The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010301	Campylobacter jejuni subsp. jejuni strain 00-0949, complete genome	1745537	604883	673470	1745537	terminase,tRNA,tail,protease,transposase,plate,integrase	Campylobacter_phage(43.59%)	85	664313:664330	681068:681085
WP_014516733.1|604883_606635_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	29.9	8.8e-10
WP_002852365.1|606725_607586_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_014516734.1|607585_609109_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014516735.1|609214_610459_+	bile resistance response regulator CbrR	NA	NA	NA	NA	NA
WP_002858473.1|610449_611265_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_002852087.1|611264_612383_+	lytic transglycosylase domain-containing protein	NA	A0A218M4G6	Pasteurella_phage	34.1	1.6e-09
WP_002852227.1|612342_613170_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.0	5.6e-23
WP_002858506.1|613175_613664_+	HAD-IIIA family hydrolase	NA	A0A140XBD6	Dickeya_phage	42.0	5.1e-16
WP_002855039.1|613654_614170_+	membrane protein	NA	NA	NA	NA	NA
WP_002852252.1|614151_614613_+	organic solvent tolerance protein OstA	NA	NA	NA	NA	NA
WP_002852258.1|614609_615206_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002852364.1|615202_615697_+	membrane protein	NA	NA	NA	NA	NA
WP_002852196.1|615697_617503_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_010891873.1|617623_619414_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	47.4	1.4e-159
WP_019108583.1|619410_619869_-	di-/tripeptide transporter	NA	A0A0P0IY73	Acinetobacter_phage	50.4	9.9e-30
WP_002859995.1|619811_620126_-	amino acid transporter	NA	NA	NA	NA	NA
WP_019109092.1|620164_620365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079261378.1|620376_620625_-	peptide transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.8	1.0e-17
WP_019109091.1|620651_620846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002873342.1|620971_621520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891874.1|621512_622619_-	membrane protein	NA	NA	NA	NA	NA
WP_002852114.1|622605_623481_-	GTPase Era	NA	NA	NA	NA	NA
WP_002852226.1|623477_624797_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.6	6.2e-40
WP_002781630.1|624793_625336_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_002781628.1|625335_625779_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_020837019.1|625791_627012_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_002864726.1|627167_627413_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_002852319.1|627409_627817_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_002855252.1|627809_628538_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.8	1.4e-25
WP_043012781.1|628537_629788_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002873747.1|637214_637415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002843337.1|637709_638339_+	LexA family transcriptional regulator	NA	A7YG70	Campylobacter_phage	100.0	4.4e-60
WP_002843338.1|638419_638740_+	hypothetical protein	NA	A7YG71	Campylobacter_phage	100.0	2.9e-52
WP_002843339.1|638749_638944_+	hypothetical protein	NA	A7YG72	Campylobacter_phage	100.0	1.8e-28
WP_002865289.1|639023_639311_+	hypothetical protein	NA	A7YGG4	Campylobacter_phage	100.0	1.9e-47
WP_043020473.1|639338_640154_-	DNA adenine methylase	NA	A7YG84	Campylobacter_phage	100.0	1.4e-151
WP_043012783.1|640355_640844_-	virion morphogenesis protein	NA	A7YG85	Campylobacter_phage	100.0	1.2e-89
WP_043012784.1|640847_643064_-|tail	phage tail tape measure protein	tail	A7YG87	Campylobacter_phage	100.0	0.0e+00
WP_002865378.1|643105_643411_+	hypothetical protein	NA	A7YGX3	Campylobacter_phage	100.0	2.7e-39
WP_002873740.1|643522_643762_-|tail	phage tail assembly protein	tail	A7YGZ3	Campylobacter_phage	93.8	9.4e-24
WP_002865376.1|643914_644424_-|tail	tail protein	tail	A7YG76	Campylobacter_phage	100.0	3.3e-90
WP_043012785.1|644450_645644_-|tail	phage tail sheath family protein	tail	A7YG77	Campylobacter_phage	99.7	6.5e-198
WP_043012790.1|645662_646670_-	hypothetical protein	NA	A7YG78	Campylobacter_phage	100.0	1.0e-191
WP_043012791.1|646770_647142_-	DUF1353 domain-containing protein	NA	A7YG79	Campylobacter_phage	100.0	2.0e-68
WP_043012793.1|647138_647645_-	DUF4376 domain-containing protein	NA	A7YG80	Campylobacter_phage	100.0	2.6e-87
WP_043012795.1|647669_648701_-|tail	phage tail protein	tail	A7YG81	Campylobacter_phage	100.0	2.8e-189
WP_043012798.1|648700_649321_-|tail	phage tail protein I	tail	A7YGM6	Campylobacter_phage	97.4	2.8e-59
WP_043012800.1|649317_650484_-|plate	baseplate assembly protein	plate	A0A1X9SH02	Bradyrhizobium_phage	25.8	3.3e-13
WP_002795239.1|650480_650771_-|plate	baseplate assembly protein	plate	Q8H9N4	Vibrio_phage	40.8	2.7e-09
WP_002795238.1|650767_650959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043020458.1|650967_651600_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	33.9	1.0e-08
WP_002784492.1|651599_651914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784496.1|652025_652274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002854893.1|652270_652612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043012804.1|652622_653012_-	DUF882 domain-containing protein	NA	A0A1X9Q0V8	Human_gokushovirus	46.7	8.5e-22
WP_043012806.1|653159_653594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901531.1|653595_654411_+	hypothetical protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	48.4	2.9e-24
WP_038401719.1|654413_654941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784507.1|654943_655921_+	hypothetical protein	NA	R9TRN2	Rhizobium_phage	23.4	3.3e-06
WP_002917934.1|656035_656494_+	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_002803360.1|656486_657086_+	DUF1804 family protein	NA	NA	NA	NA	NA
WP_043012811.1|657085_658756_+|terminase	phage terminase large subunit	terminase	H1ZZE1	Pseudomonas_virus	41.2	8.8e-92
WP_002821550.1|658765_660136_+	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	26.6	5.8e-17
WP_043012813.1|660138_661374_+	hypothetical protein	NA	Q6QIB9	Burkholderia_phage	34.7	1.2e-29
WP_002876309.1|661499_661874_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002784520.1|661866_662058_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002855003.1|662051_663029_+|tail	tail protein	tail	A0A219Y9Y2	Aeromonas_phage	25.7	6.2e-13
WP_002878915.1|663025_663931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002865476.1|663896_664103_-	CJH_07325 family protein	NA	S5VYW8	Campylobacter_phage	47.0	2.4e-07
WP_043012815.1|664224_664509_-	DNA-binding protein	NA	NA	NA	NA	NA
664313:664330	attL	TCCGCACTTGCATTTTTA	NA	NA	NA	NA
WP_043012816.1|664602_665274_+	deoxyribonuclease	NA	NA	NA	NA	NA
WP_002873721.1|665265_665541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002876315.1|665587_666037_-	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_041160245.1|666033_666726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784531.1|666725_666995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043012817.1|666991_667954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002791413.1|668063_668450_-	hypothetical protein	NA	D5GVQ0	Campylobacter_virus	56.4	2.7e-36
WP_043012818.1|668446_668719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043012819.1|668782_668962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002824159.1|668958_669444_-	host-nuclease inhibitor protein Gam	NA	A0A2K9VGT9	Faecalibacterium_phage	32.7	9.3e-18
WP_043012820.1|669550_669892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002824157.1|670024_670210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002791422.1|670206_670398_-	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_043012822.1|670400_671324_-	AAA family ATPase	NA	A0A2H4JAW1	uncultured_Caudovirales_phage	25.0	5.1e-09
WP_043012824.1|671394_673470_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
681068:681085	attR	TAAAAATGCAAGTGCGGA	NA	NA	NA	NA
>prophage 2
NZ_CP010301	Campylobacter jejuni subsp. jejuni strain 00-0949, complete genome	1745537	1143523	1201246	1745537	head,terminase,tRNA,tail,transposase,plate,integrase	Campylobacter_phage(31.25%)	71	1179022:1179042	1209048:1209068
WP_043012886.1|1143523_1145116_-|tRNA	arginine--tRNA ligase	tRNA	L7RDT2	Acanthamoeba_polyphaga_moumouvirus	23.6	4.1e-06
WP_002852866.1|1145127_1145367_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_002860253.1|1145368_1145992_-	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	33.5	3.3e-20
WP_002852900.1|1145988_1147617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002852712.1|1147673_1148441_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_002852807.1|1148427_1149063_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.3	9.9e-20
WP_002852901.1|1149075_1150149_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002853455.1|1150148_1150940_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_014516809.1|1151055_1152219_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	37.2	1.5e-53
WP_002852693.1|1152346_1153471_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_002852758.1|1153467_1154718_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_002852880.1|1154719_1155223_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_043012887.1|1156591_1157221_+	LexA family transcriptional regulator	NA	A7YG70	Campylobacter_phage	96.5	5.3e-58
WP_002865000.1|1157301_1157622_+	hypothetical protein	NA	A7YGI4	Campylobacter_phage	100.0	1.3e-52
WP_043012888.1|1157631_1157826_+	hypothetical protein	NA	A7YG72	Campylobacter_phage	98.4	3.9e-28
WP_002865289.1|1157905_1158193_+	hypothetical protein	NA	A7YGG4	Campylobacter_phage	100.0	1.9e-47
WP_032598505.1|1158220_1159036_-	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	99.6	3.1e-151
WP_002865687.1|1159137_1160106_-|tail	phage tail protein	tail	A0A219Y9Y2	Aeromonas_phage	26.8	4.3e-14
WP_002789964.1|1160099_1160291_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002870151.1|1160283_1160658_-|tail	tail protein	tail	NA	NA	NA	NA
WP_043012889.1|1160659_1162624_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002870149.1|1162653_1162884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002789979.1|1162991_1163228_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002789981.1|1163238_1163754_-|tail	tail protein	tail	Q858V0	Yersinia_virus	26.3	2.6e-10
WP_043020461.1|1163876_1165067_-|tail	phage tail sheath family protein	tail	A7YG77	Campylobacter_phage	98.7	1.4e-195
WP_043020462.1|1165085_1166093_-	hypothetical protein	NA	A7YG78	Campylobacter_phage	98.2	2.6e-187
WP_043012791.1|1166193_1166565_-	DUF1353 domain-containing protein	NA	A7YG79	Campylobacter_phage	100.0	2.0e-68
WP_043020463.1|1166561_1167068_-	DUF4376 domain-containing protein	NA	A7YG80	Campylobacter_phage	98.8	3.1e-85
WP_043020464.1|1168840_1170007_-|plate	baseplate assembly protein	plate	A0A1X9SH02	Bradyrhizobium_phage	25.8	3.3e-13
WP_002795239.1|1170003_1170294_-|plate	baseplate assembly protein	plate	Q8H9N4	Vibrio_phage	40.8	2.7e-09
WP_002795238.1|1170290_1170482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002827116.1|1170490_1171123_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	35.6	4.6e-09
WP_002865847.1|1171119_1171584_-	DUF1804 family protein	NA	NA	NA	NA	NA
WP_043012893.1|1171714_1172755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002790002.1|1172754_1173642_+|head	head protein	head	A0A2K9VH18	Faecalibacterium_phage	43.7	3.5e-63
WP_019108985.1|1173641_1173911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002790896.1|1173907_1174261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002790266.1|1174257_1174623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002878913.1|1174612_1175002_+	DUF882 domain-containing protein	NA	A0A1X9Q0V8	Human_gokushovirus	46.3	6.5e-22
WP_002865466.1|1175012_1175354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784496.1|1175350_1175599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002790261.1|1175710_1176025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043012894.1|1176114_1177641_+|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	31.1	4.9e-49
WP_002870186.1|1177637_1179020_+	DUF935 family protein	NA	A0A0M3LRU4	Mannheimia_phage	22.7	8.2e-11
WP_002870187.1|1179012_1180146_+	hypothetical protein	NA	A0A1C6ZDL9	Pseudomonas_phage	34.2	5.1e-27
1179022:1179042	attL	ATTTTTAACAAAAGCGTAGAT	NA	NA	NA	NA
WP_002918728.1|1180284_1180764_-	hypothetical protein	NA	A7YGZ0	Campylobacter_phage	30.2	2.8e-06
WP_002918730.1|1180750_1180942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002790255.1|1180993_1181422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002864977.1|1181418_1181598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002791413.1|1181712_1182099_-	hypothetical protein	NA	D5GVQ0	Campylobacter_virus	56.4	2.7e-36
WP_002791414.1|1182095_1182368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043012819.1|1182431_1182611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002806832.1|1182607_1183093_-	host-nuclease inhibitor protein Gam	NA	A0A2K9VGT9	Faecalibacterium_phage	34.0	3.2e-18
WP_043020465.1|1183287_1183626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002865075.1|1183699_1184131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002824157.1|1184186_1184372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002795448.1|1184368_1184560_-	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_002790751.1|1184556_1185414_-	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	31.2	9.6e-26
WP_043012897.1|1185501_1187619_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002790505.1|1187619_1187820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020836814.1|1188099_1188789_+	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	28.4	7.7e-10
WP_002889833.1|1189166_1191026_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_002777340.1|1191113_1191611_-	bipartate energy taxis response protein CetB	NA	A0A1B0V854	Salmonella_phage	41.6	1.8e-21
WP_002790076.1|1191628_1193008_-	bipartate energy taxis response protein CetA	NA	A0A2H4J162	uncultured_Caudovirales_phage	55.6	5.9e-17
WP_043012899.1|1193128_1193623_-	energy taxis response protein CetC	NA	A0A1B0V854	Salmonella_phage	39.3	3.6e-17
WP_002868577.1|1193891_1195268_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_002889830.1|1195264_1196071_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_043012900.1|1196212_1197739_+	inorganic phosphate transporter	NA	M4QMY4	Ostreococcus_lucimarinus_virus	27.3	6.7e-38
WP_002927156.1|1197746_1198925_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002859277.1|1198934_1199831_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_043012901.1|1199827_1201246_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
1209048:1209068	attR	ATTTTTAACAAAAGCGTAGAT	NA	NA	NA	NA
>prophage 3
NZ_CP010301	Campylobacter jejuni subsp. jejuni strain 00-0949, complete genome	1745537	1284428	1327783	1745537	head,terminase,tRNA,tail,portal,capsid,integrase	Campylobacter_phage(100.0%)	58	1286935:1286952	1304937:1304954
WP_002858203.1|1284428_1285607_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_072224431.1|1285606_1286842_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_002858282.1|1286786_1287755_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
1286935:1286952	attL	ATAAAATACAAAAAATAA	NA	NA	NA	NA
WP_002864601.1|1287832_1288933_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_002787311.1|1289271_1290447_+|integrase	site-specific integrase	integrase	X2KXI6	Campylobacter_phage	100.0	1.7e-222
WP_002787309.1|1290443_1290650_-	helix-turn-helix domain-containing protein	NA	X2KXB9	Campylobacter_phage	100.0	4.8e-32
WP_043012742.1|1290651_1291005_-	hypothetical protein	NA	X2KR94	Campylobacter_phage	100.0	9.6e-57
WP_043012741.1|1291001_1291739_-	phage protein	NA	X2KM03	Campylobacter_phage	100.0	1.4e-134
WP_043012740.1|1292114_1292351_-	helix-turn-helix domain-containing protein	NA	X2KQ78	Campylobacter_phage	100.0	2.9e-33
WP_043012739.1|1292456_1293212_-	site-specific DNA-methyltransferase	NA	X2KXI8	Campylobacter_phage	100.0	7.4e-147
WP_002787304.1|1293189_1293456_-	hypothetical protein	NA	X2KLR9	Campylobacter_phage	100.0	4.7e-40
WP_002858334.1|1293439_1293811_-	hypothetical protein	NA	X2KQ09	Campylobacter_phage	100.0	1.2e-60
WP_002787300.1|1293811_1294036_-	hypothetical protein	NA	X2KM06	Campylobacter_phage	100.0	1.8e-37
WP_002787298.1|1294044_1294806_-	hypothetical protein	NA	X2KQ81	Campylobacter_phage	100.0	1.4e-124
WP_002787295.1|1294742_1295057_-	hypothetical protein	NA	X2KR17	Campylobacter_phage	100.0	1.6e-50
WP_002787293.1|1295135_1295456_-	hypothetical protein	NA	X2KLS2	Campylobacter_phage	100.0	1.4e-51
WP_002787289.1|1295843_1296080_-	hypothetical protein	NA	X2KXC5	Campylobacter_phage	100.0	8.1e-36
WP_002787287.1|1296093_1296861_-	hypothetical protein	NA	X2KRC2	Campylobacter_phage	100.0	3.7e-138
WP_002787283.1|1296998_1297229_-	hypothetical protein	NA	X2KLS5	Campylobacter_phage	100.0	5.0e-38
WP_002787281.1|1297194_1297458_-	hypothetical protein	NA	X2KQ17	Campylobacter_phage	100.0	4.1e-44
WP_002787279.1|1297514_1297802_-	hypothetical protein	NA	X2KXC8	Campylobacter_phage	100.0	2.4e-50
WP_002801548.1|1297854_1298586_-	DNA-binding protein	NA	X2KQ88	Campylobacter_phage	100.0	9.7e-128
WP_002788580.1|1299016_1299301_-	hypothetical protein	NA	X2KRM3	Campylobacter_phage	100.0	2.3e-40
WP_002858450.1|1299297_1299501_-	hypothetical protein	NA	X2KRB3	Campylobacter_phage	100.0	6.3e-29
WP_002788578.1|1299714_1300098_+	Cro/Cl family transcriptional regulator	NA	X2KPM6	Campylobacter_phage	100.0	1.0e-43
WP_002788577.1|1300101_1300419_+	hypothetical protein	NA	X2KX12	Campylobacter_phage	100.0	2.5e-48
WP_002788576.1|1300420_1301401_+	DNA polymerase III subunit epsilon	NA	X2KQX9	Campylobacter_phage	100.0	2.5e-187
WP_002858053.1|1301410_1302031_+	hypothetical protein	NA	X2KQS5	Campylobacter_phage	100.0	6.1e-107
WP_002858176.1|1302032_1303811_+	NTPase KAP	NA	X2KLG0	Campylobacter_phage	100.0	0.0e+00
WP_002905815.1|1303865_1304063_-	hypothetical protein	NA	X2KPN2	Campylobacter_phage	100.0	1.5e-27
WP_002857883.1|1303980_1304400_-	hypothetical protein	NA	X2KX19	Campylobacter_phage	100.0	6.3e-55
WP_002858146.1|1304461_1304920_-	hypothetical protein	NA	X2KQY5	Campylobacter_phage	100.0	2.0e-83
WP_002801920.1|1304968_1306252_-	hypothetical protein	NA	X2KRN1	Campylobacter_phage	100.0	1.3e-239
1304937:1304954	attR	TTATTTTTTGTATTTTAT	NA	NA	NA	NA
WP_011049932.1|1306248_1306623_-	DUF1353 domain-containing protein	NA	X2KPN9	Campylobacter_phage	100.0	3.4e-68
WP_002874384.1|1306615_1306999_-	hypothetical protein	NA	X2KX26	Campylobacter_phage	100.0	2.4e-61
WP_043020466.1|1306995_1307628_-	DUF4376 domain-containing protein	NA	X2KQZ1	Campylobacter_phage	100.0	5.9e-97
WP_002875080.1|1307640_1308090_-	hypothetical protein	NA	X2KQT3	Campylobacter_phage	100.0	3.0e-79
WP_002858267.1|1308091_1309657_-	hypothetical protein	NA	X2KRN6	Campylobacter_phage	100.0	1.1e-205
WP_002788297.1|1309649_1310282_-	hypothetical protein	NA	X2KRC7	Campylobacter_phage	100.0	7.9e-110
WP_002788295.1|1310278_1310596_-|head,tail	head-tail adaptor protein	head,tail	X2KXD7	Campylobacter_phage	100.0	9.2e-51
WP_002788293.1|1310608_1311046_-|head,tail	phage gp6-like head-tail connector protein	head,tail	X2KR38	Campylobacter_phage	100.0	1.8e-76
WP_002788291.1|1311042_1311294_-	hypothetical protein	NA	X2KLU2	Campylobacter_phage	100.0	3.7e-18
WP_002788288.1|1311304_1312471_-|capsid	phage major capsid protein	capsid	X2KQ31	Campylobacter_phage	100.0	2.8e-214
WP_002788287.1|1312487_1313045_-	peptidase	NA	X2KXE1	Campylobacter_phage	100.0	1.1e-96
WP_002788286.1|1313130_1314000_-	hypothetical protein	NA	X2KRE5	Campylobacter_phage	100.0	3.9e-168
WP_002800774.1|1314012_1319739_-	hypothetical protein	NA	X2KLJ2	Campylobacter_phage	100.0	0.0e+00
WP_043012736.1|1319798_1320137_+	hypothetical protein	NA	X2KRP3	Campylobacter_phage	100.0	1.6e-56
WP_002788282.1|1320128_1320344_-	hypothetical protein	NA	X2KXE3	Campylobacter_phage	100.0	2.2e-32
WP_002788281.1|1320424_1320781_-	hypothetical protein	NA	X2KRE9	Campylobacter_phage	100.0	1.8e-58
WP_002800772.1|1320777_1321758_-	hypothetical protein	NA	X2KXL7	Campylobacter_phage	100.0	2.3e-180
WP_002788276.1|1321929_1322280_-	hypothetical protein	NA	X2KXE7	Campylobacter_phage	100.0	7.3e-57
WP_002800770.1|1322280_1322823_-	hypothetical protein	NA	X2KRF4	Campylobacter_phage	100.0	5.7e-93
WP_002788272.1|1322819_1323992_-|portal	phage portal protein	portal	X2KR48	Campylobacter_phage	100.0	3.1e-216
WP_002788265.1|1324151_1324586_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	X2KQB2	Campylobacter_phage	100.0	3.2e-78
WP_011049938.1|1324640_1326266_-|terminase	terminase large subunit	terminase	X2KXM1	Campylobacter_phage	100.0	0.0e+00
WP_011049939.1|1326269_1326905_-|terminase	terminase	terminase	X2KRQ1	Campylobacter_phage	100.0	1.9e-111
WP_002788260.1|1327164_1327506_-	HNH endonuclease	NA	X2KRE4	Campylobacter_phage	100.0	1.1e-62
WP_002788257.1|1327492_1327783_-	hypothetical protein	NA	X2KM44	Campylobacter_phage	97.4	2.6e-15
>prophage 4
NZ_CP010301	Campylobacter jejuni subsp. jejuni strain 00-0949, complete genome	1745537	1465749	1472385	1745537		Tupanvirus(16.67%)	8	NA	NA
WP_002857908.1|1465749_1466415_-	D-glycero-D-manno-heptose 1-phosphate guanosyltransferase	NA	A0A2K9L821	Tupanvirus	26.6	4.1e-08
WP_002857991.1|1466402_1467008_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	35.0	2.2e-16
WP_002858413.1|1466995_1468015_-	D-glycero-D-manno-heptose 7-phosphate kinase	NA	A0A222YW25	Synechococcus_phage	40.7	2.7e-59
WP_002857889.1|1468034_1468886_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_002858299.1|1468904_1469846_-	NAD-dependent epimerase/dehydratase	NA	A0A0F7LC08	uncultured_marine_virus	46.1	1.0e-73
WP_002864205.1|1469869_1470910_-	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	44.4	1.7e-69
WP_002852387.1|1470909_1471836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002858190.1|1471839_1472385_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	32.4	6.1e-18
