The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007471	Haemophilus influenzae strain C486, complete genome	1846503	1237266	1243944	1846503		Sodalis_phage(16.67%)	9	NA	NA
WP_005688173.1|1237266_1237557_+	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	38.2	1.5e-10
WP_005688175.1|1237609_1238095_+	endopeptidase	NA	A0A2H5BM69	Streptomyces_phage	39.3	2.3e-16
WP_044345631.1|1238160_1239114_+	WYL domain-containing transcriptional regulator	NA	NA	NA	NA	NA
WP_005688179.1|1239172_1239628_+	hypothetical protein	NA	I6X231	Vibriophage	63.0	3.5e-43
WP_005671438.1|1239611_1240322_+	NAD-dependent deacylase	NA	R9TG77	Vibrio_phage	40.1	3.2e-27
WP_005688182.1|1240400_1240895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044345634.1|1241681_1242683_-	cytochrome c	NA	Q9JMN3	Wolbachia_phage	39.8	5.4e-20
WP_005688188.1|1242901_1243102_+	cell division protein FtsK	NA	NA	NA	NA	NA
WP_005688189.1|1243098_1243944_+	NAD-dependent deacetylase	NA	A0A1C3S788	Escherichia_phage	22.9	7.0e-05
>prophage 2
NZ_CP007471	Haemophilus influenzae strain C486, complete genome	1846503	1315054	1327027	1846503	tRNA	Acinetobacter_phage(42.86%)	11	NA	NA
WP_044330129.1|1315054_1317919_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.5	2.1e-149
WP_005659477.1|1317952_1318225_-	hydrogenase maturation factor HybG	NA	NA	NA	NA	NA
WP_080317233.1|1318286_1319720_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	38.0	1.2e-33
WP_042594026.1|1319757_1320759_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	35.3	8.8e-47
WP_005662273.1|1320811_1321198_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_044345677.1|1321246_1321828_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	39.9	5.9e-35
WP_005687196.1|1321840_1323397_-	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	33.2	2.4e-22
WP_044345679.1|1323502_1324267_-	glycosyltransferase	NA	M1HQG0	Paramecium_bursaria_Chlorella_virus	29.6	6.8e-15
WP_005650592.1|1324499_1324997_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_005650594.1|1325016_1325505_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_074031221.1|1326022_1327027_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A222YW41	Synechococcus_phage	40.5	1.2e-51
>prophage 3
NZ_CP007471	Haemophilus influenzae strain C486, complete genome	1846503	1604082	1612600	1846503		uncultured_Caudovirales_phage(16.67%)	9	NA	NA
WP_005686508.1|1604082_1604766_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.7	2.3e-54
WP_044345781.1|1604758_1605184_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	42.7	6.0e-21
WP_005686506.1|1605184_1605820_+	7-carboxy-7-deazaguanine synthase	NA	S4TZT1	uncultured_phage	30.3	8.7e-16
WP_005647470.1|1606218_1606452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074032815.1|1606435_1608619_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.6	1.8e-116
WP_074032816.1|1608738_1609710_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005686499.1|1609724_1610612_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005686498.1|1610621_1611614_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	5.7e-14
WP_005686497.1|1611616_1612600_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	1.4e-20
>prophage 4
NZ_CP007471	Haemophilus influenzae strain C486, complete genome	1846503	1640625	1717963	1846503	integrase,plate,head,protease,tail,terminase,transposase	Haemophilus_phage(48.89%)	87	1684285:1684306	1729037:1729058
WP_012054474.1|1640625_1641981_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_005651852.1|1642069_1642606_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_012054475.1|1642656_1643271_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_044345799.1|1643251_1643770_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_005647567.1|1643773_1644499_+	LPS export ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.3	1.8e-25
WP_005651843.1|1644501_1644996_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_044345802.1|1645013_1645871_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	26.4	3.4e-07
WP_005647570.1|1645915_1647073_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_005693459.1|1647199_1648117_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_044345806.1|1648155_1649421_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_005651835.1|1649504_1650782_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_005657246.1|1650800_1651565_-	cell division protein FtsQ/DivIB	NA	NA	NA	NA	NA
WP_005657248.1|1651564_1652485_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_005657250.1|1652556_1653984_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_005657251.1|1654120_1655176_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_005651826.1|1655187_1656372_-	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_044345808.1|1656393_1657707_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_005661304.1|1657818_1658901_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_044345809.1|1658894_1660268_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_044345810.1|1660281_1661748_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_044345812.1|1661757_1663590_-	peptidoglycan synthase	NA	NA	NA	NA	NA
WP_005647600.1|1663601_1663925_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_042603630.1|1663927_1664893_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_005661293.1|1664923_1665379_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_005667512.1|1665580_1667167_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_061723865.1|1667364_1667595_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_038440031.1|1668124_1669078_-	transaldolase	NA	M4QQ61	Prochlorococcus_phage	32.5	9.7e-11
WP_044345820.1|1669372_1670998_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005661284.1|1671078_1671999_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_005661282.1|1672008_1672944_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_005662746.1|1672953_1673925_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.2e-13
WP_005657282.1|1673921_1674920_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	1.8e-23
WP_074032937.1|1674959_1675838_-	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_005690705.1|1675930_1676548_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_005647634.1|1676662_1678192_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_012054490.1|1678225_1678897_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_005686413.1|1679007_1679511_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_044345822.1|1679563_1680490_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.1	3.8e-36
WP_044345824.1|1681927_1682191_+	hypothetical protein	NA	F6MIM3	Haemophilus_phage	79.1	1.1e-33
WP_044345826.1|1682229_1683075_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	71.4	8.9e-117
WP_005641687.1|1683131_1683251_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006995417.1|1683426_1683915_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	56.2	1.9e-47
WP_044345828.1|1683907_1684534_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	51.5	7.2e-31
1684285:1684306	attL	CTAAAAGTGCGGTTTGTTTTTC	NA	NA	NA	NA
WP_044345829.1|1684546_1686574_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	63.4	2.2e-174
WP_080334578.1|1686577_1687174_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	63.0	1.7e-66
WP_044345832.1|1687170_1688235_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	62.3	4.1e-119
WP_032824912.1|1688249_1688600_-	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	75.0	1.4e-44
WP_044345834.1|1688669_1689305_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	58.1	1.2e-62
WP_044345835.1|1689314_1690439_-|tail	tail protein	tail	F6MIL3	Haemophilus_phage	72.4	2.1e-145
WP_044345836.1|1690428_1691766_-	phage morphogeneis protein	NA	F6MIL2	Haemophilus_phage	45.1	3.1e-108
WP_040034149.1|1691769_1694049_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	48.4	7.6e-155
WP_040034148.1|1694095_1694302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021034874.1|1694316_1694658_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	50.5	1.8e-20
WP_040034146.1|1694657_1695029_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	65.8	3.1e-37
WP_040034144.1|1695038_1696454_-|tail	tail sheath protein	tail	B7SDP8	Haemophilus_phage	63.0	3.9e-157
WP_006995430.1|1696446_1696629_-	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	64.8	8.2e-12
WP_040034143.1|1696600_1697263_-	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	45.0	1.6e-44
WP_040034142.1|1697246_1697678_-	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	61.6	2.7e-37
WP_040034141.1|1697687_1697993_-	hypothetical protein	NA	B7SDP3	Haemophilus_phage	52.0	1.2e-20
WP_040034140.1|1698056_1698980_-|head	head protein	head	B7SDP1	Haemophilus_phage	74.9	7.9e-135
WP_040034139.1|1698979_1700017_-	hypothetical protein	NA	B7SDN9	Haemophilus_phage	47.0	1.4e-68
WP_005662125.1|1700298_1700715_-	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	68.8	4.3e-48
WP_040034138.1|1700850_1702152_-|head	head morphogenesis protein	head	B7SDN5	Haemophilus_phage	68.6	1.5e-171
WP_005661920.1|1702135_1703758_-	DUF935 domain-containing protein	NA	B7SDN1	Haemophilus_phage	68.7	2.8e-204
WP_005661918.1|1703826_1705467_-|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	78.5	3.5e-250
WP_005661916.1|1705603_1706107_-	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	51.8	2.7e-44
WP_005661915.1|1706108_1706375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005661913.1|1706374_1706632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044345843.1|1706755_1707013_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_005661904.1|1707012_1707303_-	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	58.7	4.4e-15
WP_005661902.1|1707456_1707963_-	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	66.0	5.8e-55
WP_005661900.1|1708043_1708472_-	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	44.6	8.7e-28
WP_005661898.1|1708558_1709488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005661897.1|1709541_1709943_-	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	42.2	2.6e-18
WP_005661895.1|1709932_1710481_-	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	51.4	2.2e-47
WP_005661893.1|1710477_1710717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005661891.1|1710825_1711074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005661889.1|1711077_1711638_-	hypothetical protein	NA	A0A0M3LP85	Mannheimia_phage	26.4	4.2e-14
WP_005688591.1|1711970_1712225_-	hypothetical protein	NA	A1YZS4	Burkholderia_virus	45.0	5.7e-11
WP_005659435.1|1712378_1712588_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005659432.1|1712772_1713390_-	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	59.1	3.1e-66
WP_005647090.1|1713390_1713582_-	HTH domain-containing protein	NA	F6MII8	Haemophilus_phage	57.6	9.5e-11
WP_005647009.1|1713590_1713887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005659430.1|1713897_1714779_-	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	75.4	2.9e-118
WP_005659426.1|1714790_1716773_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	F6MII5	Haemophilus_phage	53.3	3.6e-193
WP_032827525.1|1716787_1717051_-	Nlp family transcriptional regulator	NA	F6MII4	Haemophilus_phage	73.6	1.7e-29
WP_005659422.1|1717249_1717963_+	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	43.2	5.7e-40
1729037:1729058	attR	GAAAAACAAACCGCACTTTTAG	NA	NA	NA	NA
>prophage 5
NZ_CP007471	Haemophilus influenzae strain C486, complete genome	1846503	1780268	1789336	1846503		Escherichia_phage(83.33%)	9	NA	NA
WP_044345895.1|1780268_1782113_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.0	3.6e-22
WP_012054520.1|1782237_1782516_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_105872514.1|1782524_1782842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044345896.1|1782861_1783971_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_044345898.1|1784223_1786644_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.2	5.3e-223
WP_042601957.1|1786654_1787272_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.8	1.3e-72
WP_005686309.1|1787273_1788113_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	31.5	7.2e-18
WP_005686307.1|1788224_1788836_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	32.5	2.3e-21
WP_005656004.1|1788835_1789336_+	ferredoxin-type protein NapF	NA	A0A077SLP0	Escherichia_phage	32.0	3.2e-13
