_162002345.1|89301_90051_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211679.1|90123_90999_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002224141.1|91312_92308_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211677.1|92655_93069_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002217933.1|93139_93412_+	YeaC family protein	NA	NA	NA	NA	NA
WP_002211676.1|93545_94193_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002211675.1|94207_95224_-	asparaginase	NA	NA	NA	NA	NA
WP_002211674.1|95340_97191_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211673.1|97353_97905_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_015683625.1|98129_99176_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002211670.1|99237_101163_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211669.1|101159_101450_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211668.1|101462_101849_-	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211667.1|101946_102753_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211665.1|103562_104423_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209743.1|105294_106503_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210667.1|106465_107335_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	5.5e-13
WP_002210666.1|107418_107883_-	YchJ family protein	NA	NA	NA	NA	NA
WP_002210665.1|109216_110233_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_016582239.1|110539_111886_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.0	4.3e-81
WP_002223593.1|112320_112728_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002210659.1|113477_114068_+	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	55.8	1.5e-54
WP_042665979.1|114436_115216_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_000255944.1|115215_116238_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215943.1|116644_117034_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_002210859.1|117143_117383_-	YebV family protein	NA	NA	NA	NA	NA
WP_002210858.1|117590_118580_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	129757	131830	4523033		Moraxella_phage(100.0%)	1	NA	NA
WP_002210848.1|129757_131830_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
>prophage 4
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	144247	151380	4523033		Sphingobium_phage(33.33%)	6	NA	NA
WP_002210839.1|144247_145099_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210838.1|145313_146705_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210837.1|146908_147457_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_002210836.1|147936_148647_-	porin	NA	NA	NA	NA	NA
WP_002210835.1|148944_150237_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210834.1|150252_151380_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
>prophage 5
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	155240	158872	4523033	transposase	Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
WP_002210830.1|155240_156002_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002210829.1|156093_156930_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210828.1|157265_157616_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015683622.1|157663_158872_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.1e-50
>prophage 6
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	163835	164726	4523033		Klosneuvirus(100.0%)	1	NA	NA
WP_002211843.1|163835_164726_-	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	27.5	2.9e-09
>prophage 7
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	168698	184564	4523033	tRNA	Tupanvirus(44.44%)	16	NA	NA
WP_002216696.1|168698_168911_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_002211836.1|169301_171230_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.1e-127
WP_002227898.1|171233_171785_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_002211834.1|171881_172079_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002211833.1|172116_172473_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152328947.1|172567_172615_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002211832.1|172971_173955_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
WP_002211831.1|173968_176356_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002211830.1|176360_176657_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_002211829.1|176990_177449_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002220283.1|177675_178683_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_002211827.1|178752_179307_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_002211826.1|179331_180090_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A1M7XV31	Cedratvirus	28.5	9.4e-09
WP_002211825.1|180439_181594_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.8	8.3e-33
WP_002211824.1|181580_182564_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.2	6.9e-36
WP_002211823.1|182560_184564_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	24.6	1.7e-17
>prophage 8
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	188130	196165	4523033		Bacillus_phage(33.33%)	5	NA	NA
WP_002216102.1|188130_188595_+	lipoprotein	NA	A0A217EQL1	Bacillus_phage	37.0	8.9e-10
WP_002211816.1|188719_189736_+	lipoate--protein ligase A	NA	NA	NA	NA	NA
WP_002211815.1|191419_192466_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	49.0	3.2e-84
WP_002211814.1|192622_193444_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002211813.1|193780_196165_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	4.1e-175
>prophage 9
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	202676	212252	4523033	transposase	Escherichia_phage(40.0%)	9	NA	NA
WP_002211809.1|202676_203048_+	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	35.6	1.1e-15
WP_002211808.1|203062_204574_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_002211807.1|204759_205506_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.3	1.9e-09
WP_002211806.1|205480_206806_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002211805.1|206802_208023_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.9	2.8e-87
WP_002211804.1|208111_208534_+	cysteine desulfuration protein SufE	NA	NA	NA	NA	NA
WP_002223648.1|208804_209869_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_001297096.1|210450_211230_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|211229_212252_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 10
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	217522	224756	4523033		Orpheovirus(20.0%)	8	NA	NA
WP_002210939.1|217522_218179_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	34.7	1.1e-21
WP_002210940.1|218229_219381_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	1.0e-83
WP_002210941.1|219860_221063_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.2	6.9e-14
WP_002210942.1|221352_222285_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071837007.1|222209_222422_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002216285.1|222755_222845_+	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_002210944.1|222948_223527_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.6	4.4e-43
WP_002210945.1|223904_224756_-	hydrolase	NA	A0A2H4PI41	Streptomyces_phage	43.9	2.8e-17
>prophage 11
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	238627	239902	4523033	tRNA	Pectobacterium_phage(100.0%)	1	NA	NA
WP_002210960.1|238627_239902_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.4	3.0e-84
>prophage 12
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	246998	248806	4523033		Planktothrix_phage(100.0%)	2	NA	NA
WP_002210969.1|246998_247814_-	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	30.9	6.5e-16
WP_002210970.1|247813_248806_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	25.3	8.8e-07
>prophage 13
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	269950	272167	4523033	tRNA	Moumouvirus(50.0%)	2	NA	NA
WP_002222427.1|269950_270919_-	alpha/beta hydrolase	NA	A0A2P1EM31	Moumouvirus	28.7	7.3e-14
WP_002210992.1|271225_272167_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	88.3	2.1e-130
>prophage 14
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	276845	279703	4523033		Bacillus_virus(50.0%)	4	NA	NA
WP_015683614.1|276845_277505_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	44.6	6.0e-20
WP_002227907.1|277789_278131_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_002214605.1|278188_278641_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_002210998.1|278710_279703_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	44.2	7.6e-67
>prophage 15
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	283455	291049	4523033		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_002211002.1|283455_284847_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	2.7e-46
WP_002211003.1|285056_286013_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002211004.1|286133_286739_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_002211005.1|287161_291049_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	31.4	4.0e-55
>prophage 16
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	301289	302567	4523033		Bacillus_phage(100.0%)	1	NA	NA
WP_002227911.1|301289_302567_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	27.9	3.4e-19
>prophage 17
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	312405	312924	4523033		Streptococcus_phage(100.0%)	1	NA	NA
WP_002211023.1|312405_312924_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.5	1.6e-23
>prophage 18
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	331060	331879	4523033		Bacillus_virus(100.0%)	1	NA	NA
WP_002223602.1|331060_331879_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.1	4.4e-36
>prophage 19
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	354275	355847	4523033		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002210588.1|354275_355847_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	4.1e-14
>prophage 20
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	360814	366407	4523033		Bacillus_phage(100.0%)	5	NA	NA
WP_002210593.1|360814_362953_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.4	3.7e-50
WP_002215882.1|362954_363323_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015683610.1|363322_364324_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_002228460.1|364348_364675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215879.1|364622_366407_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.9	9.6e-28
>prophage 21
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	378382	383813	4523033		Bodo_saltans_virus(50.0%)	4	NA	NA
WP_002210605.1|378382_380317_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	22.5	6.8e-11
WP_002220371.1|380666_382733_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_002210607.1|382725_383031_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_002215192.1|383147_383813_-	fructose-6-phosphate aldolase	NA	A0A1Z1LWE4	Synechococcus_phage	34.4	6.1e-28
>prophage 22
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	390928	391519	4523033		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002227926.1|390928_391519_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	8.0e-40
>prophage 23
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	397282	401733	4523033	protease	Catovirus(50.0%)	4	NA	NA
WP_002210622.1|397282_399898_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	34.1	1.4e-88
WP_002228458.1|399924_400224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210623.1|400316_400568_+	YciN family protein	NA	NA	NA	NA	NA
WP_002210624.1|400686_401733_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	1.6e-22
>prophage 24
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	408329	411352	4523033		Acinetobacter_phage(100.0%)	3	NA	NA
WP_002215981.1|408329_408908_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	37.3	7.4e-30
WP_002215980.1|408922_409921_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.7	7.7e-51
WP_002228453.1|409924_411352_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	38.6	1.9e-34
>prophage 25
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	416972	418055	4523033		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002215978.1|416972_418055_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.7	2.0e-12
>prophage 26
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	423172	423712	4523033		Salmonella_phage(100.0%)	1	NA	NA
WP_002210646.1|423172_423712_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	42.4	2.1e-26
>prophage 27
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	427782	429782	4523033		Planktothrix_phage(100.0%)	2	NA	NA
WP_002210651.1|427782_428784_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	4.7e-24
WP_002210652.1|428780_429782_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.2e-14
>prophage 28
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	439885	440665	4523033		Escherichia_phage(100.0%)	1	NA	NA
WP_001297096.1|439885_440665_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
>prophage 29
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	450566	458607	4523033		uncultured_Caudovirales_phage(40.0%)	7	NA	NA
WP_002210870.1|450566_451331_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	27.2	1.9e-09
WP_002210872.1|451901_452546_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_002210873.1|452555_452945_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.3	1.3e-06
WP_002210874.1|453045_454095_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	6.1e-06
WP_002214065.1|454094_454967_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_015683605.1|455139_456750_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.2	4.3e-11
WP_002210876.1|456933_458607_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	1.5e-11
>prophage 30
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	481511	482210	4523033		Bacillus_virus(100.0%)	1	NA	NA
WP_002210891.1|481511_482210_-	MgtC family protein	NA	G3MA03	Bacillus_virus	40.0	2.1e-15
>prophage 31
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	485658	489612	4523033		Morganella_phage(50.0%)	2	NA	NA
WP_002210893.1|485658_485871_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_015683601.1|486411_489612_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	61.9	0.0e+00
>prophage 32
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	494123	494327	4523033		Salmonella_phage(100.0%)	1	NA	NA
WP_002210902.1|494123_494327_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	44.6	9.8e-06
>prophage 33
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	498804	503483	4523033		Salmonella_phage(50.0%)	4	NA	NA
WP_002210907.1|498804_500385_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	50.7	2.5e-35
WP_002210908.1|500504_500765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210909.1|501040_502084_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002210910.1|502229_503483_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
>prophage 34
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	506725	508096	4523033		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_002210915.1|506725_508096_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	2.0e-110
>prophage 35
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	514251	518022	4523033		Vibrio_phage(50.0%)	3	NA	NA
WP_002210921.1|514251_515088_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	2.6e-20
WP_002210922.1|516070_517318_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_002210923.1|517317_518022_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	43.3	1.4e-35
>prophage 36
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	524040	525249	4523033	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_002209743.1|524040_525249_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 37
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	538232	538871	4523033		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002213082.1|538232_538871_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.1	4.6e-25
>prophage 38
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	543390	544515	4523033		Ralstonia_phage(50.0%)	2	NA	NA
WP_002220787.1|543390_543627_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.6	7.7e-10
WP_002210935.1|543780_544515_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	7.7e-16
>prophage 39
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	554368	559953	4523033	transposase	uncultured_virus(66.67%)	6	NA	NA
WP_002209743.1|554368_555577_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002213107.1|555853_556141_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_015683595.1|556375_557422_+	dihydroorotase	NA	NA	NA	NA	NA
WP_002213110.1|557734_557980_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	51.3	2.6e-13
WP_002217041.1|558485_558782_+	biofilm formation regulator BssS	NA	NA	NA	NA	NA
WP_002209743.1|558744_559953_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 40
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	574128	582117	4523033		Vibrio_phage(100.0%)	5	NA	NA
WP_002211867.1|574128_575133_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	41.2	3.3e-54
WP_002211868.1|575150_576101_-	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_002222491.1|576097_577444_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_002228501.1|577852_581140_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	29.8	1.0e-59
WP_002210191.1|581136_582117_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YUF3	Vibrio_phage	36.7	3.2e-49
>prophage 41
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	593990	596558	4523033		Bacillus_phage(50.0%)	2	NA	NA
WP_002210201.1|593990_595379_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	28.3	2.5e-31
WP_002210202.1|595478_596558_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.3	2.3e-24
>prophage 42
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	622093	623584	4523033		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002210222.1|622093_623584_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.6	6.3e-17
>prophage 43
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	629422	633312	4523033		Escherichia_phage(50.0%)	4	NA	NA
WP_002210229.1|629422_629947_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.0	5.5e-16
WP_015683588.1|630351_631239_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_002210231.1|631254_631752_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002210233.1|632808_633312_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.8	2.5e-05
>prophage 44
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	636759	640869	4523033		Planktothrix_phage(33.33%)	3	NA	NA
WP_002210237.1|636759_637482_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.9	5.0e-36
WP_015683587.1|637721_639008_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.3	3.0e-15
WP_001297096.1|640089_640869_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
>prophage 45
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	659301	660252	4523033		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002210257.1|659301_660252_-	2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	25.2	2.2e-15
>prophage 46
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	686998	690715	4523033		Salmonella_phage(50.0%)	4	NA	NA
WP_002210283.1|686998_687592_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	34.6	8.4e-05
WP_002216053.1|687638_687830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227880.1|687934_689767_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_002210285.1|690058_690715_-	sugar phosphatase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	25.1	1.2e-07
>prophage 47
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	698636	699845	4523033	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_002209743.1|698636_699845_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 48
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	704979	705777	4523033		Planktothrix_phage(100.0%)	1	NA	NA
WP_002209738.1|704979_705777_-	histidine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	33.5	7.1e-23
>prophage 49
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	709418	710936	4523033		Mollivirus(100.0%)	1	NA	NA
WP_002209733.1|709418_710936_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	5.0e-86
>prophage 50
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	716128	789541	4523033	tRNA,transposase,plate	Escherichia_phage(22.22%)	61	NA	NA
WP_032465663.1|716128_716959_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002209726.1|717009_718020_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002209725.1|718189_719317_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A285PXZ1	Cedratvirus	27.9	6.1e-20
WP_002209724.1|719363_720149_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002209722.1|720374_721292_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002209721.1|721576_722614_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_002209720.1|722955_723486_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002216161.1|724273_724969_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_002209717.1|725376_726600_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_002209716.1|726771_728841_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002209715.1|729018_729297_-	YfcL family protein	NA	NA	NA	NA	NA
WP_002209714.1|729354_729897_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002209713.1|729996_730803_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_002225365.1|730806_731634_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002209711.1|731639_732725_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.4	2.7e-89
WP_002209710.1|732801_733734_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002227846.1|734103_734634_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002209707.1|734987_735479_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_002209705.1|736047_738372_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002209704.1|738371_739682_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_002227845.1|739968_740265_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_002209702.1|740678_741944_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002209701.1|742050_742815_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_002209700.1|742850_744077_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002214855.1|744076_744589_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002209698.1|745147_747118_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002209697.1|747114_747609_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_002209696.1|747605_747908_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_002209695.1|747904_748642_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_002209694.1|748704_749364_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_002209693.1|749333_749990_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A1V0SE00	Indivirus	24.7	4.8e-09
WP_002209692.1|750434_750902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209691.1|751517_752060_+	LemA family protein	NA	NA	NA	NA	NA
WP_002209690.1|752064_754104_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_002209688.1|754479_754821_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002209687.1|754895_755243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209686.1|755267_755747_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002209685.1|755891_756698_-	ImpE family protein	NA	NA	NA	NA	NA
WP_002354537.1|756717_757560_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_002209684.1|757565_757826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011055427.1|757924_760510_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.1	3.3e-29
WP_002209681.1|764638_765475_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_001297096.1|765490_766270_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_042666058.1|766269_767292_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	2.0e-200
WP_002211571.1|767970_769320_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002211572.1|769323_769863_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211573.1|770136_770622_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211574.1|770947_772450_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211575.1|772473_772998_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211576.1|773102_773711_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211577.1|773695_774886_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_015683580.1|774910_776119_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	1.6e-50
WP_002215157.1|776140_777691_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211579.1|777818_778580_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002211580.1|778736_779282_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002215317.1|779482_782158_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211582.1|782940_784821_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211583.1|784820_785846_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211584.1|785944_787126_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002215319.1|787132_788164_+	fimbrial protein	NA	NA	NA	NA	NA
WP_002211586.1|788203_789541_+	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	32.8	2.0e-70
>prophage 51
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	798708	799758	4523033		Planktothrix_phage(100.0%)	1	NA	NA
WP_002211598.1|798708_799758_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-21
>prophage 52
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	803209	808121	4523033		Escherichia_phage(100.0%)	4	NA	NA
WP_002228420.1|803209_805636_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.3	6.9e-255
WP_002211603.1|805647_806265_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	1.1e-87
WP_002211604.1|806266_807043_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	41.4	3.9e-42
WP_002228419.1|807524_808121_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	49.2	9.2e-44
>prophage 53
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	811227	812278	4523033		Yersinia_phage(50.0%)	2	NA	NA
WP_002211610.1|811227_811659_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	2.4e-25
WP_002211611.1|811753_812278_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.1	9.3e-24
>prophage 54
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	827964	837908	4523033	transposase	Ralstonia_phage(25.0%)	9	NA	NA
WP_002213368.1|827964_829977_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.2	1.7e-142
WP_002227089.1|830067_831054_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_002213487.1|831302_832037_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002222180.1|832193_833162_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.8	4.8e-74
WP_002208488.1|833660_833918_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002208490.1|833966_835694_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.3	3.0e-18
WP_002208491.1|835742_836252_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002221590.1|836394_836829_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000255944.1|836885_837908_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 55
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	841331	844577	4523033		Dickeya_phage(50.0%)	2	NA	NA
WP_002208495.1|841331_842537_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	64.2	3.0e-25
WP_002208496.1|842540_844577_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	41.0	4.0e-38
>prophage 56
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	853127	859373	4523033		Pseudomonas_phage(25.0%)	5	NA	NA
WP_002208505.1|853127_854672_+	HAMP domain-containing histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	28.6	8.6e-09
WP_002224818.1|854668_855376_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	2.4e-35
WP_002208507.1|855755_856988_-	EspK/GogB family type III secretion system effector	NA	NA	NA	NA	NA
WP_002208508.1|857232_858111_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.3	1.0e-51
WP_002208509.1|858281_859373_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	1.1e-31
>prophage 57
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	862422	863955	4523033		Burkholderia_virus(100.0%)	1	NA	NA
WP_002208513.1|862422_863955_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.1	1.2e-07
>prophage 58
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	870407	872868	4523033		Pandoravirus(50.0%)	3	NA	NA
WP_002208519.1|870407_871307_-	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	33.2	1.6e-26
WP_002208521.1|871484_872096_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_002208522.1|872454_872868_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	40.9	3.0e-17
>prophage 59
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	897628	898699	4523033		Planktothrix_phage(100.0%)	1	NA	NA
WP_002208544.1|897628_898699_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	2.5e-31
>prophage 60
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	908987	909701	4523033		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002208555.1|908987_909701_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	34.8	2.9e-36
>prophage 61
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	918593	926608	4523033	transposase	uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_002208565.1|918593_918950_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.3	6.1e-19
WP_002228401.1|919161_919869_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002213775.1|920056_920515_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002209776.1|920690_921317_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002209777.1|921713_922757_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.3	9.1e-71
WP_002209778.1|922871_923510_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.4	3.1e-29
WP_002209779.1|923738_924284_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_002209780.1|925795_926608_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.8	1.3e-16
>prophage 62
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	941399	945844	4523033		Klosneuvirus(33.33%)	3	NA	NA
WP_002209789.1|941399_942689_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	2.1e-24
WP_002209790.1|942870_944376_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	31.7	4.0e-19
WP_002209791.1|944758_945844_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	8.4e-27
>prophage 63
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	956626	959490	4523033	tRNA	Bacillus_phage(50.0%)	3	NA	NA
WP_002209796.1|956626_957346_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.8	2.3e-33
WP_002209797.1|957482_957821_+	YegP family protein	NA	NA	NA	NA	NA
WP_002209798.1|958095_959490_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	81.4	1.5e-177
>prophage 64
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	965129	974306	4523033	transposase	uncultured_virus(33.33%)	9	NA	NA
WP_002209743.1|965129_966338_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002223532.1|966512_966827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228617.1|966910_967147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016256670.1|967287_967614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157131901.1|967660_967969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015683569.1|969055_970411_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.3	4.5e-54
WP_002220154.1|970801_971512_+	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_002220156.1|971563_972550_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_015683568.1|972563_974306_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.6	6.3e-24
>prophage 65
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	980131	983297	4523033		Feldmannia_irregularis_virus(50.0%)	2	NA	NA
WP_002220170.1|980131_981496_-	sigma 54-interacting transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.1	1.3e-05
WP_002220171.1|981482_983297_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.4	1.0e-16
>prophage 66
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	986320	991589	4523033	holin	Grouper_iridovirus(50.0%)	4	NA	NA
WP_002214195.1|986320_987184_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002214197.1|987529_988378_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002214199.1|988415_989309_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002228035.1|989540_991589_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
>prophage 67
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1000368	1001292	4523033		Streptococcus_phage(100.0%)	1	NA	NA
WP_002210769.1|1000368_1001292_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.8	3.7e-23
>prophage 68
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1005064	1005775	4523033		Planktothrix_phage(100.0%)	1	NA	NA
WP_002210766.1|1005064_1005775_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.3	3.5e-13
>prophage 69
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1009715	1014432	4523033		Klosneuvirus(50.0%)	4	NA	NA
WP_002220188.1|1009715_1010996_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	32.1	2.4e-17
WP_002210760.1|1011180_1012185_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_002210759.1|1012475_1013297_+	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_002210758.1|1013352_1014432_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.1	1.4e-21
>prophage 70
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1017487	1021389	4523033	protease	Cedratvirus(50.0%)	3	NA	NA
WP_002210753.1|1017487_1018978_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.8	2.8e-12
WP_002210751.1|1019194_1020013_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002210750.1|1020372_1021389_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.8	3.0e-79
>prophage 71
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1026570	1029850	4523033		Edwardsiella_phage(33.33%)	3	NA	NA
WP_002223549.1|1026570_1027623_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.7	1.3e-80
WP_002210743.1|1028071_1029010_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	42.0	1.2e-10
WP_002210742.1|1029124_1029850_-	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	28.6	8.7e-20
>prophage 72
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1041507	1042380	4523033		Tupanvirus(100.0%)	1	NA	NA
WP_002210729.1|1041507_1042380_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	34.7	3.6e-20
>prophage 73
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1058243	1124934	4523033	tRNA,transposase,protease,integrase	Escherichia_phage(18.75%)	61	1059136:1059195	1070202:1070286
WP_002210714.1|1058243_1058726_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	3.4e-28
1059136:1059195	attL	CCAAATGTTAAACCGGTTATTACCAGATAAGTCCGGTGAAGTACGGAAAGCCCGCATCCC	NA	NA	NA	NA
WP_002213759.1|1059360_1059819_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210713.1|1060042_1061242_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.2	2.2e-108
WP_002210712.1|1061320_1062409_+	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_002215945.1|1062459_1064130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215946.1|1064291_1064519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210710.1|1065326_1066214_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_002210709.1|1066206_1066407_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002215949.1|1066406_1066949_+	ash family protein	NA	NA	NA	NA	NA
WP_002215950.1|1066941_1067901_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
WP_002210707.1|1067897_1068986_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002210705.1|1069334_1069649_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002215951.1|1069654_1069972_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_000255944.1|1070576_1071599_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
1070202:1070286	attR	CCAAATGTTAAACCGGTTATTACCAGATAAGTCCGGTGAAGTACGGAAAGCCCGCATCCCTTCTAGGTTTGCGGGCTTTTTTGTG	NA	NA	NA	NA
WP_001297096.1|1071598_1072378_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210703.1|1072428_1072662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210701.1|1073000_1074485_+	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
WP_002210700.1|1074730_1075495_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.8	1.9e-41
WP_002210699.1|1075564_1076029_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	53.9	9.1e-47
WP_002210698.1|1076083_1076803_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002210697.1|1076847_1077603_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002228041.1|1077674_1079063_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.8	4.5e-09
WP_002220059.1|1079104_1079887_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_002210693.1|1080746_1081550_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SKP9	Klosneuvirus	29.2	3.6e-27
WP_002220061.1|1087254_1087440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220062.1|1087690_1088257_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_002212161.1|1088443_1089475_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	35.4	1.7e-32
WP_002212160.1|1089467_1090121_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_002212159.1|1090184_1091000_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_002212158.1|1091117_1091525_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_002212157.1|1091521_1092229_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_002212156.1|1092332_1094051_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002212155.1|1094165_1094849_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_002212154.1|1094933_1095350_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002212153.1|1095352_1095901_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_002212152.1|1096142_1096343_+	YaeP family protein	NA	NA	NA	NA	NA
WP_002218374.1|1096329_1096590_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_002212150.1|1096854_1097172_-	cytochrome c	NA	NA	NA	NA	NA
WP_002212149.1|1097408_1098791_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_002212148.1|1098792_1099191_-	VOC family protein	NA	NA	NA	NA	NA
WP_002212147.1|1099374_1100334_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_002228634.1|1100346_1103829_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.2	3.6e-204
WP_002212145.1|1103991_1104588_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	41.4	3.8e-29
WP_002212144.1|1104584_1105769_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_002212143.1|1105772_1106561_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_002217656.1|1106564_1107095_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002212141.1|1107252_1108275_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_002212140.1|1108278_1108776_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_002212139.1|1108933_1111321_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_002212138.1|1111357_1112713_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_002212137.1|1112741_1113590_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002212136.1|1113599_1114358_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	1.4e-23
WP_002212135.1|1114581_1115778_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_002212134.1|1115991_1116549_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002212133.1|1116684_1117410_-	UMP kinase	NA	NA	NA	NA	NA
WP_002212132.1|1117618_1118476_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002221800.1|1118603_1119329_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002212130.1|1119763_1120555_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002212129.1|1120614_1123296_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_002212128.1|1123470_1124295_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_002213775.1|1124475_1124934_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 74
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1129275	1132653	4523033		Vibrio_phage(50.0%)	3	NA	NA
WP_002212122.1|1129275_1130121_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.9	1.2e-41
WP_002212121.1|1130273_1131638_+	LOG family protein	NA	NA	NA	NA	NA
WP_002215970.1|1131897_1132653_+	flap endonuclease Xni	NA	A0A0N7ACJ6	Bacillus_phage	29.2	1.5e-14
>prophage 75
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1136140	1152292	4523033	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_002212116.1|1136140_1137346_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.5	6.0e-74
WP_002212115.1|1137480_1137924_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_002212114.1|1137959_1138787_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	30.8	2.5e-15
WP_002228046.1|1138929_1140102_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_002211623.1|1140823_1142074_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	30.3	4.2e-14
WP_002211624.1|1142309_1143635_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_002215834.1|1143789_1145748_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.5	7.0e-24
WP_002215833.1|1145744_1149407_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	23.0	3.4e-11
WP_002211626.1|1149403_1152292_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.7	5.1e-63
>prophage 76
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1158140	1158935	4523033		Cronobacter_phage(100.0%)	1	NA	NA
WP_002211384.1|1158140_1158935_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.9	8.9e-119
>prophage 77
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1192376	1194299	4523033		Vibrio_phage(100.0%)	1	NA	NA
WP_002220086.1|1192376_1194299_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	32.2	6.9e-32
>prophage 78
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1204930	1209228	4523033	transposase	Escherichia_phage(66.67%)	4	NA	NA
WP_001297096.1|1204930_1205710_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1205709_1206732_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_042666077.1|1206788_1207223_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_002209873.1|1207674_1209228_-	sulfatase	NA	A0A1V0SA98	Catovirus	26.1	5.4e-19
>prophage 79
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1219547	1220774	4523033		Erwinia_phage(100.0%)	1	NA	NA
WP_002209885.1|1219547_1220774_+	anaerobic sulfatase maturase	NA	A0A1B2IC15	Erwinia_phage	33.1	5.4e-06
>prophage 80
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1231471	1234760	4523033		Enterobacteria_phage(50.0%)	3	NA	NA
WP_002209894.1|1231471_1232545_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	43.6	2.9e-72
WP_002215759.1|1232816_1234076_+	maltoporin	NA	NA	NA	NA	NA
WP_002209896.1|1234448_1234760_-	PTS transporter subunit EIIB	NA	A0A2I7SAJ6	Vibrio_phage	39.2	3.3e-08
>prophage 81
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1242117	1245281	4523033		Bacillus_virus(50.0%)	2	NA	NA
WP_015683551.1|1242117_1243224_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	4.7e-25
WP_002209903.1|1243772_1245281_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	2.2e-09
>prophage 82
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1260184	1276651	4523033	tRNA,integrase	Enterobacteria_phage(25.0%)	18	1254697:1254711	1273562:1273576
1254697:1254711	attL	GCTGAGTTATCACTG	NA	NA	NA	NA
WP_002209918.1|1260184_1261327_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	22.6	2.9e-09
WP_002209919.1|1261595_1261961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002214792.1|1261973_1262210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002214791.1|1262215_1262548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209920.1|1262729_1262930_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209922.1|1263088_1263415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209923.1|1263714_1266006_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.5	7.2e-153
WP_002209924.1|1266405_1266804_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_002214787.1|1266803_1267100_-	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_002209925.1|1267263_1267626_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002214785.1|1267688_1267949_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	36.0	7.4e-06
WP_002209928.1|1268546_1268732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209929.1|1268813_1270028_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	58.8	2.8e-132
WP_002209930.1|1270460_1271978_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.0	1.1e-85
WP_002228062.1|1271987_1273086_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_002209931.1|1273264_1274998_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.7	3.6e-64
1273562:1273576	attR	CAGTGATAACTCAGC	NA	NA	NA	NA
WP_002209932.1|1275004_1275721_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_002209933.1|1275751_1276651_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	8.5e-33
>prophage 83
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1290004	1292884	4523033		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002209947.1|1290004_1292884_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.3	1.7e-268
>prophage 84
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1301876	1303118	4523033		Catovirus(100.0%)	1	NA	NA
WP_002209956.1|1301876_1303118_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	46.5	2.1e-98
>prophage 85
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1320278	1321433	4523033		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002209971.1|1320278_1321433_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
>prophage 86
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1326200	1328204	4523033		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_002209979.1|1326200_1327085_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209980.1|1327088_1328204_+	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
>prophage 87
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1351664	1356296	4523033		Acinetobacter_phage(50.0%)	3	NA	NA
WP_002209998.1|1351664_1353698_+	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209999.1|1353780_1354764_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210000.1|1354796_1356296_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
>prophage 88
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1362590	1363288	4523033	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_086016632.1|1362590_1363288_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
>prophage 89
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1371445	1376439	4523033		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_015683548.1|1371445_1373794_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	9.1e-18
WP_002210013.1|1373790_1376439_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
>prophage 90
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1404321	1405675	4523033	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_144405338.1|1404321_1405675_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.3	3.1e-55
>prophage 91
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1411372	1419009	4523033		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_002223678.1|1411372_1415425_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	49.6	1.7e-27
WP_002211401.1|1415438_1416758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211400.1|1416783_1419009_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.0	1.2e-27
>prophage 92
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1433700	1437223	4523033		Bacillus_phage(100.0%)	2	NA	NA
WP_002211394.1|1433700_1435458_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.0	6.7e-34
WP_002214927.1|1435450_1437223_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.6	7.8e-30
>prophage 93
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1447681	1457405	4523033	transposase	Tupanvirus(50.0%)	4	NA	NA
WP_071882607.1|1447681_1448929_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	27.1	7.1e-30
WP_144405340.1|1448889_1455588_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.0	8.8e-42
WP_001297096.1|1455603_1456383_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1456382_1457405_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 94
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1460543	1468316	4523033		Staphylococcus_phage(50.0%)	4	NA	NA
WP_015683540.1|1460543_1462502_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	38.0	1.0e-86
WP_002209033.1|1463357_1464674_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_002209034.1|1464851_1465484_-	two component system response regulator	NA	NA	NA	NA	NA
WP_002209035.1|1465496_1468316_-	two component system sensor kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	28.2	6.3e-34
>prophage 95
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1489017	1489818	4523033		Pithovirus(100.0%)	1	NA	NA
WP_002209058.1|1489017_1489818_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.5	1.9e-15
>prophage 96
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1501087	1510175	4523033	protease	Acinetobacter_phage(33.33%)	10	NA	NA
WP_002209070.1|1501087_1502167_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	36.1	3.7e-43
WP_002209071.1|1502159_1502972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209072.1|1502964_1504101_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.3	4.8e-33
WP_002209073.1|1504112_1505174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228131.1|1505449_1506043_+	tellurium resistance protein TerZ	NA	A0A2L1IWC0	Streptomyces_phage	34.5	1.2e-11
WP_002209075.1|1506042_1507227_+	tellurite resistance protein	NA	NA	NA	NA	NA
WP_002209076.1|1507259_1507715_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_002209077.1|1507736_1508774_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	48.8	2.9e-77
WP_002209078.1|1508837_1509416_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.5	4.9e-34
WP_002209079.1|1509599_1510175_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.0	1.6e-29
>prophage 97
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1530629	1531238	4523033		Lactococcus_phage(100.0%)	1	NA	NA
WP_015683538.1|1530629_1531238_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	39.8	7.8e-14
>prophage 98
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1535599	1544389	4523033		Salmonella_phage(25.0%)	6	NA	NA
WP_002209095.1|1535599_1537006_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	75.4	2.8e-192
WP_002209096.1|1537102_1538182_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.0	1.7e-27
WP_002209097.1|1538367_1539561_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002209098.1|1540087_1540447_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_002209099.1|1540539_1543383_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	1.3e-308
WP_002209100.1|1543840_1544389_+	single-stranded DNA-binding protein SSB1	NA	A0A291LCB6	Klebsiella_phage	90.1	1.1e-54
>prophage 99
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1554017	1557425	4523033		Escherichia_phage(50.0%)	2	NA	NA
WP_002209112.1|1554017_1554443_-	subtilase	NA	A0A0U2KD34	Escherichia_phage	50.0	6.0e-29
WP_002209115.1|1554869_1557425_+	viral enhancin protein	NA	A0A068LKB3	Peridroma_alphabaculovirus	23.2	5.4e-40
>prophage 100
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1570343	1572330	4523033		uncultured_virus(50.0%)	2	NA	NA
WP_002209127.1|1570343_1570637_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	36.8	3.3e-10
WP_002209128.1|1570683_1572330_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	66.9	1.6e-183
>prophage 101
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1577501	1579325	4523033		Lactobacillus_phage(100.0%)	1	NA	NA
WP_002209137.1|1577501_1579325_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.6	1.0e-16
>prophage 102
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1586598	1587144	4523033		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_002209143.1|1586598_1587144_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.1	3.8e-28
>prophage 103
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1591492	1660978	4523033	tRNA,transposase,protease	Bacillus_phage(18.75%)	64	NA	NA
WP_002232017.1|1591492_1593406_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	M1HNA7	Bacillus_virus	28.2	2.1e-28
WP_015683535.1|1593421_1595335_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.1	1.4e-56
WP_002209149.1|1595327_1596269_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002209151.1|1596384_1596690_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_002209152.1|1596788_1598075_+	GTPase HflX	NA	NA	NA	NA	NA
WP_002209154.1|1598315_1599575_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_002209155.1|1599578_1600583_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_002217227.1|1600754_1600955_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_002209157.1|1601054_1602353_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.4	1.3e-66
WP_002217229.1|1602721_1603147_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_002209159.1|1603387_1605922_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	2.5e-66
WP_002209161.1|1606040_1606781_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_002353634.1|1607200_1608832_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_002215294.1|1608903_1609215_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_144405345.1|1609399_1609480_+	phospholipase	NA	NA	NA	NA	NA
WP_000255944.1|1610332_1611355_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002210152.1|1611411_1612113_+	esterase	NA	NA	NA	NA	NA
WP_002210153.1|1612479_1612872_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002430134.1|1612880_1613198_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_002210155.1|1613202_1613430_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002210156.1|1613469_1613922_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_002213775.1|1614117_1614576_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210157.1|1614697_1615153_-	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002210158.1|1615292_1616033_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_002228198.1|1616375_1616996_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002210159.1|1617093_1617759_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_002210160.1|1617913_1619884_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_002220539.1|1620318_1621059_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_002210162.1|1621061_1621625_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_002210163.1|1621960_1622173_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_015683534.1|1622280_1623612_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002210165.1|1623889_1624528_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002210166.1|1624802_1626539_+	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_002210168.1|1630454_1630811_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002210169.1|1630928_1631456_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	9.3e-56
WP_002216946.1|1631655_1632669_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	45.8	3.0e-71
WP_002210171.1|1632839_1634222_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210172.1|1634517_1634781_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002210173.1|1635169_1635640_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002210174.1|1636103_1637042_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002210175.1|1637475_1637751_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	1.1e-18
WP_002210176.1|1637933_1638281_+	putative DNA-binding transcriptional regulator	NA	A0A0M3LPN5	Mannheimia_phage	45.2	7.3e-09
WP_002210177.1|1638377_1639349_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	27.6	6.0e-08
WP_002210178.1|1639608_1639920_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002210179.1|1639939_1640197_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002210180.1|1640284_1641271_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002210181.1|1641271_1642444_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_002210182.1|1642538_1643606_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	21.9	4.7e-06
WP_002210183.1|1643602_1644265_-	two-component system response regulator PmrA	NA	W8CYM9	Bacillus_phage	35.5	8.4e-30
WP_015683533.1|1644270_1645719_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_002210184.1|1645975_1646452_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002210185.1|1646579_1646873_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_002228196.1|1647019_1647649_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_002228195.1|1647705_1649640_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	44.5	4.4e-119
WP_015683532.1|1649759_1650593_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.9	1.1e-18
WP_002210189.1|1650602_1651943_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_002210190.1|1652165_1652501_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_002222054.1|1653032_1653485_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002209253.1|1653506_1654994_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002223151.1|1655018_1657697_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	2.3e-25
WP_002209255.1|1657762_1658173_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002209256.1|1658172_1659147_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002209257.1|1659268_1659538_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_100067904.1|1659624_1660978_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
>prophage 104
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1671933	1683051	4523033		Escherichia_phage(100.0%)	1	NA	NA
WP_042593566.1|1671933_1683051_+	autotransporter adhesin YapH	NA	A0A2L1IV18	Escherichia_phage	37.8	1.6e-133
>prophage 105
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1690850	1692083	4523033		Brevibacillus_phage(100.0%)	1	NA	NA
WP_002211633.1|1690850_1692083_+	peptidase T	NA	A0A0K2CPK3	Brevibacillus_phage	39.1	1.2e-05
>prophage 106
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1698120	1772713	4523033	transposase	Escherichia_phage(33.33%)	58	NA	NA
WP_000255944.1|1698120_1699143_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|1699142_1699922_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_086016626.1|1700593_1701693_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	2.2e-46
WP_002218887.1|1707363_1707549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210692.1|1708016_1709606_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.2e-68
WP_002210691.1|1709665_1710952_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002355296.1|1711099_1711753_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210689.1|1711802_1712078_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
WP_002210688.1|1712266_1712857_-	YjaG family protein	NA	NA	NA	NA	NA
WP_002210687.1|1712902_1713643_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_002210686.1|1713672_1714740_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_002210685.1|1714858_1715644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210684.1|1715736_1716519_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_002210683.1|1716615_1717125_+	sigma D regulator	NA	NA	NA	NA	NA
WP_002210682.1|1717500_1719546_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_002210681.1|1719532_1720207_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_002210680.1|1720196_1720994_+	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.8	1.6e-11
WP_002217275.1|1720990_1721206_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_002228257.1|1721207_1722023_+	thiazole synthase	NA	NA	NA	NA	NA
WP_002210678.1|1722015_1723146_+	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002213775.1|1723577_1724036_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210677.1|1724162_1728383_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
WP_015683531.1|1728511_1732540_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
WP_002210675.1|1732882_1733251_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002210674.1|1733317_1733815_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002210673.1|1734179_1734884_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002210672.1|1734887_1735316_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002210671.1|1735506_1736052_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
WP_002210670.1|1736053_1736437_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002210669.1|1736687_1737872_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
WP_071882713.1|1738928_1739708_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
WP_042666093.1|1739707_1740730_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	7.0e-201
WP_002217850.1|1740819_1741371_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002212290.1|1741581_1742532_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.2	8.7e-28
WP_002212289.1|1742566_1743526_-	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_002212288.1|1743522_1744560_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_002218887.1|1750226_1750412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215920.1|1750695_1751229_-	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_002211550.1|1751250_1752702_-	Trk system potassium transporter TrkH	NA	NA	NA	NA	NA
WP_002213759.1|1753290_1753749_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211548.1|1753853_1754063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211547.1|1754062_1755394_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_015683529.1|1755720_1757910_+	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
WP_002211545.1|1757921_1759085_+	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
WP_002215918.1|1759244_1759946_-	NAD(P)H-flavin reductase	NA	NA	NA	NA	NA
WP_002215917.1|1760000_1761497_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_002211542.1|1761744_1762233_+	transcription/translation regulatory transformer protein RfaH	NA	NA	NA	NA	NA
WP_002211541.1|1762342_1763365_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_002211540.1|1763379_1763715_-	deoxyribonuclease	NA	NA	NA	NA	NA
WP_001297096.1|1763753_1764533_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1764532_1765555_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_015683528.1|1766176_1766953_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.9	1.6e-27
WP_002211537.1|1766955_1767618_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_002211536.1|1767621_1767888_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_002211535.1|1768067_1769699_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.1	5.3e-41
WP_002215928.1|1769698_1770349_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_002224024.1|1770362_1771118_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_002211532.1|1771207_1772713_-	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	61.8	1.4e-08
>prophage 107
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1784496	1786316	4523033		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_002211524.1|1784496_1785246_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	26.5	8.1e-13
WP_002211523.1|1785242_1786316_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	8.9e-21
>prophage 108
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1797191	1798705	4523033		Planktothrix_phage(50.0%)	2	NA	NA
WP_002211512.1|1797191_1797893_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.6	1.7e-12
WP_002211511.1|1797937_1798705_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	23.9	8.3e-13
>prophage 109
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1803938	1806718	4523033		Salicola_phage(50.0%)	3	NA	NA
WP_002211506.1|1803938_1804796_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.0	4.6e-44
WP_002211505.1|1805106_1806060_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_002211504.1|1806049_1806718_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.6	8.8e-27
>prophage 110
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1811009	1815721	4523033		Dickeya_phage(66.67%)	3	NA	NA
WP_002211498.1|1811009_1811636_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	63.7	1.2e-30
WP_002215973.1|1814514_1814769_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	91.7	2.0e-11
WP_002211495.1|1815052_1815721_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	56.4	6.3e-57
>prophage 111
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1821375	1822491	4523033		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002211490.1|1821375_1822491_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	4.8e-09
>prophage 112
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1827491	1829324	4523033		Catovirus(100.0%)	1	NA	NA
WP_002211484.1|1827491_1829324_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	36.8	2.4e-82
>prophage 113
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1836945	1840837	4523033		Bacillus_phage(50.0%)	3	NA	NA
WP_002211475.1|1836945_1839108_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.1	9.3e-118
WP_002211474.1|1839209_1839926_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_002211473.1|1839925_1840837_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	31.2	4.6e-18
>prophage 114
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1859173	1865650	4523033		Enterobacteria_phage(40.0%)	6	NA	NA
WP_002211981.1|1859173_1860304_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	35.5	7.9e-20
WP_002211982.1|1860305_1861043_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_002211983.1|1861020_1861902_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.6	1.3e-105
WP_002211984.1|1862196_1863264_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	9.6e-100
WP_002211985.1|1863260_1864523_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	26.3	4.7e-21
WP_002211986.1|1864519_1865650_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	28.4	2.0e-31
>prophage 115
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1870398	1878638	4523033	transposase	Indivirus(25.0%)	7	NA	NA
WP_002211990.1|1870398_1870725_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	42.1	1.9e-14
WP_002228177.1|1870843_1872130_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.1	6.4e-34
WP_002211993.1|1873796_1875818_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	3.8e-113
WP_002215828.1|1875816_1876002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211995.1|1876021_1876303_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002211996.1|1876541_1877333_+	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_002209743.1|1877429_1878638_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 116
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1900286	1901933	4523033		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_002212017.1|1900286_1901933_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.7	3.1e-65
>prophage 117
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1907683	1909174	4523033		Planktothrix_phage(100.0%)	1	NA	NA
WP_002212023.1|1907683_1909174_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.0	2.6e-10
>prophage 118
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1917882	1919760	4523033		Acinetobacter_phage(100.0%)	1	NA	NA
WP_002228170.1|1917882_1919760_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	24.8	1.3e-11
>prophage 119
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1925196	1925928	4523033		Synechococcus_phage(100.0%)	1	NA	NA
WP_002209479.1|1925196_1925928_+	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	58.5	1.3e-47
>prophage 120
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1929873	1931682	4523033		Bacillus_phage(100.0%)	1	NA	NA
WP_002209483.1|1929873_1931682_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	31.2	3.5e-25
>prophage 121
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1944428	1945782	4523033	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_100067904.1|1944428_1945782_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
>prophage 122
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1958359	1959691	4523033		Erwinia_phage(100.0%)	1	NA	NA
WP_002208943.1|1958359_1959691_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.8	1.2e-43
>prophage 123
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1964538	1966653	4523033		Bacillus_phage(100.0%)	1	NA	NA
WP_002223915.1|1964538_1966653_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
>prophage 124
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1985284	1989655	4523033	transposase	Sodalis_phage(33.33%)	5	NA	NA
WP_002353252.1|1985284_1986205_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	8.6e-73
WP_002221684.1|1986288_1986465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208969.1|1986921_1987410_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_002208970.1|1987583_1988282_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.8e-06
WP_002208971.1|1988278_1989655_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.4	1.5e-17
>prophage 125
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	1994237	2002883	4523033		Rhizobium_phage(20.0%)	7	NA	NA
WP_002208977.1|1994237_1994486_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	50.0	5.4e-14
WP_002208978.1|1994604_1995039_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002208979.1|1995435_1996983_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002208980.1|1996992_1998363_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	35.7	2.4e-10
WP_002208981.1|1999458_2000484_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	8.0e-19
WP_002208982.1|2000493_2001705_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	27.6	4.6e-34
WP_002208983.1|2001950_2002883_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	36.6	1.3e-31
>prophage 126
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2007419	2011990	4523033		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_002208988.1|2007419_2007899_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.7	1.0e-29
WP_002208989.1|2007904_2008714_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	32.7	6.7e-21
WP_002208990.1|2008796_2008964_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002208991.1|2008975_2009212_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002208992.1|2009474_2010143_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_002208993.1|2010336_2011554_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	9.1e-46
WP_011566231.1|2011531_2011990_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	61.5	6.0e-51
>prophage 127
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2016401	2021587	4523033		Vibrio_phage(33.33%)	4	NA	NA
WP_002215674.1|2016401_2018105_-	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.9	1.2e-19
WP_002209000.1|2018505_2019129_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.7	2.4e-18
WP_002209001.1|2019183_2019459_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002209002.1|2019478_2021587_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	3.7e-10
>prophage 128
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2026184	2027570	4523033		environmental_Halophage(100.0%)	1	NA	NA
WP_002209006.1|2026184_2027570_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	80.0	3.8e-56
>prophage 129
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2030754	2038378	4523033	tRNA,transposase	Escherichia_phage(33.33%)	9	NA	NA
WP_000255944.1|2030754_2031777_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215709.1|2032668_2033154_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002209026.1|2033208_2034030_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002209025.1|2034038_2034611_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	30.2	4.9e-10
WP_002228134.1|2034612_2035152_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_002209023.1|2035192_2035666_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_002209022.1|2035637_2036759_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002209021.1|2036893_2037406_+	peptide deformylase	NA	NA	NA	NA	NA
WP_002209020.1|2037430_2038378_+|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	29.8	1.2e-05
>prophage 130
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2058702	2062068	4523033		Tupanvirus(50.0%)	2	NA	NA
WP_002212326.1|2058702_2059887_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.0e-13
WP_014501251.1|2059959_2062068_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.7	1.3e-60
>prophage 131
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2072420	2076959	4523033		Catovirus(50.0%)	5	NA	NA
WP_002212312.1|2072420_2073410_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	30.6	4.7e-08
WP_002212311.1|2073502_2074483_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_002212310.1|2074495_2075344_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_002212309.1|2075340_2076195_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_002212307.1|2076191_2076959_-	taurine ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	35.6	1.6e-35
>prophage 132
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2083308	2090259	4523033		environmental_Halophage(20.0%)	5	NA	NA
WP_002212296.1|2083308_2085429_+	membrane protein	NA	H9YQA8	environmental_Halophage	64.5	6.0e-45
WP_002212295.1|2085654_2086872_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	4.5e-29
WP_002223842.1|2087004_2087580_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	3.0e-68
WP_002215686.1|2087822_2089364_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	44.5	6.9e-83
WP_002208878.1|2089689_2090259_-	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	32.3	1.7e-07
>prophage 133
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2107122	2107938	4523033		Vibrio_phage(100.0%)	1	NA	NA
WP_002208895.1|2107122_2107938_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.5	9.0e-66
>prophage 134
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2111279	2112782	4523033		Vibrio_phage(100.0%)	1	NA	NA
WP_002208900.1|2111279_2112782_-	DNA uptake porin HofQ	NA	R9TEZ5	Vibrio_phage	22.3	1.3e-14
>prophage 135
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2123890	2127713	4523033		Bacillus_phage(66.67%)	3	NA	NA
WP_002208912.1|2123890_2125510_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.0	2.1e-138
WP_002208913.1|2125644_2126997_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.1	1.6e-11
WP_002208914.1|2126993_2127713_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	2.7e-29
>prophage 136
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2139937	2141962	4523033		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_002430067.1|2139937_2141962_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.1	3.4e-13
>prophage 137
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2147914	2151812	4523033	transposase	Escherichia_phage(66.67%)	3	NA	NA
WP_100067904.1|2147914_2149268_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_001297096.1|2150010_2150790_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2150789_2151812_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 138
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2159273	2160383	4523033		Planktothrix_phage(100.0%)	1	NA	NA
WP_002212091.1|2159273_2160383_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	G9BWD6	Planktothrix_phage	35.5	5.0e-27
>prophage 139
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2176503	2180199	4523033		Dickeya_phage(100.0%)	1	NA	NA
WP_002212080.1|2176503_2180199_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	82.5	4.6e-24
>prophage 140
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2198360	2204617	4523033		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_002212253.1|2198360_2200229_-	low affinity potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	30.5	5.8e-68
WP_002212254.1|2200502_2202056_+	ATPase RavA	NA	A0A0N9NIH9	Sulfolobus_monocaudavirus	32.4	1.6e-18
WP_002212255.1|2202059_2203526_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_002212256.1|2203624_2204617_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	36.0	2.2e-50
>prophage 141
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2217183	2232090	4523033		Tupanvirus(16.67%)	14	NA	NA
WP_002215550.1|2217183_2218554_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	33.5	6.0e-30
WP_002215552.1|2218754_2220584_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	43.0	1.9e-132
WP_002215557.1|2221066_2222107_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	38.2	5.7e-49
WP_002215558.1|2222335_2223292_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_002215560.1|2223293_2224181_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002215562.1|2224261_2225038_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.6	6.7e-18
WP_002220747.1|2225125_2225848_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002228151.1|2226143_2226815_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_002215568.1|2227034_2227889_+	ABC transporter substrate-binding protein	NA	A0A140XBD5	Dickeya_phage	81.6	1.9e-10
WP_002215571.1|2228071_2228809_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002215573.1|2228810_2229566_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002215575.1|2229600_2230269_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_071525562.1|2230343_2230442_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002215577.1|2230761_2232090_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.1	4.7e-64
>prophage 142
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2241436	2248999	4523033	transposase	Rhizobium_phage(33.33%)	6	NA	NA
WP_002209645.1|2241436_2242537_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	36.8	1.1e-53
WP_002218418.1|2242540_2242711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209643.1|2242709_2243795_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_002209642.1|2243814_2246229_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.0	2.4e-114
WP_002209641.1|2246444_2247254_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_100067904.1|2247644_2248999_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
>prophage 143
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2252683	2253842	4523033		Cyanophage(50.0%)	2	NA	NA
WP_002209636.1|2252683_2253097_+	heat shock chaperone IbpA	NA	A0A127KM93	Cyanophage	36.8	7.1e-19
WP_002209635.1|2253377_2253842_+	heat shock chaperone IbpB	NA	A0A0E3FB97	Synechococcus_phage	32.2	3.3e-12
>prophage 144
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2260915	2264662	4523033		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_002223788.1|2260915_2261896_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	25.4	7.1e-17
WP_002209629.1|2262414_2263059_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002209628.1|2263189_2263849_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_002209627.1|2264206_2264662_-	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	32.2	1.4e-15
>prophage 145
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2278982	2279606	4523033		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_002209614.1|2278982_2279606_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.4	2.4e-63
>prophage 146
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2288262	2288526	4523033		Tupanvirus(100.0%)	1	NA	NA
WP_031334614.1|2288262_2288526_+	hypothetical protein	NA	A0A2K9KZ60	Tupanvirus	31.0	5.2e-07
>prophage 147
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2294312	2295667	4523033	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_100067904.1|2294312_2295667_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
>prophage 148
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2307573	2321094	4523033	integrase	Enterobacteria_phage(33.33%)	13	2300897:2300912	2329643:2329658
2300897:2300912	attL	GCCTGACGTATTTGGC	NA	NA	NA	NA
WP_002209590.1|2307573_2309106_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.5e-17
WP_002209589.1|2309092_2310277_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002209588.1|2310366_2311560_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015683793.1|2311945_2313139_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	80.3	2.7e-183
WP_002209586.1|2313125_2314505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002214358.1|2314772_2315018_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	52.6	3.5e-13
WP_002209585.1|2316162_2316525_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072085081.1|2317294_2317468_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002214362.1|2317464_2317650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002214364.1|2317885_2318386_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	49.4	1.0e-35
WP_015683792.1|2318382_2319141_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.7	7.2e-17
WP_002209583.1|2319137_2320145_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002209582.1|2320134_2321094_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	39.3	2.7e-61
2329643:2329658	attR	GCCAAATACGTCAGGC	NA	NA	NA	NA
>prophage 149
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2328759	2330292	4523033		Catovirus(100.0%)	1	NA	NA
WP_002209575.1|2328759_2330292_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.1	1.1e-83
>prophage 150
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2341138	2342530	4523033		Moraxella_phage(100.0%)	1	NA	NA
WP_002224153.1|2341138_2342530_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	28.4	3.0e-21
>prophage 151
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2348905	2350959	4523033		Planktothrix_phage(100.0%)	2	NA	NA
WP_002209562.1|2348905_2349886_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	3.0e-15
WP_161597821.1|2349918_2350959_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	4.3e-20
>prophage 152
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2375222	2376359	4523033		Streptococcus_phage(100.0%)	1	NA	NA
WP_002209537.1|2375222_2376359_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.4	1.2e-44
>prophage 153
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2396125	2397649	4523033		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002209523.1|2396125_2397649_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	6.5e-17
>prophage 154
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2427503	2429201	4523033		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002209502.1|2427503_2429201_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	67.9	3.0e-204
>prophage 155
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2436985	2439433	4523033		Dickeya_phage(100.0%)	1	NA	NA
WP_002209497.1|2436985_2439433_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	84.5	1.2e-33
>prophage 156
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2443444	2444799	4523033	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_100067904.1|2443444_2444799_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
>prophage 157
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2450757	2453361	4523033		Agrobacterium_phage(100.0%)	1	NA	NA
WP_002212107.1|2450757_2453361_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.5	6.4e-89
>prophage 158
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2461255	2468462	4523033		Ralstonia_phage(50.0%)	3	NA	NA
WP_002210020.1|2461255_2463454_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	2.6e-27
WP_002213861.1|2463456_2463879_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_002210022.1|2463923_2468462_+	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	35.2	3.2e-27
>prophage 159
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2479389	2482836	4523033		Bacillus_virus(50.0%)	3	NA	NA
WP_002210036.1|2479389_2480205_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.2	2.6e-28
WP_002210038.1|2480823_2481027_-	DNA-damage-inducible protein J	NA	NA	NA	NA	NA
WP_002210039.1|2481480_2482836_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	74.0	4.1e-164
>prophage 160
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2486390	2490794	4523033		Morganella_phage(50.0%)	3	NA	NA
WP_002210042.1|2486390_2487311_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	6.8e-78
WP_002210043.1|2488104_2489094_+	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210044.1|2489297_2490794_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.7	1.1e-13
>prophage 161
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2499957	2500642	4523033		Morganella_phage(100.0%)	2	NA	NA
WP_002210052.1|2499957_2500170_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	9.9e-25
WP_002210053.1|2500429_2500642_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	80.0	4.4e-25
>prophage 162
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2504611	2505976	4523033		Burkholderia_virus(100.0%)	1	NA	NA
WP_002210058.1|2504611_2505976_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	25.8	1.0e-13
>prophage 163
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2522171	2523215	4523033		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002228205.1|2522171_2523215_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.0e-06
>prophage 164
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2531859	2594295	4523033	protease,transposase,tail	uncultured_Mediterranean_phage(18.18%)	55	NA	NA
WP_002210082.1|2531859_2533305_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002210083.1|2533507_2536366_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210084.1|2536390_2539222_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210086.1|2539422_2539782_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_002210087.1|2539778_2540180_-	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	61.0	3.6e-36
WP_002214300.1|2540192_2540495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210089.1|2540628_2545119_-	toxin	NA	NA	NA	NA	NA
WP_002220204.1|2545175_2548769_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002210090.1|2548809_2551311_-	toxin	NA	NA	NA	NA	NA
WP_002214297.1|2551546_2552413_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210092.1|2552673_2553585_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002210093.1|2553887_2554091_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002210094.1|2554098_2555034_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210095.1|2555035_2556991_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002214288.1|2558920_2559394_+	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210098.1|2559398_2559680_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002210099.1|2559791_2560340_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210100.1|2560520_2561861_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011055205.1|2562109_2562754_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210102.1|2562961_2563348_+	cytochrome b562	NA	NA	NA	NA	NA
WP_002210103.1|2563579_2563990_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210104.1|2564342_2566010_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002215779.1|2566104_2567520_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210106.1|2567930_2568884_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002210107.1|2569117_2569594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210109.1|2569892_2570279_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210110.1|2570416_2570881_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210111.1|2570892_2571828_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210112.1|2572165_2572438_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210113.1|2572434_2573289_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002213952.1|2573594_2574077_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210115.1|2574505_2575939_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002210116.1|2576000_2576726_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210117.1|2576732_2577278_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002218352.1|2577261_2577825_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002228203.1|2577821_2578385_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002210119.1|2578633_2579620_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002210120.1|2579730_2580705_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210121.1|2580969_2581788_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210122.1|2582005_2582788_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210123.1|2582792_2583350_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210124.1|2583362_2583986_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210125.1|2584021_2584324_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210126.1|2584470_2584725_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210127.1|2584878_2586141_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210128.1|2586321_2587410_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002213775.1|2587635_2588094_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002218066.1|2588210_2589584_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002210130.1|2589854_2590259_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002210131.1|2590482_2591610_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210132.1|2591923_2592352_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210133.1|2592366_2592759_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002230558.1|2592755_2592953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015683774.1|2593132_2593774_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002216203.1|2593779_2594295_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
>prophage 165
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2603268	2612248	4523033		Hokovirus(33.33%)	8	NA	NA
WP_002210142.1|2603268_2605605_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.4	9.9e-41
WP_002210143.1|2605846_2606500_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002210144.1|2606496_2607222_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_002210145.1|2607428_2608004_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_002210146.1|2608014_2608605_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	32.0	3.2e-12
WP_002210147.1|2608875_2609229_-	YraN family protein	NA	NA	NA	NA	NA
WP_002228200.1|2609312_2611286_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_002210149.1|2611348_2612248_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.4	1.0e-49
>prophage 166
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2616792	2656719	4523033	tRNA,transposase,plate	Escherichia_phage(33.33%)	29	NA	NA
WP_000255944.1|2616792_2617815_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_042468859.1|2618279_2618465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220999.1|2624111_2625320_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002217538.1|2625377_2625908_-	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_015683770.1|2625907_2626495_-	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_002213170.1|2626648_2626918_+	YihD family protein	NA	NA	NA	NA	NA
WP_002213169.1|2627008_2627995_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_002213168.1|2628022_2628646_+	thiol:disulfide interchange protein DsbA	NA	NA	NA	NA	NA
WP_002213164.1|2629137_2631936_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.8	2.7e-69
WP_002213759.1|2632344_2632803_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002213775.1|2633054_2633513_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213160.1|2633764_2634415_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002213158.1|2635159_2635726_+	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_015683769.1|2635908_2637279_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_002213152.1|2637332_2638745_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	25.6	3.1e-05
WP_002213151.1|2638752_2639802_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.2	4.2e-07
WP_002213150.1|2640054_2641464_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_002217380.1|2642025_2643849_+	ribosome-dependent GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	42.3	1.2e-20
WP_002209011.1|2644170_2644761_+	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_002209010.1|2644857_2645742_+	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002209009.1|2645748_2646186_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297096.1|2646259_2647039_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2647038_2648061_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002209166.1|2648194_2650258_+	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	33.2	5.3e-30
WP_002209167.1|2650254_2651571_+	McrC family protein	NA	NA	NA	NA	NA
WP_002209169.1|2652594_2653920_+	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_002209170.1|2653969_2654692_+	histidine kinase	NA	NA	NA	NA	NA
WP_002209171.1|2654663_2656037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071525507.1|2656380_2656719_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 167
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2666903	2669462	4523033		Hokovirus(100.0%)	1	NA	NA
WP_002228120.1|2666903_2669462_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.3	5.2e-11
>prophage 168
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2674723	2676307	4523033		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002209192.1|2674723_2676307_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	33.7	2.3e-25
>prophage 169
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2684367	2687454	4523033		Leptospira_phage(100.0%)	1	NA	NA
WP_002209200.1|2684367_2687454_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	18.9	3.5e-17
>prophage 170
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2690575	2691748	4523033		Bacillus_virus(100.0%)	1	NA	NA
WP_002209204.1|2690575_2691748_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	32.2	2.0e-18
>prophage 171
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2695002	2697861	4523033		Streptococcus_phage(50.0%)	3	NA	NA
WP_002209209.1|2695002_2696592_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.6	8.8e-33
WP_002209210.1|2696918_2697533_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_002209211.1|2697699_2697861_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.7	9.5e-12
>prophage 172
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2710536	2723086	4523033		Bacillus_phage(40.0%)	7	NA	NA
WP_002209221.1|2710536_2711808_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	46.3	2.4e-89
WP_002218755.1|2711964_2713095_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	29.2	3.7e-09
WP_002215967.1|2715086_2715593_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002223940.1|2715598_2716876_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.6	3.6e-13
WP_002209225.1|2716872_2717496_-	YfiR family protein	NA	NA	NA	NA	NA
WP_002209226.1|2717870_2720597_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.1	2.2e-68
WP_002209227.1|2721166_2723086_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	37.5	6.1e-12
>prophage 173
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2735370	2736324	4523033		Cyanophage(100.0%)	1	NA	NA
WP_002209241.1|2735370_2736324_+	transaldolase	NA	A0A127KNC6	Cyanophage	28.8	4.3e-11
>prophage 174
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2742505	2752718	4523033	tRNA	Micromonas_pusilla_virus(25.0%)	8	NA	NA
WP_002209248.1|2742505_2744416_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.2	9.9e-148
WP_002209249.1|2744527_2745667_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.7	3.6e-20
WP_002220711.1|2745909_2747094_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.0	1.3e-89
WP_002220713.1|2747223_2748123_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_002220715.1|2748253_2748517_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_157131898.1|2748633_2748798_+	DUF2575 family protein	NA	NA	NA	NA	NA
WP_002210510.1|2748931_2749870_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_002210509.1|2749901_2752718_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.1	1.0e-63
>prophage 175
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2757273	2758449	4523033		Halovirus(100.0%)	1	NA	NA
WP_002224759.1|2757273_2758449_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.3	6.9e-51
>prophage 176
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2764265	2764748	4523033		Bacillus_phage(100.0%)	1	NA	NA
WP_002210497.1|2764265_2764748_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	42.6	4.7e-30
>prophage 177
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2778752	2854604	4523033	plate,transposase	Escherichia_phage(20.0%)	56	NA	NA
WP_000255944.1|2778752_2779775_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_042468670.1|2779774_2780554_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.9e-138
WP_002210424.1|2780815_2781202_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_015683761.1|2781496_2784211_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210427.1|2784288_2784822_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|2784850_2785375_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|2785541_2786462_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210430.1|2786561_2787713_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002210431.1|2787785_2789042_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002228100.1|2789068_2789896_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|2789897_2790818_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|2790810_2792286_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002210434.1|2792423_2793494_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002210435.1|2793490_2794693_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210436.1|2794692_2796009_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210437.1|2796011_2797094_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210438.1|2797087_2798464_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210439.1|2798460_2799948_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002228284.1|2799934_2801698_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|2801763_2802081_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210442.1|2802077_2803040_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210443.1|2803042_2803501_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|2804055_2804145_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|2804602_2805043_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002210447.1|2805173_2806184_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213775.1|2806688_2807147_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002424260.1|2807345_2807870_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002228103.1|2807842_2809570_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_002216437.1|2810029_2811835_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002216434.1|2812371_2813328_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002210452.1|2814005_2814221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|2814649_2815108_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210453.1|2815254_2816817_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|2816819_2817911_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|2817912_2819343_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|2819357_2819960_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002224086.1|2820200_2821382_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210461.1|2822045_2823707_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002214274.1|2824646_2825639_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002214276.1|2825614_2827222_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002210464.1|2827208_2827919_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|2827987_2828755_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|2828950_2831320_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002220588.1|2831780_2834687_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210468.1|2834942_2835296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468664.1|2835317_2838758_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_002210470.1|2840424_2841780_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|2841899_2842391_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|2842383_2842749_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|2842754_2843372_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|2843364_2844468_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002224087.1|2844493_2846713_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_002210474.1|2846725_2849074_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|2849177_2851766_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|2851783_2852767_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210477.1|2852759_2854604_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 178
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2910085	2911201	4523033		Planktothrix_phage(100.0%)	1	NA	NA
WP_002353714.1|2910085_2911201_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	8.9e-24
>prophage 179
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2914745	2915732	4523033		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002210384.1|2914745_2915732_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.3	1.3e-23
>prophage 180
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2940465	2949909	4523033	tRNA	Vibrio_phage(25.0%)	8	NA	NA
WP_002210359.1|2940465_2942304_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_002210358.1|2942461_2944210_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	8.7e-74
WP_001144069.1|2944345_2944561_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002212201.1|2944966_2945980_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.7	6.5e-106
WP_002217581.1|2946225_2946876_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_015683751.1|2946983_2947343_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_002212198.1|2947616_2948435_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_002212197.1|2948670_2949909_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	4.7e-82
>prophage 181
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2955463	2963476	4523033		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_002212193.1|2955463_2956894_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.9	4.1e-37
WP_002212192.1|2956930_2958181_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_002212191.1|2958505_2958787_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_002212190.1|2959355_2960009_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	45.1	1.1e-42
WP_002212189.1|2960433_2961216_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_002212188.1|2961622_2962783_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	45.2	3.7e-89
WP_002357252.1|2962792_2963476_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	45.6	2.2e-41
>prophage 182
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2968256	2974286	4523033		Bacillus_virus(100.0%)	5	NA	NA
WP_002212181.1|2968256_2970152_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.5	2.9e-91
WP_002212180.1|2970155_2971067_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002212179.1|2971124_2971709_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002216196.1|2971781_2972030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212178.1|2972012_2974286_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.4	5.4e-84
>prophage 183
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	2979582	2980416	4523033		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002212175.1|2979582_2980416_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	43.9	9.5e-63
>prophage 184
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3036541	3037895	4523033	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_100067904.1|3036541_3037895_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
>prophage 185
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3041475	3043470	4523033		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_002209261.1|3041475_3043470_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.3	1.6e-52
>prophage 186
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3055460	3055748	4523033		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_002209274.1|3055460_3055748_-	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	54.1	9.6e-15
>prophage 187
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3062879	3063974	4523033		Bacillus_virus(100.0%)	1	NA	NA
WP_002209280.1|3062879_3063974_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	32.0	2.1e-25
>prophage 188
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3068956	3070856	4523033		Planktothrix_phage(50.0%)	2	NA	NA
WP_002209287.1|3068956_3069676_-	phosphonate C-P lyase system protein PhnL	NA	G9BWD6	Planktothrix_phage	34.9	5.0e-20
WP_002209288.1|3070064_3070856_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.7	7.0e-15
>prophage 189
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3075062	3079857	4523033		Cronobacter_phage(25.0%)	4	NA	NA
WP_025470743.1|3075062_3075527_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.5	9.4e-52
WP_002209296.1|3075703_3077842_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	65.3	1.5e-269
WP_002209297.1|3078275_3078992_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.9	2.7e-21
WP_002209298.1|3078978_3079857_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-10
>prophage 190
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3087326	3105322	4523033	tRNA,transposase,integrase	Escherichia_phage(28.57%)	15	3082885:3082901	3110691:3110707
3082885:3082901	attL	GGTTTTTTTATCAACAA	NA	NA	NA	NA
WP_002209307.1|3087326_3090224_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.2e-141
WP_002209309.1|3090236_3090686_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_002209310.1|3090836_3092348_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.7	5.4e-48
WP_002209311.1|3092627_3093722_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_002223173.1|3093721_3094798_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_015683738.1|3095185_3096445_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.7	2.8e-82
WP_002209314.1|3096598_3098509_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_002209315.1|3098501_3099611_+	histidine kinase	NA	A0A2H4J2R8	uncultured_Caudovirales_phage	67.9	1.5e-143
WP_001297096.1|3099661_3100441_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_042666123.1|3100440_3101463_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_002213759.1|3101573_3102032_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209317.1|3102221_3102428_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_002209318.1|3102613_3103366_-	cell division protein ZapD	NA	NA	NA	NA	NA
WP_002209319.1|3103362_3103983_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_002209320.1|3104278_3105322_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.2	6.3e-104
3110691:3110707	attR	GGTTTTTTTATCAACAA	NA	NA	NA	NA
>prophage 191
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3120040	3121465	4523033		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_015683735.1|3120040_3121465_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.7	2.3e-40
>prophage 192
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3129989	3134325	4523033		Mamastrovirus(33.33%)	4	NA	NA
WP_002209340.1|3129989_3131591_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	45.3	8.9e-17
WP_002228315.1|3131810_3132347_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_002209342.1|3132500_3133163_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_002209343.1|3133398_3134325_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.7	5.9e-21
>prophage 193
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3139560	3141556	4523033		Pandoravirus(50.0%)	2	NA	NA
WP_002209351.1|3139560_3140040_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	43.2	1.4e-18
WP_002228219.1|3140047_3141556_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	30.6	6.2e-28
>prophage 194
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3144946	3151207	4523033		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_002222096.1|3144946_3147508_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.8	3.5e-39
WP_002209358.1|3147616_3150091_+	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_002209359.1|3150412_3151207_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	29.0	2.1e-14
>prophage 195
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3157895	3158240	4523033		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_002209365.1|3157895_3158240_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.0	3.5e-27
>prophage 196
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3162710	3167123	4523033	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_002209370.1|3162710_3164156_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.5	6.1e-25
WP_002209371.1|3164330_3167123_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.9	3.1e-49
>prophage 197
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3171056	3175822	4523033		Only_Syngen_Nebraska_virus(25.0%)	4	NA	NA
WP_002209376.1|3171056_3172694_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	5.0e-156
WP_002209377.1|3172774_3174070_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.7	5.7e-131
WP_161597822.1|3174531_3175047_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	71.1	2.4e-56
WP_002209379.1|3175150_3175822_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	28.8	1.9e-13
>prophage 198
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3181341	3181749	4523033		Haemophilus_virus(100.0%)	1	NA	NA
WP_002209383.1|3181341_3181749_-	HicB family protein	NA	Q775F5	Haemophilus_virus	40.0	5.4e-19
>prophage 199
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3185145	3187225	4523033		Hokovirus(50.0%)	2	NA	NA
WP_002228227.1|3185145_3186582_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.7	4.2e-34
WP_002209388.1|3186583_3187225_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	40.3	1.0e-27
>prophage 200
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3190759	3200906	4523033		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_002209394.1|3190759_3191524_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.3	6.1e-56
WP_002209395.1|3191517_3192144_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	9.1e-34
WP_002209396.1|3192265_3193249_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	2.3e-07
WP_002209397.1|3193303_3194302_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	1.0e-31
WP_002209399.1|3194669_3197225_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	4.4e-26
WP_002209402.1|3198018_3198474_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_002209403.1|3198956_3200072_+	erythritol/L-threitol dehydrogenase	NA	NA	NA	NA	NA
WP_002209404.1|3200135_3200906_+	D-threitol dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.9	2.5e-17
>prophage 201
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3204321	3206037	4523033		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_002209408.1|3204321_3205611_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.5	6.4e-167
WP_002209409.1|3205695_3206037_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	1.3e-21
>prophage 202
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3210260	3212357	4523033		Acinetobacter_phage(100.0%)	1	NA	NA
WP_002223222.1|3210260_3212357_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.9	7.6e-08
>prophage 203
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3222217	3223732	4523033		Bacillus_virus(100.0%)	1	NA	NA
WP_002209422.1|3222217_3223732_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	3.3e-13
>prophage 204
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3228426	3234011	4523033		Escherichia_phage(100.0%)	5	NA	NA
WP_002209427.1|3228426_3230877_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.2e-219
WP_002209428.1|3230888_3231506_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	1.8e-74
WP_002209429.1|3231507_3232368_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	33.7	7.6e-23
WP_002209430.1|3232513_3233224_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.5	4.8e-23
WP_002215100.1|3233480_3234011_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	42.1	1.6e-15
>prophage 205
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3239018	3240542	4523033		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002209436.1|3239018_3240542_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	9.1e-19
>prophage 206
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3249707	3255283	4523033	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_002209445.1|3249707_3250196_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.0	2.6e-28
WP_002209446.1|3250309_3251380_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.3	4.1e-111
WP_002209447.1|3251517_3252081_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002209448.1|3252220_3254848_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.3	1.8e-78
WP_002209449.1|3255097_3255283_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
>prophage 207
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3271530	3275090	4523033		Escherichia_coli_O157_typing_phage(50.0%)	3	NA	NA
WP_002228238.1|3271530_3272601_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	1.5e-89
WP_002209465.1|3272613_3273735_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_071882714.1|3274310_3275090_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	3.8e-138
>prophage 208
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3281452	3284026	4523033		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002217405.1|3281452_3284026_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.9	2.4e-128
>prophage 209
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3295666	3296104	4523033		Streptomyces_phage(100.0%)	1	NA	NA
WP_002216643.1|3295666_3296104_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	36.6	2.6e-11
>prophage 210
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3309805	3310552	4523033		Planktothrix_phage(100.0%)	1	NA	NA
WP_002208732.1|3309805_3310552_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	3.4e-35
>prophage 211
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3327485	3328067	4523033		Caulobacter_phage(100.0%)	1	NA	NA
WP_002208720.1|3327485_3328067_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	3.7e-13
>prophage 212
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3344911	3395657	4523033	tRNA,transposase,holin	uncultured_Mediterranean_phage(21.43%)	45	NA	NA
WP_002213775.1|3344911_3345370_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_015683723.1|3345555_3347160_-	carbohydrate-binding protein	NA	Q9J8B0	Spodoptera_exigua_multiple_nucleopolyhedrovirus	31.0	2.3e-20
WP_002216043.1|3347356_3347662_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	46.2	2.0e-10
WP_002208704.1|3348088_3348547_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002208703.1|3348673_3349921_+	esterase FrsA	NA	NA	NA	NA	NA
WP_002208702.1|3349980_3350382_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_002208701.1|3350558_3351662_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.6	1.5e-60
WP_002208700.1|3351671_3352931_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.4	1.0e-92
WP_002213775.1|3353193_3353652_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002264519.1|3353977_3354727_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_002208698.1|3354924_3355179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099156357.1|3355304_3355946_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002208694.1|3356675_3357233_+	methyltransferase	NA	NA	NA	NA	NA
WP_002208693.1|3357479_3358004_+	shikimate kinase AroL	NA	NA	NA	NA	NA
WP_002208692.1|3358493_3358781_+	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_042468846.1|3359016_3359928_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	65.9	7.4e-101
WP_000255944.1|3359990_3361013_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002208690.1|3362221_3363136_+	fructokinase	NA	NA	NA	NA	NA
WP_002223265.1|3363737_3367427_-	AAA family ATPase	NA	G3MAB6	Bacillus_virus	26.1	2.2e-10
WP_002208687.1|3367423_3368668_-	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_002208685.1|3368935_3369625_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.1	1.7e-36
WP_002208684.1|3369649_3370966_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	29.2	7.1e-28
WP_002215524.1|3370987_3372052_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208680.1|3372525_3373845_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002223269.1|3373920_3375312_+	proline-specific permease ProY	NA	NA	NA	NA	NA
WP_002208678.1|3375872_3377702_+	maltodextrin glucosidase	NA	NA	NA	NA	NA
WP_002222306.1|3377698_3377881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208677.1|3377856_3378537_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002208675.1|3380897_3381500_-	peroxiredoxin C	NA	NA	NA	NA	NA
WP_002216927.1|3381798_3382380_-	ACP phosphodiesterase	NA	NA	NA	NA	NA
WP_002208673.1|3382582_3383653_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002208672.1|3383745_3384870_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	3.2e-90
WP_002208671.1|3384981_3385317_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.6	6.4e-10
WP_002223272.1|3385344_3387192_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002208669.1|3387202_3388171_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.7	1.9e-46
WP_002213759.1|3388377_3388836_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002217139.1|3389133_3389829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002217141.1|3389861_3390455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208668.1|3390525_3390975_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_002208667.1|3391124_3392234_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.2	1.5e-50
WP_002208666.1|3392369_3392840_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.7	3.5e-30
WP_002208665.1|3392860_3393277_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002208664.1|3393517_3394507_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_002208663.1|3394499_3394985_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_002213759.1|3395198_3395657_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 213
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3416300	3421440	4523033	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_002208642.1|3416300_3416924_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.9	1.7e-64
WP_002208641.1|3417129_3418401_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.2	7.3e-131
WP_002208640.1|3418595_3420950_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.9	4.5e-227
WP_002208639.1|3421167_3421440_+	DNA-binding protein HU-beta	NA	A4JWM7	Burkholderia_virus	59.6	3.5e-22
>prophage 214
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3425059	3425758	4523033		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002208635.1|3425059_3425758_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	70.5	2.1e-87
>prophage 215
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3430592	3434175	4523033		Bacillus_phage(100.0%)	2	NA	NA
WP_002208629.1|3430592_3432359_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	7.0e-47
WP_002208628.1|3432351_3434175_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	2.5e-39
>prophage 216
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3454594	3459630	4523033		Bacteriophage(50.0%)	4	NA	NA
WP_002208605.1|3454594_3456571_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.6	3.4e-42
WP_002208604.1|3456626_3456959_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002208603.1|3456958_3457564_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_042666137.1|3457755_3459630_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.4	2.4e-114
>prophage 217
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3465045	3466359	4523033		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002208596.1|3465045_3466359_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	3.1e-52
>prophage 218
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3475823	3480513	4523033		Paramecium_bursaria_Chlorella_virus(25.0%)	4	NA	NA
WP_002223297.1|3475823_3476789_+	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	47.9	2.1e-82
WP_015683716.1|3476982_3478389_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.1	3.5e-49
WP_002208589.1|3478391_3479135_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	34.8	8.6e-07
WP_002208588.1|3479139_3480513_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	29.1	8.1e-35
>prophage 219
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3491145	3494031	4523033		uncultured_virus(100.0%)	1	NA	NA
WP_002223301.1|3491145_3494031_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.8	1.0e-111
>prophage 220
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3499041	3499728	4523033		Planktothrix_phage(100.0%)	1	NA	NA
WP_002208572.1|3499041_3499728_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.6e-31
>prophage 221
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3505516	3511389	4523033	tRNA,transposase,integrase	Acanthamoeba_polyphaga_mimivirus(33.33%)	9	3508621:3508634	3511420:3511433
WP_015683714.1|3505516_3506902_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.5	2.2e-40
WP_002213775.1|3507248_3507707_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002209775.1|3507853_3508066_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_002209774.1|3508080_3508947_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
3508621:3508634	attL	TTTAACGTTATCAA	NA	NA	NA	NA
WP_002215270.1|3509301_3509484_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_002215268.1|3509742_3509943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228356.1|3510056_3510554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215266.1|3510689_3511028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079866998.1|3511110_3511389_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	73.5	4.2e-31
3511420:3511433	attR	TTTAACGTTATCAA	NA	NA	NA	NA
>prophage 222
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3518596	3519376	4523033		Escherichia_phage(100.0%)	1	NA	NA
WP_001297096.1|3518596_3519376_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
>prophage 223
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3522456	3523308	4523033		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015683712.1|3522456_3523308_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	1.2e-49
>prophage 224
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3531209	3532418	4523033	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_002209743.1|3531209_3532418_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 225
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3540356	3540602	4523033		Vibrio_phage(100.0%)	1	NA	NA
WP_002209745.1|3540356_3540602_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	7.2e-19
>prophage 226
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3554281	3560137	4523033		Ostreococcus_lucimarinus_virus(50.0%)	3	NA	NA
WP_042468842.1|3554281_3556207_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.9	2.0e-23
WP_002210300.1|3557611_3558541_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002223323.1|3558589_3560137_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.7	1.3e-09
>prophage 227
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3566804	3568595	4523033		Bacillus_phage(100.0%)	1	NA	NA
WP_042593515.1|3566804_3568595_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	29.3	1.3e-48
>prophage 228
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3572989	3574005	4523033		Morganella_phage(50.0%)	2	NA	NA
WP_002210315.1|3572989_3573199_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	5.9e-22
WP_002210317.1|3573621_3574005_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	59.4	1.2e-25
>prophage 229
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3577541	3580229	4523033		Stx2-converting_phage(50.0%)	2	NA	NA
WP_002210323.1|3577541_3578744_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	51.5	2.2e-105
WP_002210324.1|3579146_3580229_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.9	3.7e-14
>prophage 230
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3586848	3591033	4523033	tRNA	Staphylococcus_phage(50.0%)	3	NA	NA
WP_002210333.1|3586848_3589431_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	4.3e-186
WP_002210335.1|3589691_3590174_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_002210336.1|3590307_3591033_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.5	5.8e-32
>prophage 231
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3597323	3598379	4523033		Pseudomonas_phage(100.0%)	1	NA	NA
WP_042468841.1|3597323_3598379_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.2	3.5e-46
>prophage 232
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3603041	3604706	4523033		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002210348.1|3603041_3604706_-	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	39.4	3.0e-84
>prophage 233
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3612452	3614120	4523033	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_015683705.1|3612452_3614120_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	87.1	4.0e-294
>prophage 234
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3622055	3625805	4523033		Mycobacterium_phage(50.0%)	4	NA	NA
WP_002215390.1|3622055_3622823_-	esterase	NA	G1DB77	Mycobacterium_phage	36.0	3.4e-06
WP_002212204.1|3623533_3623785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215393.1|3623947_3624133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|3625025_3625805_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
>prophage 235
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3630090	3635847	4523033		Bacillus_virus(25.0%)	4	NA	NA
WP_002212210.1|3630090_3631290_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.0	7.1e-27
WP_002212211.1|3631965_3632937_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	74.3	3.1e-137
WP_002212212.1|3633061_3635212_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.8	1.1e-211
WP_002212214.1|3635610_3635847_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	53.3	5.9e-18
>prophage 236
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3639103	3639316	4523033		Morganella_phage(100.0%)	1	NA	NA
WP_002212220.1|3639103_3639316_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	75.7	3.2e-23
>prophage 237
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3643470	3644277	4523033		Cedratvirus(100.0%)	1	NA	NA
WP_002212225.1|3643470_3644277_+	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	31.2	1.2e-09
>prophage 238
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3668286	3673903	4523033		Hokovirus(50.0%)	3	NA	NA
WP_015683703.1|3668286_3671013_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.7	9.2e-14
WP_002224856.1|3671022_3671673_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_002209651.1|3671836_3673903_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.4	9.1e-30
>prophage 239
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3677336	3678800	4523033		Catovirus(100.0%)	1	NA	NA
WP_002209655.1|3677336_3678800_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	30.8	4.1e-53
>prophage 240
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3687287	3691002	4523033		Cronobacter_phage(50.0%)	4	NA	NA
WP_002209664.1|3687287_3687671_+	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	67.3	9.8e-31
WP_002209665.1|3687849_3688812_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_002209667.1|3688889_3689546_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_002209669.1|3689676_3691002_-	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	32.4	1.9e-52
>prophage 241
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3694107	3694683	4523033		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_002209672.1|3694107_3694683_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	27.4	6.2e-05
>prophage 242
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3698147	3701987	4523033		Streptococcus_phage(50.0%)	3	NA	NA
WP_002209677.1|3698147_3699947_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.4	3.4e-25
WP_002209678.1|3699956_3700955_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002209679.1|3701306_3701987_+	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	28.8	2.4e-19
>prophage 243
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3705715	3705976	4523033		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002211567.1|3705715_3705976_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	9.3e-17
>prophage 244
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3709063	3715441	4523033	tRNA	Pandoravirus(33.33%)	3	NA	NA
WP_002211563.1|3709063_3709666_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	34.1	6.5e-05
WP_002211562.1|3709774_3711235_-	membrane-bound lytic murein transglycosylase MltF	NA	I1VXB7	Halocynthia_phage	41.4	7.1e-13
WP_002223376.1|3711550_3715441_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.5	8.8e-127
>prophage 245
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3719219	3724809	4523033		Bacillus_phage(66.67%)	4	NA	NA
WP_002216114.1|3719219_3720656_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.8	3.1e-13
WP_072120864.1|3720704_3721727_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_002211556.1|3721689_3723027_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.4	1.2e-11
WP_002211555.1|3723186_3724809_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.5	1.1e-94
>prophage 246
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3728424	3730670	4523033		Aeromonas_phage(50.0%)	3	NA	NA
WP_002211552.1|3728424_3729678_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.5	2.8e-98
WP_002223388.1|3729829_3730012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228384.1|3730121_3730670_+	attachment invasion locus protein Ail	NA	A0A1B0VBR9	Salmonella_phage	36.7	5.2e-25
>prophage 247
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3738588	3745664	4523033		Faustovirus(20.0%)	8	NA	NA
WP_002209836.1|3738588_3739818_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	33.1	8.6e-36
WP_002209835.1|3739848_3740235_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	5.4e-53
WP_002209834.1|3740504_3740828_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	7.8e-21
WP_002209833.1|3740938_3741463_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_002209832.1|3741705_3743658_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	37.8	1.8e-96
WP_015683702.1|3743660_3743996_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_002209830.1|3744025_3744226_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_002209829.1|3744365_3745664_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	39.0	9.7e-38
>prophage 248
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3758711	3759140	4523033		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_002209821.1|3758711_3759140_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
>prophage 249
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3770385	3773398	4523033		Indivirus(50.0%)	2	NA	NA
WP_002209810.1|3770385_3771765_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	38.7	3.7e-43
WP_002227862.1|3771934_3773398_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.1	1.7e-86
>prophage 250
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3779153	3780362	4523033	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_002209743.1|3779153_3780362_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 251
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3791745	3792582	4523033		Planktothrix_phage(100.0%)	1	NA	NA
WP_002210787.1|3791745_3792582_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	6.1e-17
>prophage 252
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3795640	3796114	4523033		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002210791.1|3795640_3796114_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.7e-37
>prophage 253
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3800622	3802251	4523033		Cedratvirus(50.0%)	2	NA	NA
WP_002210795.1|3800622_3801459_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	28.2	4.2e-10
WP_002223523.1|3801552_3802251_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	6.4e-12
>prophage 254
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3808876	3809815	4523033		Planktothrix_phage(100.0%)	1	NA	NA
WP_002210802.1|3808876_3809815_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	6.4e-23
>prophage 255
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3816571	3821644	4523033		Enterobacteria_phage(33.33%)	3	NA	NA
WP_002210809.1|3816571_3817687_-	porin OmpF2	NA	Q1MVN1	Enterobacteria_phage	54.5	2.1e-110
WP_015683693.1|3817956_3820134_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.2	1.4e-44
WP_002228030.1|3820201_3821644_-	catalase	NA	A0A2K9L0T1	Tupanvirus	38.8	4.9e-99
>prophage 256
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3825878	3871236	4523033	coat,protease,plate,tail,transposase	Pseudomonas_phage(21.05%)	38	NA	NA
WP_002210815.1|3825878_3826388_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210816.1|3826422_3826680_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210817.1|3826683_3827814_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210818.1|3827976_3830265_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210820.1|3830758_3831487_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210821.1|3831748_3834424_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.0e-102
WP_080071931.1|3834611_3837485_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210824.1|3837552_3838206_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_002216094.1|3838208_3838781_-	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_002216093.1|3838948_3840901_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002210825.1|3840924_3842079_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210826.1|3843181_3844297_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002213759.1|3844498_3844957_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002228026.1|3845746_3846913_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002208870.1|3847187_3848714_-	MFS transporter	NA	NA	NA	NA	NA
WP_002208869.1|3849090_3850119_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208868.1|3850192_3851980_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208867.1|3852401_3853337_-	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208866.1|3853508_3853751_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208864.1|3853956_3854679_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002215470.1|3854952_3855432_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208862.1|3855642_3856947_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002208861.1|3857655_3858468_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208860.1|3858443_3859238_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208859.1|3859868_3860159_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208858.1|3860204_3860822_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208857.1|3860826_3861021_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208855.1|3862546_3862915_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002208854.1|3862916_3863216_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208853.1|3863336_3864830_+|coat	coat protein	coat	NA	NA	NA	NA
WP_002208852.1|3865096_3866503_+	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208850.1|3866499_3867555_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002215460.1|3867570_3868167_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208848.1|3868163_3868619_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208847.1|3868622_3869759_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002215458.1|3869755_3870016_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208846.1|3870012_3870360_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002208845.1|3870456_3871236_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
>prophage 257
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3877194	3889531	4523033	transposase	Vibrio_phage(40.0%)	11	NA	NA
WP_002230704.1|3877194_3877578_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208837.1|3877808_3879605_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002208836.1|3879632_3879860_-	YejL family protein	NA	NA	NA	NA	NA
WP_002208835.1|3880037_3881042_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002213775.1|3881242_3881701_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208834.1|3881839_3882124_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_002208833.1|3882285_3884043_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	2.3e-98
WP_002208832.1|3884556_3885264_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_002208831.1|3885367_3886567_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.3e-23
WP_002208829.1|3887533_3887878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208828.1|3887938_3889531_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	1.3e-20
>prophage 258
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3895728	3896313	4523033		Clostridioides_phage(100.0%)	1	NA	NA
WP_002208822.1|3895728_3896313_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	2.8e-13
>prophage 259
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3900192	3901665	4523033		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002208815.1|3900192_3901665_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	7.1e-45
>prophage 260
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3906200	3907992	4523033		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_002208810.1|3906200_3907016_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.6	8.8e-13
WP_002208809.1|3907026_3907992_-	C-terminal binding protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	30.3	5.2e-28
>prophage 261
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3914586	3917763	4523033		Staphylococcus_phage(50.0%)	3	NA	NA
WP_002208803.1|3914586_3916161_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	2.9e-12
WP_002208802.1|3916196_3917195_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002208801.1|3917307_3917763_-	NUDIX domain-containing protein	NA	D9ICN3	Escherichia_virus	44.3	2.9e-05
>prophage 262
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3927873	3928731	4523033		Catovirus(100.0%)	1	NA	NA
WP_002208791.1|3927873_3928731_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	31.0	6.9e-24
>prophage 263
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3935985	3939031	4523033		Bacillus_virus(50.0%)	2	NA	NA
WP_015683682.1|3935985_3936774_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	5.0e-13
WP_002208782.1|3937033_3939031_+	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	31.6	3.5e-10
>prophage 264
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3943336	3946531	4523033		Planktothrix_phage(50.0%)	3	NA	NA
WP_002208776.1|3943336_3944323_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	9.6e-30
WP_002208775.1|3944319_3944991_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015683680.1|3945325_3946531_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.3	1.8e-102
>prophage 265
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3955145	3955409	4523033		Vibrio_phage(100.0%)	1	NA	NA
WP_002208765.1|3955145_3955409_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	2.5e-25
>prophage 266
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3958610	3969323	4523033		Bacillus_virus(25.0%)	13	NA	NA
WP_002208760.1|3958610_3959744_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	35.4	3.4e-31
WP_002208759.1|3959768_3960734_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002208758.1|3960730_3961576_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002208757.1|3961700_3962165_+	YbjO family protein	NA	NA	NA	NA	NA
WP_002208756.1|3962248_3963379_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.8	5.1e-27
WP_002220045.1|3963505_3964237_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002228004.1|3964484_3964715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211378.1|3965055_3965982_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	44.1	4.6e-50
WP_002211377.1|3966393_3967485_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002231265.1|3967484_3967721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002231264.1|3967717_3968104_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002211376.1|3968064_3968541_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002211375.1|3968537_3969323_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-10
>prophage 267
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3974650	3975379	4523033		Planktothrix_phage(100.0%)	1	NA	NA
WP_002228008.1|3974650_3975379_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	34.9	3.3e-27
>prophage 268
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	3991242	4156253	4523033	protease,transposase,tRNA,plate	Bacillus_phage(12.5%)	117	NA	NA
WP_002211351.1|3991242_3993192_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	37.7	8.8e-35
WP_002211350.1|3993472_3993736_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	3.6e-16
WP_002211349.1|3994096_3994417_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_002211348.1|3994442_3996719_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.7	7.4e-166
WP_002213759.1|3996996_3997455_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211347.1|3997826_3998045_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002211344.1|3999138_4000863_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	3.3e-17
WP_002217690.1|4000865_4002632_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.9	6.8e-26
WP_002211341.1|4003090_4004053_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.7	4.9e-63
WP_002211340.1|4004819_4005314_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002211339.1|4005436_4009354_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.8	1.5e-89
WP_002211338.1|4009546_4010155_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_002228009.1|4010165_4011509_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.4	5.4e-76
WP_002211336.1|4011750_4013043_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.5	4.0e-92
WP_002211334.1|4016558_4017293_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.4	3.6e-21
WP_002211333.1|4018279_4018954_+	glycosyltransferase family 25 protein	NA	A0A2H4UUT1	Bodo_saltans_virus	40.5	7.8e-31
WP_002211332.1|4019071_4021354_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	1.6e-157
WP_002211331.1|4021409_4022267_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_002211330.1|4022963_4024730_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_002211329.1|4024878_4025916_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_002211328.1|4026184_4027279_+	hemagglutinin	NA	B0FIT1	Escherichia_phage	32.7	3.7e-06
WP_002211327.1|4027299_4029147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211326.1|4029513_4030599_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.1	4.4e-84
WP_002211325.1|4030761_4032048_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002211324.1|4032360_4033053_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_002211323.1|4033226_4034900_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_002211322.1|4034960_4035245_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	2.4e-10
WP_002211320.1|4038117_4039866_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	31.5	8.7e-66
WP_002211319.1|4039862_4040849_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_002226050.1|4040856_4042284_-	VOC family protein	NA	NA	NA	NA	NA
WP_002211317.1|4043010_4043220_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.0	3.0e-10
WP_002211315.1|4043767_4043950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211314.1|4043946_4044699_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002211313.1|4045061_4045955_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_002211311.1|4046727_4047513_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_002211310.1|4047509_4048832_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_002211309.1|4048812_4049541_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_002211308.1|4049537_4053995_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_002213759.1|4054210_4054669_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002217987.1|4054952_4056809_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002211305.1|4057032_4057581_+	YcbK family protein	NA	A0A0K1LLY2	Rhodobacter_phage	34.7	7.8e-05
WP_002211304.1|4057641_4058289_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.3	2.2e-22
WP_002430096.1|4058442_4058559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211303.1|4058712_4059903_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002354007.1|4060159_4061239_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	56.5	3.2e-111
WP_002211301.1|4061539_4062940_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.2	6.5e-80
WP_002228013.1|4063438_4064644_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002220013.1|4065359_4067975_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002211296.1|4068592_4069603_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_002211295.1|4069785_4070337_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_002363919.1|4070362_4071472_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_002211293.1|4071574_4073695_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_002211292.1|4073700_4075614_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.5e-47
WP_002211291.1|4075742_4077029_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_015683672.1|4077015_4078668_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_002211289.1|4078664_4079243_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_002228015.1|4079512_4079680_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_002213775.1|4079877_4080336_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_001297096.1|4081496_4082276_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|4082275_4083298_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211286.1|4083931_4084120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220006.1|4084385_4084904_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002224683.1|4084972_4086724_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002226586.1|4086934_4087390_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002213775.1|4087558_4088017_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213066.1|4088206_4089268_-	porin OmpA	NA	NA	NA	NA	NA
WP_002213065.1|4089625_4090132_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213064.1|4090360_4090996_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213063.1|4091097_4093236_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213062.1|4093265_4093712_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002221095.1|4093905_4095960_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.8	1.5e-16
WP_002213060.1|4096020_4096485_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213056.1|4097660_4098077_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213054.1|4098185_4098503_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213052.1|4098563_4099754_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213049.1|4099847_4100126_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002213046.1|4100177_4100507_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_015683670.1|4104152_4106570_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213038.1|4106723_4107470_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213036.1|4108200_4108419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213034.1|4108682_4109207_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213032.1|4109196_4110480_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|4110481_4111219_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213028.1|4111234_4112473_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213026.1|4112465_4113185_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213025.1|4113186_4113939_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_002213024.1|4113941_4114730_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002228570.1|4114816_4115257_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213017.1|4115294_4115543_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002213016.1|4115641_4116490_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002211662.1|4117478_4117979_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215896.1|4118021_4119566_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211664.1|4119577_4120930_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|4120926_4121613_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_015683668.1|4121612_4123349_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|4123352_4123844_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211927.1|4124231_4126874_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	1.6e-92
WP_015683667.1|4126876_4129225_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.1	4.5e-17
WP_002211929.1|4129240_4131541_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211930.1|4131537_4132311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211931.1|4132464_4132725_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002211932.1|4132740_4134924_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002214564.1|4135096_4135567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211935.1|4137731_4138964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211936.1|4138960_4142383_+	type VI secretion system membrane subunit	NA	NA	NA	NA	NA
WP_002211937.1|4142426_4144028_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_002211938.1|4144045_4145104_+	PAAR domain protein	NA	NA	NA	NA	NA
WP_002211939.1|4145118_4145574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211940.1|4145794_4147558_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211941.1|4147521_4148607_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002214552.1|4148581_4149163_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211943.1|4149162_4149615_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002211944.1|4149639_4151007_+	membrane protein	NA	NA	NA	NA	NA
WP_002211945.1|4151218_4151842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|4152524_4154120_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211947.1|4154347_4155001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|4155044_4156253_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 269
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4160289	4160958	4523033		Planktothrix_phage(100.0%)	1	NA	NA
WP_002211951.1|4160289_4160958_-	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
>prophage 270
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4165999	4170415	4523033		Synechococcus_phage(50.0%)	4	NA	NA
WP_002211957.1|4165999_4167139_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.9	5.2e-35
WP_002211958.1|4167412_4168282_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211959.1|4168417_4169569_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211960.1|4169752_4170415_+	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
>prophage 271
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4173605	4175126	4523033		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002211964.1|4173605_4175126_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.6e-10
>prophage 272
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4188285	4197063	4523033	tRNA	Indivirus(25.0%)	6	NA	NA
WP_002211870.1|4188285_4190313_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
WP_015683662.1|4190577_4191690_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_002211872.1|4191934_4192576_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.9	1.0e-35
WP_002211873.1|4192680_4193262_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	2.5e-33
WP_002211874.1|4193448_4195305_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_002223436.1|4195449_4197063_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.5	1.5e-40
>prophage 273
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4203843	4204662	4523033		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002211879.1|4203843_4204662_-	ABC transporter ATP-binding protein	NA	M1H3A1	Paramecium_bursaria_Chlorella_virus	29.7	2.0e-09
>prophage 274
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4213155	4217632	4523033		Bacillus_phage(50.0%)	4	NA	NA
WP_002211886.1|4213155_4214046_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.3	1.1e-56
WP_002211887.1|4214129_4215023_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	41.1	1.1e-45
WP_002211888.1|4215408_4216818_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	30.2	1.8e-29
WP_002211889.1|4217017_4217632_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	28.8	1.3e-13
>prophage 275
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4223266	4224166	4523033		Cellulophaga_phage(100.0%)	1	NA	NA
WP_002211896.1|4223266_4224166_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	81.6	3.2e-08
>prophage 276
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4228171	4229065	4523033		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002216311.1|4228171_4229065_-	sugar ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	24.3	7.9e-07
>prophage 277
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4236983	4238192	4523033	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_002209743.1|4236983_4238192_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 278
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4249080	4250448	4523033		Dickeya_phage(100.0%)	1	NA	NA
WP_002211920.1|4249080_4250448_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	7.0e-63
>prophage 279
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4266201	4269799	4523033	transposase	uncultured_virus(50.0%)	2	NA	NA
WP_002209743.1|4266201_4267410_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_042666164.1|4268785_4269799_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	6.1e-197
>prophage 280
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4273927	4275646	4523033		Bacillus_phage(100.0%)	1	NA	NA
WP_015683658.1|4273927_4275646_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	7.0e-52
>prophage 281
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4279173	4279473	4523033		Pectobacterium_phage(100.0%)	1	NA	NA
WP_002211053.1|4279173_4279473_+	DUF2591 family protein	NA	K9L3P6	Pectobacterium_phage	37.0	7.4e-10
>prophage 282
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4283500	4283710	4523033		Morganella_phage(100.0%)	1	NA	NA
WP_002221949.1|4283500_4283710_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	5.3e-23
>prophage 283
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4296575	4297970	4523033		Moraxella_phage(100.0%)	1	NA	NA
WP_002227969.1|4296575_4297970_+	CBS domain-containing protein	NA	A0A0R6PEZ3	Moraxella_phage	41.5	5.4e-26
>prophage 284
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4311217	4316018	4523033		Pandoravirus(50.0%)	4	NA	NA
WP_002211081.1|4311217_4312594_-	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	31.1	4.5e-41
WP_002211082.1|4312758_4313016_+	YoaH family protein	NA	NA	NA	NA	NA
WP_002211083.1|4313141_4314323_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_002211084.1|4314635_4316018_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.6	7.4e-52
>prophage 285
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4321390	4321621	4523033		Pectobacterium_phage(100.0%)	1	NA	NA
WP_002211091.1|4321390_4321621_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.0e-14
>prophage 286
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4342738	4343683	4523033		Clostridium_phage(100.0%)	1	NA	NA
WP_002211118.1|4342738_4343683_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RU71	Clostridium_phage	35.9	2.9e-15
>prophage 287
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4352963	4357477	4523033		Staphylococcus_phage(33.33%)	4	NA	NA
WP_002211126.1|4352963_4354541_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	9.1e-14
WP_002223882.1|4355613_4356573_+	sugar kinase	NA	NA	NA	NA	NA
WP_002211129.1|4356830_4357250_-	hypothetical protein	NA	A0A0R6PJ17	Moraxella_phage	44.0	1.8e-14
WP_002214976.1|4357294_4357477_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	55.0	1.5e-13
>prophage 288
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4369845	4370013	4523033		Enterobacterial_phage(100.0%)	1	NA	NA
WP_002215990.1|4369845_4370013_+	hypothetical protein	NA	K7PGV2	Enterobacterial_phage	71.2	1.0e-16
>prophage 289
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4384531	4385293	4523033		Planktothrix_phage(100.0%)	1	NA	NA
WP_002211159.1|4384531_4385293_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	40.5	6.1e-32
>prophage 290
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4401359	4401911	4523033		Salmonella_phage(100.0%)	1	NA	NA
WP_002211172.1|4401359_4401911_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.0	1.4e-22
>prophage 291
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4407558	4408569	4523033		Enterobacterial_phage(50.0%)	2	NA	NA
WP_002215398.1|4407558_4407783_-	hypothetical protein	NA	K7PLZ2	Enterobacterial_phage	76.8	1.5e-18
WP_002215401.1|4408341_4408569_+	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	57.7	2.1e-12
>prophage 292
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4414091	4415321	4523033	plate	Erwinia_phage(66.67%)	4	NA	NA
WP_002213212.1|4414091_4414391_-	lysozyme	NA	A0A218M4K8	Erwinia_phage	64.9	2.6e-23
WP_002213211.1|4414387_4414642_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	62.5	1.1e-17
WP_002213210.1|4414777_4415050_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_002213209.1|4415030_4415321_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	39.4	1.8e-05
>prophage 293
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4425652	4429484	4523033	transposase	Escherichia_phage(66.67%)	6	NA	NA
WP_002215425.1|4425652_4426543_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.1	6.7e-22
WP_002228531.1|4426428_4426770_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_002213183.1|4426779_4427004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161597818.1|4427044_4427239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042666058.1|4427682_4428705_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	2.0e-200
WP_001297096.1|4428704_4429484_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
>prophage 294
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4448598	4449807	4523033	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_002209743.1|4448598_4449807_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 295
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4465060	4465753	4523033		Bacillus_phage(100.0%)	1	NA	NA
WP_002211253.1|4465060_4465753_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	1.2e-31
>prophage 296
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4476112	4477060	4523033		Tupanvirus(100.0%)	1	NA	NA
WP_002211240.1|4476112_4477060_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	6.0e-45
>prophage 297
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4480525	4486711	4523033		Pseudomonas_phage(33.33%)	6	NA	NA
WP_002211236.1|4480525_4481608_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	42.1	7.4e-07
WP_002211235.1|4481607_4482438_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002211234.1|4482501_4482903_+	SirB2 family protein	NA	NA	NA	NA	NA
WP_002211233.1|4482899_4483709_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002211232.1|4483804_4484659_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.7	4.4e-47
WP_002224472.1|4485013_4486711_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.0	6.3e-21
>prophage 298
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4491751	4492819	4523033		Bacillus_virus(100.0%)	1	NA	NA
WP_015683639.1|4491751_4492819_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	7.5e-28
>prophage 299
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4511009	4512740	4523033	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_002228433.1|4511009_4512740_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	34.2	1.7e-90
>prophage 300
NZ_CP009991	Yersinia pestis strain Nicholisk 41 chromosome, complete genome	4523033	4517656	4521326	4523033	tRNA	Escherichia_coli_phage(50.0%)	2	NA	NA
WP_002211205.1|4517656_4518472_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	68.5	2.9e-48
WP_002211204.1|4519529_4521326_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.3	2.8e-11
>prophage 1
NZ_CP009989	Yersinia pestis strain Nicholisk 41 plasmid 1, complete sequence	99286	0	79992	99286	integrase,tail,transposase,terminase	Salmonella_phage(85.07%)	79	73777:73794	86835:86852
WP_002211752.1|670_1876_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002211753.1|2177_2405_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002215068.1|2404_2731_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211754.1|2930_3551_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215065.1|3616_4558_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211756.1|4580_4856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211757.1|5594_6083_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211758.1|6160_7924_+	phospholipase D	NA	NA	NA	NA	NA
WP_014501255.1|9999_11022_-|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002209743.1|11490_12699_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002224263.1|12732_13455_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_002224265.1|13707_14502_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	3.7e-141
WP_002224267.1|14802_15060_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	94.1	1.3e-34
WP_042665977.1|15461_16484_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_042665979.1|16483_17263_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_002211769.1|17392_18001_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|18302_21191_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|21271_21850_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002214118.1|21906_26538_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211773.1|26559_27147_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|27134_27932_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211775.1|27924_28623_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	7.1e-136
WP_000440566.1|28712_29048_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|29089_33667_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|33674_33899_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|34024_34342_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|34401_35148_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|35222_35606_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|35607_36081_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|36071_36416_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|36513_37347_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|37346_37781_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|37824_38487_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|38561_39437_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_042469162.1|40386_41961_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	7.1e-301
WP_002211787.1|41994_43251_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|43253_43895_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|44090_44357_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|44366_45257_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|45262_45517_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|45509_46148_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|46144_46813_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|46812_47511_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|47575_49135_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|49137_49416_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|49475_49898_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_014501254.1|49902_50430_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	97.3	7.1e-80
WP_002211799.1|50753_51404_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|51488_51716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213759.1|51825_52284_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002214145.1|52492_53062_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213303.1|53074_53821_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_038918515.1|53810_54170_-	hypothetical protein	NA	J9Q741	Salmonella_phage	100.0	5.2e-58
WP_002213300.1|55956_57042_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002213298.1|57457_58480_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002214160.1|58839_59484_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	1.8e-122
WP_002214164.1|60228_61293_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|61861_62074_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|62073_62409_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|62405_62585_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|62625_62901_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|62968_63379_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|63362_63734_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|63887_64718_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|64721_64922_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_161597819.1|65012_66044_-	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_000920226.1|66091_66358_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|66357_67302_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|67362_68391_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_011114024.1|68510_68942_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	97.9	2.2e-71
WP_002215095.1|69162_69414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213141.1|69486_70050_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002425587.1|70079_70505_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002221186.1|70519_74044_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
73777:73794	attL	CCAATGATTCCATACATC	NA	NA	NA	NA
WP_002211767.1|74224_75460_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|75556_77923_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002228800.1|78032_78245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228802.1|78507_78894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353208.1|78888_79992_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
86835:86852	attR	GATGTATGGAATCATTGG	NA	NA	NA	NA
>prophage 2
NZ_CP009989	Yersinia pestis strain Nicholisk 41 plasmid 1, complete sequence	99286	86394	96350	99286	transposase	Salmonella_phage(37.5%)	12	NA	NA
WP_002224363.1|86394_86700_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	3.2e-48
WP_002224361.1|86845_87061_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	7.7e-33
WP_002233024.1|87220_88258_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.4	1.8e-207
WP_001297096.1|88333_89113_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|89112_90135_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211744.1|90258_92268_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_002211745.1|92340_92571_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211746.1|93283_93790_-	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211747.1|94188_94968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|95021_95441_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211748.1|95451_95673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|95672_96350_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
>prophage 1
NZ_CP009990	Yersinia pestis strain Nicholisk 41 plasmid 2, complete sequence	68552	8373	63999	68552	protease,transposase	Enterobacteria_phage(40.0%)	57	NA	NA
WP_002213006.1|8373_9342_+|protease	T3SS effector cysteine protease YopT	protease	NA	NA	NA	NA
WP_002213004.1|9341_9740_+	type III secretion system chaperone SycT	NA	NA	NA	NA	NA
WP_002393889.1|10513_10864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116442925.1|11612_11858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002222517.1|12099_13392_-	T3SS effector E3 ubiquitin ligase YopM	NA	NA	NA	NA	NA
WP_002229781.1|13722_13932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212987.1|15269_16190_-	type III secretion system translocon subunit YopD	NA	NA	NA	NA	NA
WP_002212985.1|16208_17414_-	type III secretion system translocon subunit YopB	NA	NA	NA	NA	NA
WP_002222758.1|17391_17898_-	type III secretion system chaperone LcrH	NA	NA	NA	NA	NA
WP_002212981.1|17910_18891_-	type III secretion system protein LcrV	NA	NA	NA	NA	NA
WP_002212973.1|18892_19180_-	type III secretion protein LcrG	NA	NA	NA	NA	NA
WP_002220918.1|19221_19662_-	type III secretion system regulator LcrR	NA	NA	NA	NA	NA
WP_002212971.1|19658_21773_-	type III secretion system export apparatus subunit SctV	NA	NA	NA	NA	NA
WP_002229791.1|21759_22104_-	type III secretion system chaperone YscY	NA	NA	NA	NA	NA
WP_002212969.1|22100_22469_-	type III secretion system protein YscX	NA	NA	NA	NA	NA
WP_002229794.1|22465_22837_-	type III secretion chaperone SycN	NA	NA	NA	NA	NA
WP_002212965.1|22823_23102_-	type III secretion system gatekeeper subunit TyeA	NA	NA	NA	NA	NA
WP_002212958.1|23082_23964_-	type III secretion system gatekeeper subunit YopN	NA	NA	NA	NA	NA
WP_002212955.1|24161_25481_+	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_002212952.1|25477_25942_+	type III secretion system central stalk protein YscO	NA	NA	NA	NA	NA
WP_002212950.1|25941_27309_+	type III secretion system needle length determinant	NA	NA	NA	NA	NA
WP_002212948.1|27305_28229_+	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_002212947.1|28225_28879_+	type III secretion system export apparatus protein SctR	NA	NA	NA	NA	NA
WP_002212945.1|28880_29147_+	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_002212938.1|29143_29929_+	type III secretion system export apparatus protein SctT	NA	NA	NA	NA	NA
WP_002212936.1|29928_30993_+	type III secretion system export apparatus switch protein YscU	NA	NA	NA	NA	NA
WP_002222527.1|31568_31964_+	type III secretion system chaperone YscW	NA	NA	NA	NA	NA
WP_002212931.1|32087_32903_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002229797.1|32981_33080_+	type III secretion system protein YscA	NA	NA	NA	NA	NA
WP_002212925.1|33305_33719_+	type III secretion system chaperone YscB	NA	NA	NA	NA	NA
WP_002212919.1|35543_36803_+	type III secretion system inner membrane ring subunit SctD	NA	NA	NA	NA	NA
WP_002212917.1|36799_37000_+	EscE/YscE/SsaE family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
WP_002212916.1|37000_37264_+	type III secretion system needle filament subunit SctF	NA	NA	NA	NA	NA
WP_002229801.1|37265_37613_+	YscG family type III secretion protein	NA	NA	NA	NA	NA
WP_002212915.1|37609_38107_+	YopR family type III secretion effector	NA	NA	NA	NA	NA
WP_002212914.1|38107_38455_+	type III secretion system inner rod subunit SctI	NA	NA	NA	NA	NA
WP_002212912.1|38461_39196_+	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_002361471.1|39195_39825_+	type III secretion system sorting platform protein YscK	NA	NA	NA	NA	NA
WP_002212909.1|39803_40436_+	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_002212907.1|40660_41008_+	type III secretion system exported negative regulator LcrQ/YscM1	NA	NA	NA	NA	NA
WP_002213278.1|43096_44503_-	T3SS effector protein-tyrosine-phosphatase YopH	NA	NA	NA	NA	NA
WP_002225474.1|46185_47052_-	type III secretion system effector acetyltransferase YopJ	NA	NA	NA	NA	NA
WP_002229809.1|49652_50102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213291.1|50847_51087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213292.1|52259_53138_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_002233140.1|53118_53193_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_002229817.1|53434_53689_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_002233137.1|53826_54075_-	phospholipase	NA	A0A1B2LRT6	Wolbachia_phage	47.1	9.2e-06
WP_002213294.1|54491_54899_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.2	4.7e-07
WP_002213244.1|54922_55240_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|55411_55870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469136.1|55938_56208_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014501242.1|58819_61135_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.5	2.9e-279
WP_002213258.1|61298_61850_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002224338.1|61868_62333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229829.1|62471_62801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016640.1|62900_63999_+|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
