The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010524	Bacillus paralicheniformis strain BL-09, complete genome	4388022	662704	751270	4388022	head,tail,capsid,integrase,tRNA,portal,protease,plate,terminase,holin	Bacillus_phage(38.46%)	105	673010:673031	709321:709342
WP_043054090.1|662704_663181_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_020450324.1|663161_663851_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_023855532.1|663863_664322_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_026578976.1|664311_665337_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.2	3.5e-67
WP_020450327.1|665576_667502_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.5	4.9e-62
WP_020450328.1|667648_668155_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_020450329.1|668158_668803_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_020450330.1|668841_669015_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_020450331.1|669021_669798_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	25.6	1.4e-15
WP_020450332.1|669842_670037_-	YdiK family protein	NA	NA	NA	NA	NA
WP_020450333.1|670033_670768_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003179248.1|670993_671278_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	2.9e-19
WP_020450334.1|671322_672957_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.7	4.8e-159
673010:673031	attL	TTGCCCACATTTTGCCCACAGT	NA	NA	NA	NA
WP_043054091.1|673038_674256_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	64.4	6.8e-142
WP_043054092.1|674269_674902_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	62.6	4.7e-70
WP_043054093.1|675065_675314_+	helix-turn-helix transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	65.8	4.3e-19
WP_043054094.1|675347_675542_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043054095.1|675555_675747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052500251.1|675706_676390_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_043054096.1|676458_677163_+	Rha family transcriptional regulator	NA	A0A0S2MVD8	Bacillus_phage	68.3	1.1e-83
WP_043054097.1|677212_677557_+	hypothetical protein	NA	A0A0K2CZE4	Paenibacillus_phage	59.6	3.5e-11
WP_025807799.1|677561_677771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009330098.1|677760_677973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043054098.1|678026_678308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052252274.1|678294_678693_-	hypothetical protein	NA	R9VW35	Paenibacillus_phage	34.6	4.3e-05
WP_039073007.1|678745_678976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054099.1|678968_679826_+	DNA damage-inducible protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	52.4	1.1e-61
WP_043054100.1|679809_680643_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	37.4	8.4e-35
WP_017474695.1|680966_681515_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	43.3	5.2e-09
WP_017474694.1|681619_681769_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_017474644.1|681839_682040_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.9	4.2e-09
WP_017474645.1|682075_682309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054101.1|682457_682706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054102.1|683005_683446_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	51.1	3.1e-36
WP_043054103.1|683445_683988_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	61.1	1.5e-56
WP_142368620.1|684352_684562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054105.1|684558_685062_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_043054106.1|685211_685628_-	pilus assembly protein HicB	NA	D6R430	Bacillus_phage	86.9	1.6e-66
WP_043054107.1|685684_685867_-	type II toxin-antitoxin system HicA family toxin	NA	D6R431	Bacillus_phage	90.0	1.7e-25
WP_043054108.1|686128_686377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052500252.1|686366_686657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054109.1|686653_686860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080781389.1|686856_687228_+	HNH endonuclease	NA	A0A1C8E9C7	Bacillus_phage	50.8	3.9e-32
WP_043054550.1|687305_687710_+	hypothetical protein	NA	A0A1C8E969	Bacillus_phage	44.9	9.4e-24
WP_043054551.1|687754_689461_+|terminase	terminase large subunit	terminase	A0A1B0T685	Bacillus_phage	56.5	4.6e-189
WP_043054111.1|689473_690652_+|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	54.0	1.2e-108
WP_043054112.1|690644_691235_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	56.9	4.8e-53
WP_043054113.1|691231_692530_+|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	54.5	3.2e-89
WP_080781414.1|692516_692798_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	46.0	3.8e-16
WP_142368619.1|692757_693117_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_052500255.1|693094_693508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054116.1|693504_693885_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_043054117.1|693884_694517_+	hypothetical protein	NA	A0A2H4J8F3	uncultured_Caudovirales_phage	31.5	4.9e-19
WP_043054118.1|694516_694879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052500256.1|695082_699402_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	43.3	2.1e-65
WP_043054119.1|699398_700226_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_043054120.1|700239_702126_+	autolysin	NA	D6R400	Bacillus_phage	31.0	2.9e-67
WP_043054121.1|704131_705496_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	38.4	1.6e-54
WP_043054122.1|705507_705822_+	phage-like protein	NA	M4ZR44	Bacillus_phage	46.2	1.4e-14
WP_043054123.1|705818_706001_+	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	50.0	2.3e-06
WP_009329192.1|706063_706333_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	58.4	1.4e-20
WP_043054124.1|706348_706612_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	71.3	3.3e-30
WP_043054125.1|706663_707506_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	56.1	3.7e-46
WP_043054126.1|707751_708321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043054127.1|708547_708766_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_043054128.1|708845_709067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026578971.1|709916_710126_+	hypothetical protein	NA	NA	NA	NA	NA
709321:709342	attR	TTGCCCACATTTTGCCCACAGT	NA	NA	NA	NA
WP_020450369.1|710268_711186_+	cell wall maintenance factor YoaR	NA	NA	NA	NA	NA
WP_020450370.1|711302_711752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025811980.1|711777_712044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035337107.1|712141_712603_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035337105.1|712671_713346_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	70.9	1.0e-54
WP_020450373.1|713385_713616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450374.1|713776_714391_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043054130.1|714406_717031_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	34.5	3.0e-38
WP_020450376.1|717057_717342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450377.1|717407_717770_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_043054131.1|717853_718618_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020450379.1|718771_720247_+	carboxylesterase/lipase family protein	NA	S4VZJ7	Pandoravirus	41.3	3.0e-35
WP_020450380.1|720267_721545_-	MFS transporter	NA	NA	NA	NA	NA
WP_020450381.1|721914_722595_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_020450382.1|722630_723656_+	TFIIB-type zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_025811966.1|723655_724423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020450384.1|724443_725418_+	phage protein YdjI	NA	NA	NA	NA	NA
WP_020450385.1|725654_726710_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020450386.1|726745_727573_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_020450387.1|727720_728353_+	LysE family transporter	NA	NA	NA	NA	NA
WP_020450388.1|728546_729191_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020450389.1|729206_730364_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_020450390.1|730360_731503_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_020450393.1|732169_732595_-	VOC family protein	NA	NA	NA	NA	NA
WP_020450394.1|732689_733637_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_020450395.1|733929_734607_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_039073307.1|734678_736058_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_020450397.1|736188_737727_+	alpha-amylase	NA	NA	NA	NA	NA
WP_020450398.1|737894_738845_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_043054132.1|738960_740724_+	alpha-glycosidase	NA	NA	NA	NA	NA
WP_026578955.1|740818_742072_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_043054133.1|742113_743421_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_023855564.1|743421_744273_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_043054554.1|744277_745162_+	DUF1189 domain-containing protein	NA	NA	NA	NA	NA
WP_043054134.1|745139_747476_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_043054135.1|747417_749124_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_043054136.1|749120_749801_+	beta-phosphoglucomutase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	29.6	1.7e-09
WP_043054137.1|750016_751270_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP010524	Bacillus paralicheniformis strain BL-09, complete genome	4388022	777035	786960	4388022		Synechococcus_phage(50.0%)	9	NA	NA
WP_043054145.1|777035_778331_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	5.9e-19
WP_043054146.1|778405_779122_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.1e-48
WP_003179532.1|779123_779378_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	8.0e-05
WP_043054147.1|779374_780058_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_043054148.1|780041_782270_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.8	3.8e-159
WP_023855588.1|782245_783676_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	4.5e-52
WP_035337048.1|783800_784841_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
WP_035337045.1|784837_785425_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.9	7.0e-28
WP_035337043.1|785421_786960_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	5.6e-77
>prophage 3
NZ_CP010524	Bacillus paralicheniformis strain BL-09, complete genome	4388022	1020121	1084718	4388022	head,tail,transposase,capsid,integrase,protease,coat,tRNA,portal,plate,terminase,holin	Bacillus_phage(40.0%)	83	1020083:1020105	1062533:1062555
1020083:1020105	attL	TTTTTTGCACAAATTTTGCACAA	NA	NA	NA	NA
WP_043054197.1|1020121_1021240_-|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	60.8	7.6e-124
WP_043054198.1|1021254_1021701_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	54.1	2.5e-41
WP_043054199.1|1021704_1022046_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SC14	Paenibacillus_phage	62.8	1.6e-32
WP_052500258.1|1022214_1022466_+	helix-turn-helix transcriptional regulator	NA	A0A2I7SC17	Paenibacillus_phage	72.2	1.3e-26
WP_043054200.1|1022482_1022803_+	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	34.0	4.2e-11
WP_043054201.1|1022821_1023523_+	Rha family transcriptional regulator	NA	A0A0S2MVD8	Bacillus_phage	70.4	9.4e-88
WP_043054202.1|1023718_1024270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043054203.1|1024327_1024546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054204.1|1024538_1025381_+	replication protein	NA	V9QKF6	Oenococcus_phage	43.9	4.5e-52
WP_043054205.1|1025340_1026189_+	AAA family ATPase	NA	Q9MBR8	Staphylococcus_prophage	32.3	5.2e-24
WP_155392279.1|1026178_1026337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054564.1|1026494_1027037_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	43.3	3.9e-09
WP_113742868.1|1027141_1027291_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_043054206.1|1027362_1027563_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	3.6e-08
WP_043054207.1|1027598_1027832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155392280.1|1028043_1028181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054209.1|1028221_1028536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054210.1|1028532_1028781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054211.1|1028820_1029132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054212.1|1029163_1029376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054213.1|1029372_1029555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054214.1|1029736_1030003_+	hypothetical protein	NA	A0A2H4JDM6	uncultured_Caudovirales_phage	39.1	3.5e-11
WP_043054215.1|1030288_1030729_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	51.8	1.4e-36
WP_043054216.1|1030728_1031271_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.6	4.3e-56
WP_043054217.1|1031504_1031696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075213432.1|1032103_1032328_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_043054218.1|1032581_1033250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624192.1|1033325_1033634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054219.1|1033660_1034035_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	6.9e-29
WP_043054220.1|1034265_1034781_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	45.2	9.8e-34
WP_043054221.1|1034777_1036487_+|terminase	terminase large subunit	terminase	W8CZ43	Bacillus_phage	64.1	2.5e-211
WP_035316082.1|1036499_1036691_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_043054222.1|1036691_1038002_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.1	2.4e-105
WP_035338281.1|1037946_1038678_+|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	56.9	2.4e-57
WP_043054223.1|1038717_1039998_+|capsid	phage major capsid protein	capsid	A0A288WGE9	Bacillus_phage	43.5	6.3e-74
WP_052500260.1|1040021_1040465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054224.1|1040479_1040782_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	7.3e-13
WP_043054225.1|1040771_1041080_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	38.6	9.7e-13
WP_043054226.1|1041079_1041478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054227.1|1041474_1041858_+	phage protein	NA	NA	NA	NA	NA
WP_043054228.1|1041872_1042490_+|tail	tail protein	tail	NA	NA	NA	NA
WP_043054229.1|1042543_1042909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054230.1|1043117_1047587_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.4	1.8e-70
WP_043054231.1|1047586_1048423_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	68.2	1.0e-109
WP_043054232.1|1048435_1050148_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	68.2	4.8e-218
WP_043054233.1|1050184_1052140_+	hypothetical protein	NA	U5PWM6	Bacillus_phage	30.4	3.4e-42
WP_043054234.1|1052160_1053504_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	44.1	6.3e-48
WP_043054235.1|1053515_1053830_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	45.2	2.4e-14
WP_043054236.1|1053826_1054012_+	XkdX family protein	NA	NA	NA	NA	NA
WP_043054567.1|1054075_1054345_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	60.7	6.2e-24
WP_043054237.1|1054360_1054624_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	73.6	2.6e-30
WP_043054238.1|1054671_1055625_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	42.0	4.6e-61
WP_043054239.1|1055909_1056545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155392281.1|1056559_1056715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054240.1|1057039_1057438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080781392.1|1057452_1058952_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_043054241.1|1059515_1059761_+	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	60.0	1.3e-20
WP_043054242.1|1060052_1060511_+	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	41.1	6.7e-18
WP_043054243.1|1060524_1061088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054569.1|1061110_1061431_-	YolD-like family protein	NA	O64030	Bacillus_phage	37.7	2.6e-13
WP_043054244.1|1061580_1062264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025811885.1|1063004_1064330_+	TGS domain-containing protein	NA	NA	NA	NA	NA
1062533:1062555	attR	TTTTTTGCACAAATTTTGCACAA	NA	NA	NA	NA
WP_043054245.1|1064551_1067359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054246.1|1067580_1068096_-	HXXEE domain-containing protein	NA	NA	NA	NA	NA
WP_035339157.1|1068205_1068775_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031305076.1|1068902_1069667_+	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_043054570.1|1070018_1071794_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_020450655.1|1071995_1072763_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	4.4e-30
WP_101560623.1|1072759_1073773_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_043054247.1|1073769_1074606_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_020450658.1|1074619_1075750_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_020450659.1|1075780_1076239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450660.1|1076235_1076442_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020450662.1|1076991_1077204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020450663.1|1077310_1078057_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.3	5.4e-09
WP_031305077.1|1078022_1079492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020450665.1|1079481_1080390_+	PqqD family protein	NA	NA	NA	NA	NA
WP_011197680.1|1080386_1080671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023856470.1|1080777_1081047_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_023856471.1|1081372_1082002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025811864.1|1082082_1083231_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_025811863.1|1083294_1084197_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_020450670.1|1084244_1084718_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP010524	Bacillus paralicheniformis strain BL-09, complete genome	4388022	1419542	1491460	4388022	tail,capsid,coat,portal,plate,terminase,holin	Bacillus_phage(27.03%)	86	NA	NA
WP_023856676.1|1419542_1419992_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003180694.1|1420142_1420625_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003180696.1|1420757_1421264_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003180698.1|1421331_1421685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450962.1|1421733_1422120_-|coat	spore coat protein CotV	coat	NA	NA	NA	NA
WP_003180704.1|1422267_1422624_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_020450964.1|1422910_1423120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020450965.1|1423199_1423331_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_020450966.1|1423457_1423715_+	sporulation-specific transcription factor SpoVIF	NA	NA	NA	NA	NA
WP_025811628.1|1423753_1426033_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	35.5	6.6e-90
WP_003180714.1|1426154_1426412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020450968.1|1426451_1427039_-	DedA family protein	NA	NA	NA	NA	NA
WP_023856677.1|1427134_1428121_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	1.2e-53
WP_025811626.1|1428117_1429008_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	57.4	2.9e-86
WP_023856679.1|1429030_1429426_-	GtrA family protein	NA	NA	NA	NA	NA
WP_025811623.1|1429591_1430011_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003180728.1|1430020_1430530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180731.1|1430594_1431317_-	esterase family protein	NA	NA	NA	NA	NA
WP_003180732.1|1431428_1431884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180734.1|1431895_1432384_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_025811621.1|1432463_1433411_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180736.1|1433720_1434845_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.6	9.0e-16
WP_020450974.1|1434834_1436010_+	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	28.7	7.5e-21
WP_025811619.1|1436054_1437245_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_023856686.1|1437416_1437986_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180743.1|1437975_1438260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023856687.1|1438437_1439811_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	24.6	4.5e-09
WP_023856688.1|1439905_1440340_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_043054292.1|1440427_1441378_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_025811615.1|1442580_1442895_+	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	42.7	3.1e-14
WP_025811614.1|1442905_1443886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025811613.1|1443882_1444098_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011197793.1|1446778_1446958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023856696.1|1446995_1447574_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_020450990.1|1447656_1447944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450991.1|1448152_1449043_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023856698.1|1449360_1451190_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_020450993.1|1451217_1452936_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_023856699.1|1452992_1453880_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023856700.1|1453971_1454844_+	DMT family transporter	NA	NA	NA	NA	NA
WP_023856701.1|1454892_1455270_+	glyoxalase	NA	NA	NA	NA	NA
WP_023856702.1|1455314_1455863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025811608.1|1456313_1457054_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	57.6	2.7e-29
WP_023856705.1|1457111_1458536_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_023856706.1|1458552_1459131_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023856707.1|1459506_1459920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023856708.1|1460387_1461035_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.5	1.2e-44
WP_020451004.1|1461047_1461704_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	6.8e-40
WP_020451005.1|1461892_1462246_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.6	3.6e-19
WP_023856709.1|1462418_1462679_+	helix-turn-helix transcriptional regulator	NA	S5MA07	Brevibacillus_phage	43.8	3.0e-07
WP_033155144.1|1462668_1462965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023856711.1|1462965_1463790_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	29.6	2.1e-25
WP_025811606.1|1463689_1464490_+	ATP-binding protein	NA	Q0H276	Geobacillus_phage	47.7	8.0e-59
WP_023856714.1|1464759_1465101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020451011.1|1465097_1465301_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.2	6.4e-13
WP_020451012.1|1465418_1465922_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	39.3	6.4e-22
WP_020451013.1|1466066_1466867_+|terminase	phage terminase small subunit XtmA	terminase	A0A0S2MVB6	Bacillus_phage	51.4	2.6e-65
WP_020451014.1|1466863_1468162_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	60.3	2.5e-150
WP_023856715.1|1468165_1469680_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.3	6.4e-142
WP_020451016.1|1469687_1470536_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	60.6	8.8e-56
WP_020451017.1|1470553_1471489_+|capsid	phage capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.1	3.6e-103
WP_020451018.1|1471598_1471979_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_020451019.1|1471975_1472332_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_023856717.1|1472328_1472817_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	43.9	4.9e-35
WP_023856718.1|1472829_1473270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020451022.1|1473270_1473495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023856719.1|1473494_1474841_+|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	40.5	8.1e-80
WP_003180830.1|1474842_1475286_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
WP_023856720.1|1475450_1475900_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
WP_095290311.1|1475941_1476079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023856721.1|1476082_1479862_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	48.1	3.4e-43
WP_023856722.1|1479854_1480511_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.6	3.1e-24
WP_020451029.1|1480567_1481548_+	hypothetical protein	NA	H7BV96	unidentified_phage	31.4	3.0e-39
WP_023856723.1|1481544_1481853_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.3	1.4e-06
WP_023856724.1|1481871_1482297_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	37.3	7.1e-14
WP_020451032.1|1482289_1483333_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.5	7.0e-71
WP_020451033.1|1483319_1484240_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	31.7	1.4e-14
WP_020451034.1|1484253_1484640_+	phage protein	NA	NA	NA	NA	NA
WP_025811599.1|1484787_1485963_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	39.7	8.8e-22
WP_023856725.1|1486049_1486310_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	69.5	2.1e-24
WP_023856726.1|1486324_1486588_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	7.0e-28
WP_023856727.1|1486640_1487705_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	52.0	5.1e-45
WP_023856728.1|1487802_1488489_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023856729.1|1488501_1489518_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_023856730.1|1489538_1490636_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_023856787.1|1490611_1491460_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	33.3	5.6e-10
>prophage 5
NZ_CP010524	Bacillus paralicheniformis strain BL-09, complete genome	4388022	2535337	2546979	4388022		Staphylococcus_phage(55.56%)	14	NA	NA
WP_023857488.1|2535337_2535931_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	2.6e-14
WP_035338491.1|2535920_2536676_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	37.5	4.7e-08
WP_003183108.1|2536858_2536954_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_035338489.1|2537073_2537595_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_020452011.1|2537605_2537980_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_043054366.1|2538081_2538546_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
WP_020452012.1|2538580_2539777_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.2	1.6e-116
WP_020452013.1|2539798_2540446_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.4	5.2e-40
WP_043054367.1|2540457_2541546_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.2	6.2e-62
WP_020452015.1|2541907_2542252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023857493.1|2542516_2544706_-	AAA family ATPase	NA	A0A220BYT7	Staphylococcus_phage	41.8	2.8e-154
WP_023857494.1|2544922_2545192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043054368.1|2545181_2546312_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	41.2	1.8e-72
WP_043054369.1|2546541_2546979_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	44.6	1.2e-16
