The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010896	Pseudomonas simiae strain PCL1751 chromosome, complete genome	6143950	1261101	1340070	6143950	tail,plate,tRNA,lysis	uncultured_Caudovirales_phage(25.0%)	82	NA	NA
WP_010212749.1|1261101_1261572_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_010212748.1|1261714_1262824_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	34.5	1.4e-21
WP_010212747.1|1262820_1263741_-	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	27.7	5.5e-19
WP_044286704.1|1264176_1266285_+	molybdopterin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_010212745.1|1266362_1266701_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_010212744.1|1266770_1267241_-	bacterioferritin	NA	NA	NA	NA	NA
WP_003208706.1|1267442_1267661_-	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_003172097.1|1267905_1268508_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_010212742.1|1268614_1269286_-	ribonuclease T	NA	NA	NA	NA	NA
WP_010212741.1|1269282_1270329_-	dihydroorotase	NA	NA	NA	NA	NA
WP_044286705.1|1270485_1271394_+	OmpA family protein	NA	NA	NA	NA	NA
WP_010212738.1|1271523_1272741_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_010212736.1|1273364_1273997_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010212735.1|1274081_1274264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010212734.1|1274371_1275010_-	endonuclease III	NA	NA	NA	NA	NA
WP_010212733.1|1275075_1276029_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_021492527.1|1276243_1278295_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010212730.1|1278466_1279561_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_003208688.1|1280051_1280375_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_042571726.1|1280517_1283109_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.5	8.7e-30
WP_010212726.1|1283278_1283650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010212724.1|1283642_1284131_-	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	44.5	3.8e-27
WP_175439628.1|1284389_1285133_+	helix-turn-helix transcriptional regulator	NA	B5TK58	Pseudomonas_phage	87.9	2.0e-120
WP_021492473.1|1285282_1285480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010212721.1|1285730_1286075_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	81.9	3.3e-46
WP_010212719.1|1286096_1286612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010212718.1|1286615_1287227_+|plate	phage baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	53.9	6.6e-45
WP_010212717.1|1287236_1287569_+|plate	phage baseplate protein	plate	A0A2H4JI46	uncultured_Caudovirales_phage	68.2	1.5e-35
WP_044286706.1|1287565_1288561_+|plate	baseplate J/gp47 family protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	63.5	4.6e-112
WP_021492468.1|1288557_1289196_+|tail	phage tail protein I	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	51.9	2.8e-38
WP_044286708.1|1289192_1289732_+|tail	tail fiber protein	tail	B0ZSG1	Halomonas_phage	56.2	1.9e-48
WP_021492466.1|1289800_1290553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021492465.1|1290562_1290799_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_021492464.1|1290884_1291058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021492463.1|1291060_1292227_+|tail	tail protein	tail	B0ZSG8	Halomonas_phage	57.5	7.2e-125
WP_010212707.1|1292226_1292733_+|tail	phage major tail tube protein	tail	Q6R4W3	Vibrio_virus	34.5	6.5e-22
WP_010212706.1|1292785_1293358_+|tail	phage tail assembly protein	tail	B0ZSH0	Halomonas_phage	36.9	2.3e-28
WP_044286710.1|1293485_1294946_+|tail	tail tape measure protein	tail	NA	NA	NA	NA
WP_010212701.1|1294945_1295329_+|tail	phage tail protein	tail	A0A2H4JAC8	uncultured_Caudovirales_phage	53.5	1.8e-32
WP_010212700.1|1295321_1295534_+|tail	tail protein X	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	62.9	1.2e-17
WP_044286711.1|1295543_1296551_+|tail	phage-like tail protein	tail	A0A2H4JH05	uncultured_Caudovirales_phage	53.9	3.4e-99
WP_010212696.1|1296557_1297115_+	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	75.4	5.0e-76
WP_029529227.1|1297102_1297573_+|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	58.1	6.0e-38
WP_010212691.1|1297654_1298155_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	85.5	8.8e-72
WP_003189042.1|1298239_1299298_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.4	2.4e-111
WP_021492459.1|1299306_1299774_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_010212688.1|1299835_1300948_-	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_010212685.1|1301224_1301665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042571731.1|1301844_1302564_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_010212680.1|1302702_1303353_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003172176.1|1303428_1303791_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_010212678.1|1303794_1304721_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003189055.1|1304844_1305624_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_010212676.1|1305771_1306467_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_010212675.1|1306470_1306932_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	51.3	4.5e-38
WP_010212674.1|1306997_1307708_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_021492456.1|1307833_1308304_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_169899532.1|1308401_1309730_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_010212670.1|1310030_1311932_+	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.4	7.2e-74
WP_010212669.1|1312059_1313166_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_044286712.1|1313213_1314383_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_021492454.1|1314385_1314982_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010212665.1|1315237_1315423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044286714.1|1315523_1317149_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_010212662.1|1317494_1319357_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010212660.1|1319420_1320845_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_021492451.1|1321022_1321832_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010212656.1|1321821_1322751_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010212654.1|1322752_1323787_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.5	5.2e-26
WP_010212653.1|1323988_1325140_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010212652.1|1325212_1326670_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010212651.1|1326803_1327715_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010212650.1|1327883_1328594_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_010212648.1|1328742_1330365_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_010212647.1|1330364_1330877_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_010212645.1|1330873_1332133_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_010212644.1|1332129_1332831_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_044286715.1|1332827_1335092_+	hybrid sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	27.4	9.7e-09
WP_010212641.1|1335088_1336099_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_010212639.1|1336150_1337152_+	PleD family two-component system response regulator	NA	A0A127AWB9	Bacillus_phage	35.8	1.1e-17
WP_100215725.1|1337391_1338486_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	2.0e-07
WP_044286716.1|1338570_1340070_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.9	1.3e-83
>prophage 2
NZ_CP010896	Pseudomonas simiae strain PCL1751 chromosome, complete genome	6143950	1413275	1418230	6143950		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_021492421.1|1413275_1414025_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.2	1.1e-62
WP_010212427.1|1414066_1414702_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.7	2.3e-40
WP_044286731.1|1414911_1415748_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	33.3	8.2e-06
WP_042570670.1|1415854_1416859_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.3e-34
WP_002554837.1|1417065_1417275_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.7	2.2e-16
WP_010212421.1|1417663_1418230_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	73.3	8.1e-74
>prophage 3
NZ_CP010896	Pseudomonas simiae strain PCL1751 chromosome, complete genome	6143950	1581103	1634112	6143950	terminase,plate,protease,holin,tail,portal,capsid,integrase,head,lysis	uncultured_Caudovirales_phage(60.98%)	62	1590511:1590537	1636020:1636046
WP_010212202.1|1581103_1582543_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	4.2e-26
WP_010212199.1|1582608_1584042_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_042570712.1|1584136_1584376_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_010212197.1|1584406_1585477_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_010212196.1|1585529_1586003_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_003172487.1|1586013_1586574_-	glycine cleavage system protein R	NA	NA	NA	NA	NA
WP_010212195.1|1586847_1587726_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_010212194.1|1587743_1588859_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_021491032.1|1588863_1589622_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010212191.1|1589649_1590363_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	37.6	3.9e-41
1590511:1590537	attL	GGGTTCGAATCCCTATCTCTCCGCCAT	NA	NA	NA	NA
WP_044286767.1|1591206_1592103_+|protease	serine protease	protease	NA	NA	NA	NA
WP_044286768.1|1592120_1593335_-|integrase	site-specific integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	36.3	9.6e-56
WP_008036021.1|1593331_1593547_-	excisionase family protein	NA	NA	NA	NA	NA
WP_044286769.1|1593713_1595663_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	60.1	8.4e-227
WP_044286770.1|1596225_1596768_-	phosphohydrolase	NA	U5P0T3	Shigella_phage	43.3	9.3e-27
WP_044286771.1|1596764_1596986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044286772.1|1596982_1597384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044286773.1|1597430_1597757_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_044286774.1|1597912_1598197_-	phage antirepressor KilAC domain-containing protein	NA	NA	NA	NA	NA
WP_044286775.1|1598206_1598788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167337364.1|1598784_1598961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044286776.1|1599171_1600194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044286778.1|1600202_1600934_-	peptidase S24	NA	K7PM82	Enterobacteria_phage	38.3	3.8e-31
WP_044286779.1|1601012_1601273_+	hypothetical protein	NA	A0A0D4DBS7	Acinetobacter_phage	44.7	4.2e-09
WP_032889628.1|1601601_1602120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044286782.1|1602112_1602340_+	TraR/DksA C4-type zinc finger protein	NA	A0A2P1CAC2	Salmonella_phage	42.9	2.5e-05
WP_044286783.1|1602329_1604546_+	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	47.6	1.7e-191
WP_044286784.1|1604538_1604904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044286785.1|1605431_1605776_+|holin	pyocin R2, holin	holin	A0A2H4J893	uncultured_Caudovirales_phage	80.6	2.8e-45
WP_044286786.1|1605970_1606528_+	hypothetical protein	NA	A0A2H4JG15	uncultured_Caudovirales_phage	66.3	4.3e-59
WP_044286787.1|1606532_1608557_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4J898	uncultured_Caudovirales_phage	83.6	0.0e+00
WP_044286788.1|1608558_1608765_+	hypothetical protein	NA	A0A2H4JA19	uncultured_Caudovirales_phage	72.1	5.8e-22
WP_044286789.1|1608764_1610246_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	85.6	8.0e-246
WP_044286790.1|1610242_1611373_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	67.5	9.4e-138
WP_044286792.1|1611369_1611708_+|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	86.2	4.0e-44
WP_044286793.1|1611771_1612767_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	88.2	9.0e-169
WP_032889615.1|1612769_1613090_+	hypothetical protein	NA	A0A2H4J879	uncultured_Caudovirales_phage	73.3	5.7e-40
WP_044286794.1|1613086_1613743_+	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	65.6	1.8e-77
WP_044286795.1|1613735_1614254_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	62.8	9.8e-58
WP_044286797.1|1614250_1614826_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	73.5	1.6e-53
WP_044286799.1|1614872_1615064_+	hypothetical protein	NA	A0A2H4J885	uncultured_Caudovirales_phage	52.7	2.6e-08
WP_044286800.1|1615069_1615396_+	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	66.7	3.9e-36
WP_044286801.1|1615392_1616280_+|plate	baseplate J/gp47 family protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	68.4	1.3e-110
WP_044286802.1|1616276_1616882_+|tail	phage tail protein I	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	75.3	4.6e-83
WP_080923186.1|1616878_1618945_+|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	49.9	2.1e-82
WP_044288106.1|1619320_1619620_+|tail	tail fiber protein	tail	B5TK82	Pseudomonas_phage	48.4	1.3e-14
WP_044286803.1|1619718_1620885_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	80.7	1.3e-179
WP_044286804.1|1620898_1621402_+|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	62.9	7.3e-58
WP_044286805.1|1621416_1621719_+|tail	phage tail assembly protein	tail	A0A2H4J873	uncultured_Caudovirales_phage	56.0	5.6e-21
WP_044286806.1|1621859_1624343_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	53.2	1.6e-190
WP_044286807.1|1624352_1625198_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	63.9	4.9e-99
WP_044288107.1|1625172_1625379_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	58.2	3.1e-15
WP_044286808.1|1625395_1626439_+	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	77.0	3.3e-145
WP_044286809.1|1626502_1627066_+	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	78.6	8.1e-82
WP_044286810.1|1627047_1627590_+|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	56.3	1.1e-43
WP_044286811.1|1627739_1628534_+	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	66.5	2.9e-101
WP_044286812.1|1628657_1629407_-	SOS response-associated peptidase family protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	53.1	1.8e-60
WP_044286813.1|1629508_1629934_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	38.7	1.1e-14
WP_044286814.1|1629926_1631201_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	50.6	2.1e-109
WP_052806505.1|1631267_1632119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144407255.1|1632340_1633012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044286815.1|1633020_1634112_-	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	33.1	1.6e-33
1636020:1636046	attR	GGGTTCGAATCCCTATCTCTCCGCCAT	NA	NA	NA	NA
>prophage 4
NZ_CP010896	Pseudomonas simiae strain PCL1751 chromosome, complete genome	6143950	3607354	3617329	6143950	tRNA,protease	uncultured_Caudovirales_phage(71.43%)	12	NA	NA
WP_010209631.1|3607354_3608179_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	71.6	3.4e-105
WP_010209630.1|3608441_3609044_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_010209629.1|3609172_3609667_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_044287352.1|3609772_3610954_-	CoA transferase	NA	NA	NA	NA	NA
WP_021492753.1|3611111_3611504_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	84.5	1.8e-56
WP_010209620.1|3611505_3611856_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	67.8	3.4e-38
WP_010209618.1|3611855_3612134_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	57.6	9.9e-25
WP_010209617.1|3612130_3612466_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	75.7	9.8e-43
WP_021492755.1|3612462_3613464_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	86.0	2.7e-165
WP_010209615.1|3613552_3614548_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_010209614.1|3614653_3616048_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_010209612.1|3616048_3617329_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.6	1.6e-96
>prophage 5
NZ_CP010896	Pseudomonas simiae strain PCL1751 chromosome, complete genome	6143950	3749037	3785025	6143950	coat,protease	Sodalis_phage(33.33%)	31	NA	NA
WP_044287386.1|3749037_3750012_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_044287387.1|3750008_3752327_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_021492811.1|3752442_3753231_-	molecular chaperone	NA	NA	NA	NA	NA
WP_010209447.1|3753256_3753745_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_010209446.1|3753747_3754290_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_010209445.1|3754308_3754851_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_175439637.1|3754844_3755333_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_044287388.1|3755557_3756652_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_021492815.1|3756691_3757984_+	protein kinase	NA	NA	NA	NA	NA
WP_010209440.1|3758100_3758808_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010209437.1|3758917_3760243_-	MFS transporter	NA	NA	NA	NA	NA
WP_010209435.1|3760498_3761395_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010209434.1|3761364_3762225_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044287389.1|3762338_3763448_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_044287390.1|3763476_3764304_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_021492818.1|3764418_3764976_+	cytochrome b	NA	NA	NA	NA	NA
WP_042572102.1|3764965_3765850_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_021492820.1|3765907_3767947_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_021492821.1|3768161_3769292_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_044287391.1|3769288_3770317_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_044287392.1|3770650_3771667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010209424.1|3771708_3772179_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044287393.1|3772325_3774986_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_010209420.1|3774987_3775761_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_010209419.1|3775850_3776750_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044287394.1|3776869_3778075_+	MFS transporter	NA	NA	NA	NA	NA
WP_080923215.1|3778021_3778546_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_044287395.1|3778645_3780520_-	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003174819.1|3780749_3781022_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	1.8e-18
WP_010209415.1|3781170_3783567_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.6	7.1e-220
WP_010209414.1|3783741_3785025_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.7	2.1e-138
>prophage 6
NZ_CP010896	Pseudomonas simiae strain PCL1751 chromosome, complete genome	6143950	4007069	4066768	6143950	terminase,holin,tail,capsid,integrase,lysis	Pseudomonas_phage(42.0%)	79	4009386:4009433	4066847:4066894
WP_010209129.1|4007069_4008455_+	sensor histidine kinase efflux regulator BaeS	NA	W8CYF6	Bacillus_phage	31.4	9.4e-31
WP_010209128.1|4008458_4009142_+	response regulator	NA	NA	NA	NA	NA
WP_156046228.1|4009214_4009370_+	hypothetical protein	NA	NA	NA	NA	NA
4009386:4009433	attL	ATGGTCGGGACGGAGTGATTCGAACACTCGACCCCTAGCACCCCATGC	NA	NA	NA	NA
WP_044287462.1|4009633_4009996_+	hypothetical protein	NA	A0A2H4IZV2	uncultured_Caudovirales_phage	64.5	1.3e-32
WP_044288141.1|4010023_4010704_+	SOS response-associated peptidase family protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	92.4	7.6e-127
WP_021491117.1|4010700_4011495_-	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	66.4	2.4e-100
WP_021491118.1|4011562_4012081_-|lysis	lysis protein	lysis	A0A2H4IZW4	uncultured_Caudovirales_phage	67.1	3.4e-50
WP_044287463.1|4012077_4012611_-	glycoside hydrolase family 19 protein	NA	A0A059VA40	Pseudomonas_phage	80.2	5.3e-75
WP_139136436.1|4012665_4012869_-	hypothetical protein	NA	A0A2D1GNN9	Pseudomonas_phage	73.0	2.0e-19
WP_144407265.1|4012855_4013236_-	hypothetical protein	NA	A0A2D1GNF5	Pseudomonas_phage	75.6	1.2e-49
WP_044287466.1|4015300_4018864_-|tail	phage tail protein	tail	A0A1B0VMH5	Pseudomonas_phage	68.9	0.0e+00
WP_044287467.1|4018923_4019517_-|tail	tail assembly protein	tail	A0A1B0VMI5	Pseudomonas_phage	94.4	3.8e-98
WP_044287468.1|4019570_4019993_-	hypothetical protein	NA	A0A1B0VMH3	Pseudomonas_phage	89.3	1.1e-64
WP_044287469.1|4020224_4021538_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_044287470.1|4021687_4022461_-	C40 family peptidase	NA	A0A1B0VP68	Pseudomonas_phage	89.2	9.9e-139
WP_044287471.1|4022463_4023216_-|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	93.2	4.3e-139
WP_044287472.1|4023227_4023566_-|tail	phage tail protein	tail	A0A1B0VMG7	Pseudomonas_phage	84.8	8.6e-55
WP_044287473.1|4023565_4026619_-|tail	phage tail tape measure protein	tail	A0A1B0VMG8	Pseudomonas_phage	40.2	1.8e-175
WP_139136438.1|4026646_4026922_-	DUF1799 domain-containing protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	57.3	3.7e-24
WP_044287475.1|4026969_4027350_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_044287476.1|4027359_4028019_-|tail	phage tail protein	tail	A0A2H4J591	uncultured_Caudovirales_phage	67.7	3.6e-81
WP_044287477.1|4028058_4028487_-	hypothetical protein	NA	A0A2H4J5P1	uncultured_Caudovirales_phage	73.9	7.3e-51
WP_044287479.1|4028483_4029128_-	hypothetical protein	NA	A0A1B0VMI1	Pseudomonas_phage	74.6	4.4e-84
WP_044287480.1|4029129_4029522_-	hypothetical protein	NA	A0A2H4IZB5	uncultured_Caudovirales_phage	69.2	6.1e-44
WP_044287481.1|4029524_4029902_-	hypothetical protein	NA	A0A2H4J0N2	uncultured_Caudovirales_phage	74.4	2.7e-41
WP_044287482.1|4029912_4030218_-	hypothetical protein	NA	A0A2H4J0G3	uncultured_Caudovirales_phage	45.5	1.0e-22
WP_044287483.1|4030274_4031252_-	hypothetical protein	NA	A0A2H4JIE6	uncultured_Caudovirales_phage	82.8	2.1e-154
WP_044288145.1|4031255_4031993_-	hypothetical protein	NA	A0A2H4J0I7	uncultured_Caudovirales_phage	66.3	9.0e-81
WP_044287484.1|4032080_4032824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044287486.1|4032877_4033363_-	hypothetical protein	NA	A0A1B0VND3	Pseudomonas_phage	34.9	6.2e-22
WP_044287488.1|4033371_4034466_-|capsid	minor capsid protein	capsid	A0A2H4J3G9	uncultured_Caudovirales_phage	71.0	8.2e-139
WP_044287490.1|4034401_4035862_-	DUF4055 domain-containing protein	NA	A0A2H4J0H4	uncultured_Caudovirales_phage	81.6	2.6e-233
WP_044287491.1|4035861_4037352_-|terminase	terminase	terminase	A0A2H4J2I1	uncultured_Caudovirales_phage	90.3	4.8e-275
WP_044287492.1|4037353_4037953_-	hypothetical protein	NA	A0A2H4J2I6	uncultured_Caudovirales_phage	41.5	3.7e-24
WP_044287494.1|4038047_4038503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044287495.1|4038523_4038778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044287496.1|4038774_4038966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044287497.1|4038965_4039196_-	hypothetical protein	NA	A0A1S6UB66	Serratia_phage	62.0	8.2e-17
WP_044287498.1|4039410_4039788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044287499.1|4039784_4040108_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	29.7	9.2e-06
WP_044287500.1|4040429_4040669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044288146.1|4040771_4041005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044287501.1|4041392_4043168_+	GGDEF and EAL domain-containing protein	NA	NA	NA	NA	NA
WP_044287502.1|4043305_4043851_-	hypothetical protein	NA	A0A0H5AWB8	Pseudomonas_phage	66.1	9.6e-64
WP_044287503.1|4043847_4044453_-	recombination protein NinG	NA	A0A0U1VZM0	Pseudomonas_phage	62.4	4.3e-65
WP_044287504.1|4044449_4044965_-	hypothetical protein	NA	A0A2K8I9A9	Pseudomonas_phage	45.0	8.0e-36
WP_044287505.1|4044966_4045776_-	ATP-binding protein	NA	A0A2H4J3E5	uncultured_Caudovirales_phage	63.4	7.3e-92
WP_044287508.1|4045765_4046623_-	replication protein	NA	Q9MC55	Pseudomonas_phage	49.4	1.4e-48
WP_044287510.1|4046688_4047111_-	hypothetical protein	NA	A0A2D1GNM7	Pseudomonas_phage	47.1	1.8e-30
WP_024075251.1|4047193_4047373_-	Cro/Cl family transcriptional regulator	NA	R9TPV3	Vibrio_phage	48.9	5.6e-05
WP_044287511.1|4047482_4048139_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	49.7	5.1e-43
WP_044287512.1|4048221_4048965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044287515.1|4048961_4049798_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_044287516.1|4050381_4050708_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_042570972.1|4050882_4051101_+	hypothetical protein	NA	A0A2D1GNR5	Pseudomonas_phage	73.6	3.1e-21
WP_044287517.1|4051168_4051426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044287518.1|4051716_4051968_+	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_044287519.1|4052716_4053154_+	hypothetical protein	NA	A0A1B0VMC3	Pseudomonas_phage	75.9	4.4e-59
WP_044287520.1|4053150_4053366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167337371.1|4053357_4053516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044287521.1|4053723_4053915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017255737.1|4053915_4054071_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_044287522.1|4054206_4055013_+	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	52.9	1.4e-66
WP_044287523.1|4055009_4056638_+	YqaJ viral recombinase family protein	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	72.6	1.0e-206
WP_044287524.1|4056634_4056877_+	hypothetical protein	NA	A0A2H4J1H1	uncultured_Caudovirales_phage	60.0	2.4e-14
WP_044287525.1|4056873_4057335_+	hypothetical protein	NA	A0A2H4J101	uncultured_Caudovirales_phage	85.6	5.2e-71
WP_044287526.1|4057718_4058516_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_144407266.1|4058632_4058971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044287529.1|4059087_4059720_+	hypothetical protein	NA	A0A2H4JC30	uncultured_Caudovirales_phage	46.4	9.8e-44
WP_044287531.1|4059726_4059939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044287533.1|4060046_4060706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044287535.1|4060743_4062312_+	DNA cytosine methyltransferase	NA	A0A2I7RFJ9	Vibrio_phage	46.6	3.6e-103
WP_080923243.1|4062774_4063170_+	DUF4406 domain-containing protein	NA	G3KAZ6	Pseudomonas_phage	55.3	1.7e-25
WP_044287539.1|4063166_4063616_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	61.0	4.4e-14
WP_044287540.1|4063697_4064144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080923219.1|4064204_4064444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044287542.1|4064655_4065057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158497711.1|4065094_4065250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044287544.1|4065589_4066768_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	70.8	5.3e-160
4066847:4066894	attR	ATGGTCGGGACGGAGTGATTCGAACACTCGACCCCTAGCACCCCATGC	NA	NA	NA	NA
>prophage 7
NZ_CP010896	Pseudomonas simiae strain PCL1751 chromosome, complete genome	6143950	5620830	5667418	6143950	protease,holin	Tupanvirus(20.0%)	41	NA	NA
WP_044288166.1|5620830_5621286_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_010207071.1|5621511_5622399_+	acyltransferase	NA	NA	NA	NA	NA
WP_010207073.1|5622395_5622968_-	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_044287992.1|5623104_5623563_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_010207077.1|5623638_5624838_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	29.7	1.1e-11
WP_005792124.1|5625034_5625892_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_010207081.1|5625902_5626535_-	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_044287993.1|5626658_5629676_-	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
WP_010207083.1|5629672_5629975_-	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_010207084.1|5629990_5631241_-	sarcosine oxidase subunit beta	NA	NA	NA	NA	NA
WP_010207085.1|5631263_5632517_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.2	1.3e-100
WP_044287994.1|5632768_5633497_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_010207092.1|5633587_5634628_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_010207094.1|5634804_5635002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010207095.1|5635197_5636298_-	glycine-betaine demethylase subunit GbcB	NA	NA	NA	NA	NA
WP_010207096.1|5636580_5637876_+	glycine-betaine demethylase subunit GbcA	NA	NA	NA	NA	NA
WP_010207097.1|5638647_5639418_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_044287995.1|5639428_5640649_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_010207099.1|5640648_5642589_-	dimethylglycine demethylation protein DgcB	NA	NA	NA	NA	NA
WP_010207100.1|5642772_5644833_-	dimethylglycine demethylation protein DgcA	NA	NA	NA	NA	NA
WP_010207102.1|5644848_5645379_-	4-vinyl reductase	NA	NA	NA	NA	NA
WP_010207105.1|5645457_5646435_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_010207107.1|5646654_5647056_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_010207109.1|5647097_5647514_+	DUF3010 family protein	NA	NA	NA	NA	NA
WP_044287996.1|5647634_5647820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044287997.1|5647851_5648796_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_010207112.1|5649003_5649948_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_010207113.1|5650021_5650909_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_044287998.1|5651051_5652017_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_044287999.1|5652031_5652508_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_044288000.1|5652535_5653696_+	gamma-butyrobetaine dioxygenase	NA	NA	NA	NA	NA
WP_010207120.1|5654056_5654320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005792167.1|5654426_5655530_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_021491298.1|5656033_5657410_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_010207122.1|5657825_5658773_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_010207125.1|5658841_5659687_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_010207126.1|5659683_5660862_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	37.1	5.9e-26
WP_010207127.1|5661050_5663042_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	28.2	6.9e-19
WP_010207128.1|5663376_5663970_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_010207130.1|5664080_5665553_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010207131.1|5665714_5667418_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.3	1.7e-50
