The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	101830	107826	4432103		Cronobacter_phage(40.0%)	6	NA	NA
WP_010847564.1|101830_102247_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	55.6	1.8e-33
WP_010847567.1|102607_103051_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	34.7	6.7e-07
WP_010847568.1|103423_103924_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_013183086.1|104076_104769_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	8.9e-06
WP_013183087.1|104765_106148_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.1	2.0e-20
WP_013183088.1|106515_107826_+	nucleotide sugar dehydrogenase	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	30.1	6.5e-42
>prophage 2
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	153915	206292	4432103	integrase,transposase,capsid,protease	Morganella_phage(23.53%)	51	146442:146457	181939:181954
146442:146457	attL	AAACCAACCGCATTTT	NA	NA	NA	NA
WP_013183081.1|153915_154800_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_013183133.1|155680_156859_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_013183134.1|156858_157962_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_013183135.1|157963_158968_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_013183136.1|159165_160284_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010847629.1|160440_160608_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_010847630.1|160619_160856_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_010847631.1|161117_161810_-	JAB domain-containing protein	NA	A0A1B2LRS6	Wolbachia_phage	27.5	2.1e-15
WP_013183138.1|162152_163382_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.4	1.0e-41
WP_013183139.1|163359_163818_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.8	4.3e-49
WP_013183140.1|163962_164562_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_010847635.1|164816_165458_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010847636.1|165534_166278_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_013183141.1|166403_167267_+	YicC family protein	NA	NA	NA	NA	NA
WP_013183142.1|167366_168131_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	88.5	5.7e-131
WP_013183143.1|168127_168874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013183144.1|169267_169510_+	helix-turn-helix domain-containing protein	NA	A0A1W6JPE9	Morganella_phage	65.4	6.2e-23
WP_013183145.1|169643_170483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013183146.1|170505_171525_+	oxidoreductase	NA	F1BUM2	Cronobacter_phage	46.2	2.2e-77
WP_013183147.1|171521_172043_+|capsid	phage capsid protein	capsid	A5X9H4	Aeromonas_virus	56.5	5.8e-34
WP_013183148.1|172114_172627_+	ash family protein	NA	A0A1W6JPK3	Morganella_phage	57.6	8.0e-36
WP_013183149.1|172629_172848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013183150.1|172847_175562_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	31.4	9.0e-62
WP_013183151.1|175853_176066_+	phage gene (fragment)	NA	F1BUM8	Cronobacter_phage	50.9	1.8e-10
WP_010847649.1|176775_177591_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	85.5	4.7e-99
WP_013141539.1|178697_179738_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	80.9	6.8e-167
WP_010847654.1|179958_180180_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	42.5	2.6e-07
WP_013183155.1|180176_180575_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	53.8	2.0e-26
WP_010847657.1|181778_182555_-	hypothetical protein	NA	NA	NA	NA	NA
181939:181954	attR	AAAATGCGGTTGGTTT	NA	NA	NA	NA
WP_013183157.1|183070_183838_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_013183158.1|183926_184547_-	DUF1454 family protein	NA	NA	NA	NA	NA
WP_041573628.1|184605_185052_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_013183160.1|185066_185813_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_041573629.1|186124_187312_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	21.8	4.7e-07
WP_013183162.1|187415_188939_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_013183163.1|189017_189815_-	aquaporin	NA	M1HVL5	Acanthocystis_turfacea_Chlorella_virus	29.8	3.5e-14
WP_013183164.1|189869_190061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010847666.1|190130_190373_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_038219095.1|190433_190937_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_013183165.1|191045_191963_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_013183166.1|192067_193399_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.0	3.9e-42
WP_010847670.1|193410_193941_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_013183167.1|194079_194850_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_013183168.1|194921_195947_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_010847673.1|196250_198449_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_010847674.1|198675_198891_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_010847675.1|198973_199291_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_010847677.1|199583_200744_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_010847678.1|200753_203189_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_013183169.1|203373_206013_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_013183170.1|206088_206292_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	427805	478351	4432103	transposase,tRNA,protease	Escherichia_phage(17.65%)	51	NA	NA
WP_013183297.1|427805_429719_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	44.8	1.8e-120
WP_010845211.1|429793_430627_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_013183298.1|430685_432023_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_010845209.1|432199_432538_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_010845208.1|433077_433530_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_010845207.1|433551_435060_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_010845206.1|435085_437857_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	26.0	2.5e-27
WP_010845205.1|437932_438343_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_010845204.1|438342_439293_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_010845203.1|439465_439735_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_013183301.1|439984_442123_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_010845201.1|442310_443195_+	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_013183302.1|443366_445316_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.5	1.8e-51
WP_041573636.1|445505_446225_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_013183304.1|446244_447924_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	70.1	2.8e-223
WP_013183305.1|448089_451131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010845194.1|452523_452781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010845193.1|452774_453293_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_013183306.1|453315_453627_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	54.2	6.8e-14
WP_010845191.1|453904_454156_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	49.2	1.3e-07
WP_013183307.1|454271_454703_+	YhbP family protein	NA	NA	NA	NA	NA
WP_013183308.1|454738_455203_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	61.0	2.7e-51
WP_010845188.1|455207_457124_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	65.3	3.0e-237
WP_010845186.1|457357_457744_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_010845185.1|457920_458385_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_010845184.1|458682_459108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143767620.1|459153_460240_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.9	8.4e-43
WP_013183314.1|460250_460634_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_013183315.1|461386_463705_+	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_010845181.1|463915_464188_+	antitoxin	NA	NA	NA	NA	NA
WP_010845180.1|464187_464562_+	mRNA interferase PemK	NA	NA	NA	NA	NA
WP_013183319.1|465562_466504_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	9.4e-51
WP_155971035.1|466561_466717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013183321.1|466788_467217_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_013183322.1|468313_468592_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	40.3	1.4e-07
WP_013183323.1|468705_469155_+	hypothetical protein	NA	V5YTK9	Pseudomonas_phage	73.9	1.8e-20
WP_010845171.1|469296_469566_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	50.6	9.0e-15
WP_013183324.1|469562_469880_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013183325.1|470039_470288_+	hypothetical protein	NA	A0A0A8WJJ2	Clostridium_phage	42.9	4.7e-10
WP_010847874.1|470390_470819_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	2.4e-25
WP_013183327.1|470875_472018_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	68.7	1.6e-132
WP_010845168.1|472119_472743_+	LysE family translocator	NA	NA	NA	NA	NA
WP_010845167.1|472911_473433_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_113935504.1|473972_474101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010845165.1|474422_475436_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_013183330.1|475670_476096_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_010845161.1|476171_476675_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013183331.1|477119_477494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013183332.1|477519_477843_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	41.6	1.1e-09
WP_156148018.1|477811_477955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013183333.1|477940_478351_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	605383	625959	4432103	transposase	Streptococcus_phage(33.33%)	17	NA	NA
WP_013183412.1|605383_606079_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.6	3.8e-33
WP_013183414.1|606212_606818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013183415.1|606792_607497_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.0	2.3e-09
WP_013183416.1|607599_608478_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013183412.1|608740_609436_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.6	3.8e-33
WP_010847992.1|609646_610435_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_013183418.1|610619_611573_+	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	34.4	2.2e-10
WP_010847990.1|611653_612229_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_010847989.1|612756_614028_+	MFS transporter	NA	NA	NA	NA	NA
WP_010847988.1|614109_614682_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_010847986.1|615032_616943_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.5	7.3e-143
WP_013183419.1|617056_618184_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	32.9	1.6e-28
WP_013183421.1|618803_619259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013183423.1|619551_620586_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_013183425.1|620726_621626_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_013183427.1|621941_622898_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013183428.1|624342_625959_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	654812	717937	4432103	integrase,transposase,protease,tRNA	uncultured_Mediterranean_phage(33.33%)	55	697671:697688	715722:715739
WP_045107652.1|654812_655892_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_010847949.1|656023_657148_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.2	7.0e-93
WP_010847948.1|657317_657656_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	36.3	4.5e-11
WP_010847947.1|657684_659532_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_013183453.1|659542_660511_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.5	7.0e-49
WP_010847945.1|660636_661086_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_010847944.1|661121_662231_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.6	1.3e-51
WP_013183454.1|662327_662798_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.2e-30
WP_010847942.1|662827_663244_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_013183455.1|663345_664389_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_010847940.1|664381_664873_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_010847939.1|664925_665573_-	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_010847938.1|665593_666610_-	DUF979 domain-containing protein	NA	NA	NA	NA	NA
WP_010847937.1|666609_667338_-	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_013183458.1|668513_668822_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_013183462.1|671763_672681_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.3	2.5e-56
WP_010847930.1|672886_673207_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013183464.1|673355_674804_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_013183465.1|674821_675673_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_013183466.1|675669_679488_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_010847926.1|679572_681042_-	ribonuclease G	NA	NA	NA	NA	NA
WP_013183467.1|681038_681626_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_013183468.1|681729_682218_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_013183469.1|682217_683261_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_010847922.1|683369_684413_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	3.0e-05
WP_013183472.1|685142_686120_+	oxidoreductase	NA	NA	NA	NA	NA
WP_010847919.1|686275_686728_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_010847918.1|686757_687213_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_013183473.1|687224_688574_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_013183474.1|688739_688982_+	YhdT family protein	NA	NA	NA	NA	NA
WP_010847915.1|688971_690417_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_010847914.1|690470_691352_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_010847913.1|691635_692619_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_010847912.1|692626_692923_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_013183485.1|696195_696714_-	4-hydroxyphenylacetate 3-monooxygenase, reductase component	NA	NA	NA	NA	NA
WP_041573642.1|696735_698298_-	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
697671:697688	attL	AGCCAAAACCGATAAAAT	NA	NA	NA	NA
WP_013183487.1|698930_699164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013183489.1|699695_700601_-	4-hydroxyphenylacetate catabolism regulatory protein HpaA	NA	NA	NA	NA	NA
WP_013183490.1|700652_702017_-	4-hydroxyphenylacetate permease	NA	NA	NA	NA	NA
WP_010847906.1|702138_702945_-	4-hydroxy-2-oxoheptanedioate aldolase	NA	NA	NA	NA	NA
WP_010847905.1|702979_703783_-	2-oxo-hepta-3-ene-1,7-dioic acid hydratase	NA	NA	NA	NA	NA
WP_013183491.1|703789_705262_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010847903.1|705324_705714_-	5-carboxymethyl-2-hydroxymuconate Delta-isomerase	NA	NA	NA	NA	NA
WP_013183492.1|705781_706633_-	3,4-dihydroxyphenylacetate 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_013183493.1|706699_708166_-	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013183494.1|708162_708927_-	2-hydroxyhepta-2,4-diene-1,7-dioate isomerase	NA	NA	NA	NA	NA
WP_010847899.1|708923_709556_-	HpaG1	NA	NA	NA	NA	NA
WP_013183496.1|709944_710400_+	homoprotocatechuate degradation operon regulator HpaR	NA	NA	NA	NA	NA
WP_013183497.1|711301_711631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013183498.1|711730_711997_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	63.1	7.3e-17
WP_013183500.1|712253_713123_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013184724.1|713886_714039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013183502.1|714061_715030_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	30.0	5.2e-20
WP_013183503.1|715057_716014_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
715722:715739	attR	ATTTTATCGGTTTTGGCT	NA	NA	NA	NA
WP_013183194.1|717175_717937_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	1004881	1129769	4432103	tRNA,protease,plate,transposase,tail,holin	Salmonella_phage(26.32%)	120	NA	NA
WP_010845498.1|1004881_1005883_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_010845497.1|1006180_1006447_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_045107658.1|1006427_1006880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041573809.1|1007049_1008138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010845493.1|1009218_1009599_+	DUF4354 family protein	NA	NA	NA	NA	NA
WP_013183672.1|1009682_1010201_-	flavodoxin FldB	NA	NA	NA	NA	NA
WP_081480218.1|1010358_1011279_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.4	5.3e-30
WP_010845490.1|1011312_1012014_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_010845489.1|1012064_1013804_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.7e-61
WP_113935512.1|1013979_1015077_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_010845487.1|1015087_1016602_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	36.8	2.7e-84
WP_045107659.1|1016805_1017738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013183675.1|1017793_1018105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010845484.1|1018201_1019269_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010845483.1|1019704_1020994_-	toxin PirB	NA	NA	NA	NA	NA
WP_013183676.1|1021062_1021470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010845480.1|1022200_1023064_-	GHMP kinase	NA	NA	NA	NA	NA
WP_013183678.1|1023056_1024130_-	threonine-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_013183679.1|1024129_1024930_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_013183681.1|1025889_1027281_+	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_013183682.1|1027277_1028255_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_013183683.1|1028294_1028936_+	cobalt-precorrin-8 methylmutase	NA	NA	NA	NA	NA
WP_045107660.1|1028928_1030110_+	cobalt-precorrin-5B (C(1))-methyltransferase	NA	NA	NA	NA	NA
WP_010845472.1|1030106_1030736_+	cobalt-precorrin-7 (C(5))-methyltransferase	NA	NA	NA	NA	NA
WP_010845471.1|1030725_1031325_+	decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase	NA	NA	NA	NA	NA
WP_010845470.1|1031317_1032106_+	cobalt-precorrin-4 methyltransferase	NA	NA	NA	NA	NA
WP_013183685.1|1032086_1033166_+	cobalt-precorrin 5A hydrolase	NA	NA	NA	NA	NA
WP_013183686.1|1033159_1033885_+	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
WP_010845467.1|1033881_1034673_+	cobalt-precorrin-6A reductase	NA	NA	NA	NA	NA
WP_010845466.1|1034731_1035523_+	sirohydrochlorin cobaltochelatase	NA	NA	NA	NA	NA
WP_010845465.1|1035519_1036266_+	cobalt-factor II C(20)-methyltransferase	NA	NA	NA	NA	NA
WP_010845464.1|1036269_1037001_+	energy-coupling factor ABC transporter permease	NA	NA	NA	NA	NA
WP_013183687.1|1037066_1037348_+	energy-coupling factor ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010845462.1|1037334_1038012_+	energy-coupling factor ABC transporter transmembrane protein	NA	NA	NA	NA	NA
WP_010845461.1|1038048_1038876_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.3	3.4e-12
WP_013183688.1|1038872_1040450_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_010845459.1|1040470_1041019_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_013183689.1|1041015_1041774_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_013183690.1|1041808_1042453_+	adenosylcobalamin/alpha-ribazole phosphatase	NA	NA	NA	NA	NA
WP_010845456.1|1042430_1043507_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010845455.1|1043546_1044104_-	methionine-rich PixA inclusion body protein	NA	NA	NA	NA	NA
WP_013183693.1|1045034_1046642_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.4	1.6e-26
WP_013183694.1|1046934_1047675_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010845451.1|1047788_1048469_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_013183696.1|1048553_1049369_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_143767628.1|1050416_1051121_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_013183698.1|1051217_1051487_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013183081.1|1051562_1052447_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_013183699.1|1052683_1053301_-	hypothetical protein	NA	A0A1S6KZZ7	Salmonella_phage	44.7	2.4e-47
WP_013183700.1|1053518_1053866_+	DUF5347 domain-containing protein	NA	NA	NA	NA	NA
WP_013183701.1|1053954_1055898_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	53.7	5.3e-181
WP_010845443.1|1056050_1056263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010845442.1|1056281_1056518_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	40.8	1.5e-10
WP_010845441.1|1056797_1057001_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	56.7	5.9e-19
WP_010845440.1|1057010_1057274_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	48.8	1.2e-14
WP_013183702.1|1057275_1057812_+	endopeptidase	NA	H2DE61	Erwinia_phage	56.8	2.1e-18
WP_013183703.1|1057960_1058596_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	65.7	1.1e-71
WP_010845437.1|1058592_1058943_+|plate	baseplate assembly protein W	plate	F1BUP4	Erwinia_phage	62.2	4.8e-32
WP_013183705.1|1058965_1059874_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	71.5	6.2e-116
WP_010845434.1|1059866_1060475_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	69.4	6.3e-80
WP_013183706.1|1060471_1062658_+	hypothetical protein	NA	Q6K1H2	Salmonella_virus	48.6	1.4e-105
WP_013183707.1|1062677_1063001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050986613.1|1063229_1064771_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_156148020.1|1065633_1066761_+	sulfurtransferase	NA	M1TAS6	Escherichia_phage	48.0	5.1e-27
WP_013183711.1|1066997_1067879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013183713.1|1068607_1069390_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_143767676.1|1069601_1070126_-|tail	phage tail protein	tail	A0A2K9V2I0	Shigella_phage	42.8	1.5e-29
WP_041573653.1|1070410_1070890_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	46.2	9.1e-34
WP_143767629.1|1070886_1071483_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	50.8	1.7e-50
WP_050986614.1|1071628_1072588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045107685.1|1072784_1073735_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	48.6	2.8e-26
WP_013183719.1|1074259_1075432_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	74.4	8.4e-166
WP_010845425.1|1075443_1075962_+|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	65.5	3.6e-60
WP_010845424.1|1076171_1076489_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	54.7	2.2e-20
WP_013183720.1|1076500_1076623_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	66.7	5.7e-09
WP_013183721.1|1076615_1079726_+|tail	tail protein	tail	A0A1S6L010	Salmonella_phage	43.5	3.3e-15
WP_013183722.1|1079722_1080229_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	62.9	3.3e-42
WP_013183723.1|1080225_1081749_+	hypothetical protein	NA	E5G6Q3	Salmonella_phage	38.8	8.0e-84
WP_038219483.1|1081830_1082067_+	transcriptional regulator	NA	E5G6Q4	Salmonella_phage	69.4	1.8e-19
WP_013183724.1|1082226_1082445_-	YdcH family protein	NA	NA	NA	NA	NA
WP_013183726.1|1082737_1083214_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_010845416.1|1083511_1084207_+	aquaporin Z	NA	NA	NA	NA	NA
WP_041573654.1|1084472_1085234_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	41.3	4.4e-14
WP_010845414.1|1086087_1087095_+	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_010845413.1|1087128_1088019_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010845412.1|1088022_1089309_+	rhabduscin glycosyltransferase	NA	NA	NA	NA	NA
WP_013183730.1|1089482_1090112_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_013183731.1|1090221_1090404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013183732.1|1090515_1090914_-	acetyl-CoA synthetase	NA	NA	NA	NA	NA
WP_010845408.1|1090993_1092073_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_013183733.1|1092160_1093624_-	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_013183734.1|1093643_1094819_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_010845405.1|1094811_1095717_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_013183735.1|1095983_1097642_+	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_013183736.1|1097672_1098641_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_010845402.1|1098756_1098927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010845401.1|1099042_1099255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013183737.1|1099761_1102215_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_010845399.1|1102278_1102800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013183713.1|1103378_1104161_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_143767677.1|1104763_1105039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013183741.1|1105035_1105380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010845386.1|1105463_1107146_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	29.4	3.8e-50
WP_013183743.1|1107173_1108652_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010845384.1|1108688_1109285_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_013183744.1|1109494_1111531_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	26.2	8.4e-20
WP_010845382.1|1111627_1112884_-	MFS transporter	NA	NA	NA	NA	NA
WP_010845380.1|1113374_1114430_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_013183745.1|1114525_1115992_-	beta-Ala-His dipeptidase	NA	NA	NA	NA	NA
WP_010845378.1|1116252_1116714_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_013183746.1|1116729_1117977_+	esterase FrsA	NA	NA	NA	NA	NA
WP_013183747.1|1118048_1118450_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_013183748.1|1118565_1119669_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.2	3.7e-62
WP_013183749.1|1119698_1120952_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.4	2.1e-98
WP_010845373.1|1121117_1121648_+	shikimate kinase AroL	NA	NA	NA	NA	NA
WP_041573655.1|1121777_1123925_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	NA	NA	NA	NA
WP_013183751.1|1123930_1125127_+	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_013183752.1|1125152_1125656_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	43.9	1.3e-25
WP_010845369.1|1125759_1126836_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.2	9.3e-111
WP_013183753.1|1127141_1129769_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
>prophage 7
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	1416410	1426933	4432103	tRNA,protease	Bacillus_phage(33.33%)	10	NA	NA
WP_013183908.1|1416410_1417139_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	34.2	3.3e-27
WP_010846887.1|1417463_1418366_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_010846888.1|1418677_1418998_+	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
WP_010846889.1|1419054_1419285_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	4.1e-16
WP_010846890.1|1419617_1419938_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	48.8	4.8e-15
WP_010846891.1|1419969_1422255_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.6	8.7e-167
WP_010846892.1|1422346_1422565_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_013183910.1|1422702_1423410_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_013183911.1|1423418_1425161_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	24.5	2.7e-19
WP_013183912.1|1425163_1426933_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.5	4.3e-28
>prophage 8
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	1642878	1780190	4432103	integrase,transposase,tRNA,protease	Tupanvirus(21.21%)	88	1715984:1716001	1789234:1789251
WP_013184017.1|1642878_1643835_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_013184019.1|1644026_1644788_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.0	1.8e-12
WP_013184022.1|1645287_1645437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184023.1|1645733_1646105_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013184024.1|1646247_1648143_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	26.2	1.5e-42
WP_081480174.1|1648136_1649450_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_013184019.1|1649456_1650218_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.0	1.8e-12
WP_013184027.1|1650893_1651508_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	50.0	3.9e-37
WP_013184028.1|1651744_1654657_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	22.9	3.2e-57
WP_013184029.1|1654742_1654934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184032.1|1657290_1658880_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.3	2.4e-30
WP_013184033.1|1658939_1665974_-	KR domain-containing protein	NA	D0R7J2	Paenibacillus_phage	29.6	3.1e-37
WP_013184034.1|1665963_1680435_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.7	2.0e-75
WP_013184035.1|1680446_1682441_-	alpha-ketoacid dehydrogenase subunit alpha/beta	NA	NA	NA	NA	NA
WP_013184036.1|1682533_1683145_-	thioesterase	NA	NA	NA	NA	NA
WP_013184037.1|1683247_1684450_-	MFS transporter	NA	NA	NA	NA	NA
WP_013184038.1|1684446_1685307_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_013184039.1|1685337_1692246_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	22.5	1.5e-52
WP_041573665.1|1692260_1699484_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	29.1	5.6e-58
WP_013184041.1|1699470_1705413_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013184042.1|1705447_1706200_-	MupK	NA	NA	NA	NA	NA
WP_013184043.1|1706187_1706976_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_013184044.1|1706950_1708186_-	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_013184045.1|1708224_1709451_-	polyketide beta-ketoacyl synthase	NA	NA	NA	NA	NA
WP_013184046.1|1709747_1709993_-	protein CurB	NA	NA	NA	NA	NA
WP_013183963.1|1710656_1711676_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_167335071.1|1711881_1712055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184051.1|1712916_1713366_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_013184052.1|1713411_1713735_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	40.6	1.8e-09
WP_156148018.1|1713703_1713847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013183333.1|1713832_1714243_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013184054.1|1714980_1716060_+	hypothetical protein	NA	NA	NA	NA	NA
1715984:1716001	attL	AGTATGGTAACGCATGTA	NA	NA	NA	NA
WP_013184055.1|1716525_1721490_+	Nematicidal protein 2	NA	A0A1W5K0N1	Bacteriophage	35.4	3.6e-173
WP_013184056.1|1721865_1722618_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.5	1.2e-53
WP_013184057.1|1722629_1724174_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.2	5.4e-128
WP_081480177.1|1724989_1725517_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143767633.1|1725665_1726202_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013184059.1|1726222_1726390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184060.1|1726393_1726705_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010847362.1|1727938_1728436_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_010847361.1|1728531_1729242_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_010847360.1|1729261_1731361_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	1.2e-82
WP_013184063.1|1731540_1732425_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_013184065.1|1732638_1734030_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_013184068.1|1734489_1734813_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	40.6	1.4e-09
WP_013184069.1|1734910_1735195_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013184052.1|1735251_1735575_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	40.6	1.8e-09
WP_156148022.1|1738284_1738467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010847354.1|1741472_1742051_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_013184019.1|1742246_1743008_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.0	1.8e-12
WP_010847353.1|1743160_1743826_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_143767635.1|1744195_1745283_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.5	4.2e-42
WP_013184079.1|1745377_1745776_-|transposase	transposase	transposase	A0A0U2RK18	Escherichia_phage	51.1	1.4e-16
WP_010847351.1|1746117_1746981_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_010847350.1|1747111_1748008_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_010847349.1|1748004_1748880_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_010847348.1|1748876_1749788_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	29.3	4.4e-13
WP_013184080.1|1749784_1750699_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010847346.1|1750990_1751659_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_013184082.1|1752206_1754135_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	3.7e-126
WP_071827932.1|1754138_1754678_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.1	1.9e-16
WP_004157374.1|1754774_1754972_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_010847342.1|1755017_1755374_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_143767679.1|1755457_1755535_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_010847341.1|1755691_1756675_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.1	5.4e-33
WP_010847340.1|1756689_1759077_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_010847339.1|1759081_1759378_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
WP_013184085.1|1759481_1760477_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_013184086.1|1760539_1761307_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A1V0SE00	Indivirus	25.7	2.1e-08
WP_010847336.1|1761466_1762612_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.0	1.6e-36
WP_013184087.1|1762612_1763596_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	34.4	1.9e-38
WP_013184088.1|1763595_1765617_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	27.0	1.1e-22
WP_010847333.1|1765591_1766485_+	4-deoxy-4-formamido-L-arabinose- phosphoundecaprenol deformylase	NA	NA	NA	NA	NA
WP_010847332.1|1766492_1768154_+	lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase	NA	NA	NA	NA	NA
WP_010847331.1|1768150_1768501_+	EamA family transporter	NA	NA	NA	NA	NA
WP_010847330.1|1768497_1768908_+	4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF	NA	NA	NA	NA	NA
WP_013184089.1|1769014_1769500_+	endopeptidase	NA	S5MM68	Bacillus_phage	39.6	2.2e-11
WP_013184092.1|1770233_1770641_+	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	57.6	1.6e-10
WP_013184093.1|1770709_1770880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081480180.1|1771181_1771538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010847322.1|1771617_1771983_-	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	36.4	1.7e-08
WP_010847321.1|1772353_1772977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010847320.1|1773116_1773911_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.2	5.4e-15
WP_010847319.1|1773910_1774912_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_013184096.1|1774908_1775727_-	hemin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013184097.1|1775723_1776797_-	hemin-degrading factor	NA	NA	NA	NA	NA
WP_013184098.1|1776871_1778911_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_013184099.1|1779167_1780190_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
1789234:1789251	attR	AGTATGGTAACGCATGTA	NA	NA	NA	NA
>prophage 9
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	1808859	1982567	4432103	tRNA,protease,transposase,tail,integrase,holin	Escherichia_phage(10.81%)	103	1863578:1863602	1897259:1897283
WP_010847289.1|1808859_1810131_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	40.8	8.8e-84
WP_013184114.1|1810280_1811159_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_013184121.1|1817243_1818212_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013184122.1|1818485_1819508_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_045107664.1|1820542_1821016_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143767637.1|1821042_1821678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184126.1|1821803_1822850_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_013184127.1|1822797_1823226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143767638.1|1823296_1823872_-	adenylate kinase	NA	NA	NA	NA	NA
WP_013184135.1|1827335_1827689_-	YebY family protein	NA	NA	NA	NA	NA
WP_010847366.1|1827773_1828772_-	copper resistance D family protein	NA	NA	NA	NA	NA
WP_013184136.1|1828771_1829158_-	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_010847369.1|1829381_1829888_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_010847370.1|1830214_1830445_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.3e-14
WP_010847371.1|1830491_1831445_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_010847372.1|1831522_1831894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010847373.1|1831998_1832181_-	YoaH family protein	NA	NA	NA	NA	NA
WP_010847374.1|1832326_1833697_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	29.7	3.8e-40
WP_010847375.1|1833693_1834263_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_010847376.1|1834432_1835797_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_010847378.1|1836336_1837302_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_013184140.1|1837379_1838180_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_013184141.1|1838193_1839042_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_038220283.1|1839154_1839613_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_143767639.1|1839899_1840484_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_041573672.1|1840593_1841415_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_010847384.1|1841698_1843027_-	MFS transporter	NA	NA	NA	NA	NA
WP_013184144.1|1843035_1844559_-	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_013184145.1|1844558_1844732_-	toxin-antitoxin system protein	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.0	1.3e-06
WP_010847387.1|1844721_1844976_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	46.4	2.0e-11
WP_113967564.1|1845415_1845796_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_010847389.1|1845801_1846419_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_010847390.1|1846560_1847937_-	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_013184149.1|1848543_1848879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010847392.1|1849264_1849954_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010847393.1|1849954_1850341_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_013184150.1|1850614_1851055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010847395.1|1851215_1851497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010847396.1|1852536_1854114_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_038220292.1|1854192_1855659_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	1.5e-87
WP_013184153.1|1855831_1857193_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.8	1.2e-41
WP_113967565.1|1857251_1858784_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041573673.1|1858780_1859257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010847402.1|1860419_1860872_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_010847403.1|1860981_1861179_-	Cro/Cl family transcriptional regulator	NA	A2SY83	Escherichia_phage	50.8	6.4e-10
WP_010847404.1|1861279_1861993_+	helix-turn-helix domain-containing protein	NA	A0A286S2B2	Klebsiella_phage	41.3	3.0e-41
WP_010847406.1|1862696_1863560_+|tail	tail protein	tail	M1TAS6	Escherichia_phage	39.8	1.1e-32
1863578:1863602	attL	AACCCGCAACTTTCTGCGGGTTAAT	NA	NA	NA	NA
WP_013184161.1|1864221_1864488_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.8	6.6e-18
WP_158309326.1|1865843_1867082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184164.1|1867638_1868736_-|transposase	ISAs1-like element ISXne3 family transposase	transposase	NA	NA	NA	NA
WP_013184166.1|1869497_1870118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081480182.1|1870886_1873235_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	42.8	1.9e-169
WP_071837838.1|1873563_1874001_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_013184171.1|1874071_1874395_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	39.6	2.6e-08
WP_010848205.1|1874420_1875551_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.0	6.7e-120
WP_010848134.1|1876182_1876512_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_013184173.1|1876527_1876806_-	acylphosphatase	NA	NA	NA	NA	NA
WP_013184174.1|1877035_1877353_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_010848131.1|1877421_1877835_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_010848130.1|1877980_1878199_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_013184177.1|1879187_1880072_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_071837838.1|1880883_1881321_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_143767640.1|1881663_1881975_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143767641.1|1882006_1882483_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_013184184.1|1883223_1886802_-	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	55.7	0.0e+00
WP_013184185.1|1886854_1887463_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	56.9	2.6e-54
WP_013184057.1|1887670_1889215_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.2	5.4e-128
WP_013184056.1|1889226_1889979_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.5	1.2e-53
WP_071837840.1|1890211_1891243_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_010849011.1|1892043_1892481_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010849012.1|1892912_1893128_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	75.0	7.2e-23
WP_013184192.1|1893381_1893588_+	hypothetical protein	NA	A0A1P8DTI4	Proteus_phage	68.6	5.5e-12
WP_013184193.1|1894580_1895213_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	43.4	1.0e-16
WP_041573674.1|1895212_1895560_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	70.5	6.6e-42
WP_013184195.1|1895579_1897151_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.0	3.4e-170
WP_013184196.1|1897298_1897676_-	PA-I galactophilic lectin	NA	NA	NA	NA	NA
1897259:1897283	attR	ATTAACCCGCAGAAAGTTGCGGGTT	NA	NA	NA	NA
WP_013184200.1|1899085_1899877_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_081480183.1|1899944_1900106_+	recombinase family protein	NA	NA	NA	NA	NA
WP_081480220.1|1900239_1900767_+	serine hydrolase	NA	NA	NA	NA	NA
WP_013184203.1|1901740_1914157_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.6	2.1e-174
WP_013184204.1|1914457_1915384_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.9	5.8e-61
WP_013184205.1|1915396_1915573_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_010848833.1|1915862_1916324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184206.1|1916432_1916594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184208.1|1917511_1924687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184209.1|1925046_1925442_+	M15 family metallopeptidase	NA	S4TRL9	Salmonella_phage	66.9	5.2e-43
WP_041573853.1|1925447_1925897_+	lysozyme	NA	A0A2H4JHL8	uncultured_Caudovirales_phage	43.6	2.9e-13
WP_013184212.1|1926480_1927233_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_013184214.1|1927713_1928016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010848844.1|1928597_1929155_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.5	6.0e-21
WP_013184215.1|1929400_1931089_-	putative pyridoxal-dependent aspartate 1-decarboxylase	NA	S4W1T5	Pandoravirus	26.1	1.1e-17
WP_041573675.1|1931182_1949182_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.1	9.9e-173
WP_045107665.1|1949178_1955922_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.3	8.6e-138
WP_013184218.1|1955921_1972364_-	non-ribosomal peptide synthase	NA	A0A2K9KZV5	Tupanvirus	29.4	2.7e-185
WP_013184219.1|1973020_1973647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010849064.1|1975548_1975866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143767642.1|1976043_1976752_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	53.0	4.0e-62
WP_010845638.1|1977240_1977771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184226.1|1978451_1979291_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_010845635.1|1979372_1980482_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.3	5.6e-34
WP_010845634.1|1980753_1981149_-	hypothetical protein	NA	A0A0E3GMJ2	Enterobacteria_phage	51.5	2.0e-31
WP_013184227.1|1981148_1981463_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	57.1	2.6e-29
WP_143767643.1|1981869_1982567_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	53.0	9.8e-61
>prophage 10
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	2270335	2349896	4432103	lysis,transposase,portal,protease	Salmonella_phage(18.75%)	56	NA	NA
WP_158309327.1|2270335_2271103_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_156148023.1|2271281_2271446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143767680.1|2271400_2271622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184384.1|2272553_2275619_+	insecticidal toxin complex protein A	NA	NA	NA	NA	NA
WP_013184385.1|2275690_2280316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184386.1|2280403_2284963_+	insecticidal toxin complex protein B	NA	NA	NA	NA	NA
WP_013184387.1|2284955_2287865_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_013184389.1|2288187_2288574_+	phage-like protein	NA	NA	NA	NA	NA
WP_010845891.1|2288624_2289065_+	lysozyme	NA	A0A0M5M782	Salmonella_phage	58.2	7.1e-41
WP_013184390.1|2289061_2289550_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	50.0	8.2e-14
WP_010845893.1|2289761_2290775_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010845895.1|2291037_2291394_+	addiction module killer protein	NA	NA	NA	NA	NA
WP_010845896.1|2291374_2291734_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	38.0	6.0e-06
WP_013184393.1|2293018_2293651_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	43.4	2.3e-16
WP_041573688.1|2293650_2293998_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.4	3.8e-42
WP_013184395.1|2294017_2295589_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.0	2.0e-170
WP_013184398.1|2297291_2298359_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	51.2	7.6e-97
WP_013184402.1|2300076_2300748_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041573689.1|2300744_2302010_-	conjugal transfer protein TraW	NA	NA	NA	NA	NA
WP_010845909.1|2301972_2302503_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_013184404.1|2302499_2302817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184406.1|2303924_2306528_-	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_013184407.1|2306729_2307113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141546.1|2307125_2307704_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_041573865.1|2307700_2309014_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_013141544.1|2309013_2309931_-	conjugal transfer protein TraK	NA	NA	NA	NA	NA
WP_021326607.1|2310273_2310417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141542.1|2310597_2311260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141541.1|2311259_2311637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184411.1|2311646_2312093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141539.1|2312900_2313941_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	80.9	6.8e-167
WP_013141538.1|2313974_2314505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184413.1|2316531_2317149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184414.1|2317130_2317364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184415.1|2317363_2319550_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.2e-42
WP_013184417.1|2320506_2320821_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	2.8e-15
WP_013184418.1|2320817_2321174_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_013184420.1|2321619_2322330_-|portal	portal protein	portal	A0A0M5M1H6	Salmonella_phage	60.6	5.1e-73
WP_010845954.1|2324768_2325791_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013184424.1|2325941_2326265_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	40.6	1.4e-09
WP_071837852.1|2326335_2326773_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_045107667.1|2329376_2329910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184428.1|2330491_2332435_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_013184431.1|2333529_2334144_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_013184432.1|2334053_2334362_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010845962.1|2334368_2334692_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_013184433.1|2334684_2335410_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_010845965.1|2335578_2336748_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_010845966.1|2336754_2337069_-	LapA family protein	NA	NA	NA	NA	NA
WP_065814206.1|2337665_2338274_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.3	3.7e-40
WP_013184435.1|2338379_2341085_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_010845970.1|2341382_2342204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010845971.1|2342325_2343300_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_013184437.1|2343645_2346243_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	36.8	1.0e-91
WP_013184439.1|2347605_2348646_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	80.6	2.6e-166
WP_010845977.1|2348849_2349896_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	4.2e-23
>prophage 11
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	2454282	2502435	4432103	plate,transposase	Escherichia_phage(20.0%)	36	NA	NA
WP_013184479.1|2454282_2455425_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	69.0	4.9e-134
WP_038218908.1|2455481_2455910_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	2.4e-25
WP_013184481.1|2455931_2456111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010846050.1|2456161_2456443_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_010846051.1|2456614_2457028_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010846052.1|2457371_2458367_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_013184483.1|2458573_2459455_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_013184484.1|2459531_2460599_-	alanine racemase	NA	NA	NA	NA	NA
WP_010846055.1|2460621_2461923_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_013184486.1|2462980_2465143_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.1	2.3e-36
WP_013184487.1|2465166_2467764_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_013184488.1|2467760_2468828_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_010846059.1|2468842_2469463_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_013184489.1|2469473_2469866_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_041573694.1|2469920_2470505_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_013184491.1|2470501_2471845_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_010846063.1|2471858_2473079_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_010846064.1|2473091_2476700_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_010846065.1|2476730_2477777_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_010846066.1|2477954_2478497_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_010846067.1|2478500_2480003_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_010846068.1|2480139_2480631_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_013184492.1|2480702_2482232_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_010846070.1|2482293_2482848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184493.1|2482881_2484756_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_010846072.1|2484758_2485793_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_013184494.1|2485871_2488511_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	30.9	6.9e-83
WP_013184495.1|2488598_2489996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010846075.1|2490054_2490342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041573875.1|2490454_2491897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041573695.1|2492266_2493748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184497.1|2494194_2494638_-|transposase	IS200/IS605 family transposase	transposase	A0A0N9PD00	Sulfolobus_monocaudavirus	41.4	1.1e-20
WP_081480191.1|2494822_2499208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184498.1|2499361_2499619_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_119365336.1|2499608_2499902_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013183963.1|2501415_2502435_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	2874485	2934710	4432103	transposase	Cronobacter_phage(14.29%)	46	NA	NA
WP_013184669.1|2874485_2875370_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_012987825.1|2882415_2882841_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_010846804.1|2882840_2883095_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_010846805.1|2883319_2883649_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_010846806.1|2883789_2884128_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_013184681.1|2884230_2884518_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	56.8	1.3e-22
WP_010846808.1|2884528_2884813_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_013184682.1|2884895_2885279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184683.1|2885399_2885609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184684.1|2885819_2886134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184685.1|2886137_2886662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041573707.1|2886658_2886862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143767649.1|2887273_2887465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184689.1|2887494_2888496_-	site-specific tyrosine recombinase XerC	NA	T2KT84	uncultured_phage	41.2	1.5e-06
WP_038251542.1|2891303_2891645_+	helix-turn-helix transcriptional regulator	NA	I6PD69	Cronobacter_phage	33.3	2.0e-06
WP_013184691.1|2891731_2892052_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_013184692.1|2892121_2892574_-	NADAR family protein	NA	A0A0H3TLU0	Faustovirus	49.0	6.1e-32
WP_013184693.1|2892570_2892909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156148026.1|2893483_2893765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184698.1|2894303_2895332_-	site-specific tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	27.1	2.0e-17
WP_156148027.1|2895344_2895503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184700.1|2895559_2898322_-	toprim domain-containing protein	NA	A0A1S5RF71	Helicobacter_phage	23.4	1.0e-20
WP_038251542.1|2898452_2898794_+	helix-turn-helix transcriptional regulator	NA	I6PD69	Cronobacter_phage	33.3	2.0e-06
WP_013184701.1|2898880_2899201_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_013184702.1|2899282_2899510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010846820.1|2904240_2904597_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_013184703.1|2904589_2905807_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_013183865.1|2905822_2907937_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	1.6e-29
WP_013184705.1|2909135_2909897_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.0	1.4e-12
WP_013184706.1|2910049_2910508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184707.1|2910706_2911147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184708.1|2911224_2912163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184710.1|2913588_2914542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184711.1|2914538_2920331_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.9	2.7e-15
WP_013184712.1|2920391_2920886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184714.1|2921618_2922020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184715.1|2922030_2922693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041573712.1|2924619_2924967_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.4	1.3e-42
WP_013184718.1|2924966_2925599_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	43.4	1.3e-16
WP_013184720.1|2925806_2926829_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_143767681.1|2927778_2931750_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013184723.1|2931735_2932704_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	30.3	1.8e-20
WP_013184725.1|2932788_2933073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013183332.1|2933878_2934202_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	41.6	1.1e-09
WP_156148018.1|2934170_2934314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184726.1|2934299_2934710_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	2954496	3004507	4432103	transposase,protease	uncultured_Caudovirales_phage(22.22%)	39	NA	NA
WP_010848864.1|2954496_2955576_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.7	4.4e-36
WP_013184744.1|2955575_2956514_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_010848862.1|2956674_2957160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010848861.1|2957227_2957722_-	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_143767682.1|2958047_2961083_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_010848858.1|2962054_2962900_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	50.2	2.9e-75
WP_013184746.1|2962883_2963498_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J122	uncultured_Caudovirales_phage	47.0	1.2e-41
WP_013184747.1|2963910_2964606_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013184748.1|2964622_2965909_+	cytosine permease	NA	NA	NA	NA	NA
WP_010848854.1|2965981_2966812_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_013184749.1|2966834_2967725_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_013184750.1|2967831_2969739_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_013184751.1|2969750_2971424_-	solute:sodium symporter family transporter	NA	A0A219Y9P9	Aeromonas_phage	26.8	7.6e-35
WP_013184752.1|2971585_2972578_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_013184753.1|2972863_2974828_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.4	7.3e-21
WP_013184754.1|2974836_2976348_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010848847.1|2976601_2977435_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013184757.1|2978782_2979166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010848961.1|2982676_2983276_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	39.4	3.2e-28
WP_010848960.1|2983419_2983815_+	VOC family protein	NA	NA	NA	NA	NA
WP_010848957.1|2985357_2985594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184763.1|2986009_2986420_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_156148018.1|2986405_2986549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013183332.1|2986517_2986841_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	41.6	1.1e-09
WP_013184764.1|2986866_2987430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071827984.1|2987521_2987596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071837860.1|2988020_2989052_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162097867.1|2989067_2989220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184775.1|2991905_2992862_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013184723.1|2992889_2993858_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	30.3	1.8e-20
WP_013184776.1|2993880_2994033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050986633.1|2994078_2994360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184778.1|2994384_2994633_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143767653.1|2994723_2995824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010846634.1|2998404_2999481_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_010846633.1|2999570_3000737_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_010846632.1|3000838_3001858_-	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_013184779.1|3002144_3004139_-	transketolase	NA	NA	NA	NA	NA
WP_010846630.1|3004294_3004507_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	75.0	3.4e-09
>prophage 14
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	3025385	3059900	4432103	portal,capsid,plate,lysis,tail,head,terminase,integrase,holin	Salmonella_phage(48.72%)	49	3025138:3025153	3059966:3059981
3025138:3025153	attL	CCCACATACTGCTGGG	NA	NA	NA	NA
WP_013184788.1|3025385_3025784_+	hypothetical protein	NA	B9A7A8	Serratia_phage	55.8	2.1e-36
WP_071837861.1|3025861_3026080_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	66.7	2.8e-22
WP_013184790.1|3026253_3026436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184791.1|3026434_3026755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184792.1|3026800_3027895_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	56.4	9.5e-111
WP_013184793.1|3027909_3028374_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	68.2	2.2e-48
WP_013184794.1|3028376_3031166_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	36.5	1.5e-123
WP_071837882.1|3031158_3031281_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	61.5	1.8e-07
WP_013184796.1|3031292_3031610_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	54.0	1.0e-17
WP_013184797.1|3031649_3032165_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	64.9	3.6e-60
WP_013184798.1|3032175_3033348_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	78.9	1.2e-175
WP_143767654.1|3033671_3034367_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013184801.1|3034551_3035085_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	44.9	1.5e-21
WP_013184802.1|3035089_3036859_-	hypothetical protein	NA	A0A0M3ULH6	Salmonella_phage	61.9	3.0e-74
WP_013184803.1|3036855_3037464_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	60.4	1.0e-69
WP_013184804.1|3037456_3038365_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	65.6	2.8e-108
WP_013184805.1|3038369_3038711_-|plate	baseplate assembly protein	plate	O80315	Escherichia_phage	63.5	6.3e-29
WP_041573718.1|3038707_3039361_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	59.4	6.3e-62
WP_013184807.1|3039427_3040063_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	33.2	4.6e-17
WP_013184808.1|3040065_3040482_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	53.6	8.4e-36
WP_041573896.1|3040544_3040742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143767683.1|3040754_3041207_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	33.6	1.0e-10
WP_013184810.1|3041206_3041602_-	hypothetical protein	NA	A0A0A0RQM4	Escherichia_phage	50.4	5.0e-30
WP_013184811.1|3041594_3041918_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	56.4	3.1e-30
WP_013184812.1|3041921_3042125_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	67.2	9.8e-22
WP_013184813.1|3042124_3042589_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	46.1	2.7e-30
WP_013184814.1|3042676_3043339_-|terminase	terminase	terminase	A0A0M4QWM0	Salmonella_phage	47.7	1.3e-46
WP_013184815.1|3043340_3044450_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	66.8	1.1e-133
WP_013184816.1|3044465_3045302_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	51.2	2.3e-64
WP_156148028.1|3045320_3045461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041573719.1|3045444_3047205_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	76.4	2.0e-275
WP_013184818.1|3047204_3048233_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	70.5	7.4e-142
WP_013184819.1|3048760_3049264_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_013184820.1|3049320_3049653_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	61.9	3.3e-35
WP_013184821.1|3049670_3050366_-	hypothetical protein	NA	O80303	Escherichia_phage	34.0	2.6e-13
WP_013184822.1|3050371_3050572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184823.1|3050568_3051738_-	DNA cytosine methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	46.1	1.4e-112
WP_013184824.1|3051731_3051992_-	hypothetical protein	NA	A0A192YCJ9	Morganella_phage	35.4	1.9e-09
WP_013184825.1|3051988_3054103_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	56.6	1.1e-208
WP_013184827.1|3055113_3055938_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	54.4	5.3e-66
WP_013184828.1|3055939_3056161_-	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	46.5	6.5e-11
WP_013184829.1|3056153_3056402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184830.1|3056473_3056824_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	39.6	5.5e-12
WP_013184831.1|3056834_3057002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081480222.1|3057234_3057612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184834.1|3058000_3058291_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	51.2	5.2e-16
WP_041573721.1|3058287_3058575_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	46.3	2.8e-14
WP_143767684.1|3058664_3058802_+	C protein	NA	Q1JS63	Enterobacteria_phage	51.2	5.6e-05
WP_013184837.1|3058886_3059900_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.8	6.7e-95
3059966:3059981	attR	CCCACATACTGCTGGG	NA	NA	NA	NA
>prophage 15
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	3244820	3343226	4432103	portal,tRNA,capsid,protease,plate,transposase,tail,head,terminase,integrase	Vibrio_phage(18.03%)	106	3243065:3243079	3344432:3344446
3243065:3243079	attL	TGCCGGTATTGCCGT	NA	NA	NA	NA
WP_013184964.1|3244820_3246101_+|tRNA	histidine--tRNA ligase	tRNA	A0A1V0SFH3	Hokovirus	24.5	9.3e-17
WP_013184965.1|3246114_3246735_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010847185.1|3246750_3247923_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_010847186.1|3248229_3249720_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_010847187.1|3250082_3250301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010847188.1|3250592_3251642_-	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_010847189.1|3251874_3252927_-	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_010847190.1|3253173_3254082_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_013184776.1|3254353_3254506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184723.1|3254528_3255497_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	30.3	1.8e-20
WP_010847191.1|3256704_3256842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184970.1|3257868_3259209_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_010847193.1|3259277_3259937_-	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_013184971.1|3259936_3260293_-	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_013184972.1|3260314_3260986_-	CsgG/HfaB family protein	NA	NA	NA	NA	NA
WP_013184973.1|3261644_3262691_-	3-ketoacyl-CoA thiolase	NA	NA	NA	NA	NA
WP_013184974.1|3263091_3264708_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_010847198.1|3264992_3265205_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_010847199.1|3265204_3266080_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	2.8e-33
WP_013184975.1|3266512_3267727_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.8e-129
WP_013184976.1|3268164_3268371_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	46.7	8.7e-10
WP_041573914.1|3268579_3270913_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	44.1	2.1e-176
WP_013184978.1|3271503_3271929_+	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_013184979.1|3271941_3276249_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	50.4	1.2e-28
WP_013184980.1|3276261_3276879_+	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_013184981.1|3277417_3279961_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013184982.1|3279973_3281821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184984.1|3283442_3283793_+	DUF3486 family protein	NA	M4MCT3	Vibrio_phage	38.9	2.5e-12
WP_013184985.1|3283951_3284566_-	helix-turn-helix transcriptional regulator	NA	A0A0A7DJB4	Pseudomonas_phage	42.3	5.3e-10
WP_013184986.1|3284724_3284943_+	DNA-binding protein	NA	M1PVU4	Vibrio_phage	65.2	2.1e-17
WP_013184987.1|3286519_3287473_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	53.0	1.3e-84
WP_013184988.1|3287469_3287724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184989.1|3287739_3287949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184990.1|3287981_3288611_+	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	67.0	3.2e-71
WP_041573919.1|3288825_3289014_+	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	60.7	5.9e-13
WP_013184992.1|3289096_3289537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184993.1|3289529_3289694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184994.1|3289703_3290240_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	41.3	4.9e-28
WP_013184995.1|3290236_3290743_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	45.9	8.4e-30
WP_013184996.1|3290743_3291061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013184997.1|3291073_3291499_+	transcriptional regulator	NA	A0A0C4UQZ9	Shigella_phage	37.1	3.6e-18
WP_013184998.1|3291605_3292118_+	N-acetylmuramidase	NA	W8EIS8	Vibrio_phage	40.3	4.1e-24
WP_013184999.1|3292117_3292375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185000.1|3292358_3292586_+	hypothetical protein	NA	A0A2D1GNW8	Pseudomonas_phage	52.8	5.5e-13
WP_013185001.1|3292582_3293182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185002.1|3293178_3293400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113935507.1|3293392_3293686_+	DUF2730 domain-containing protein	NA	M4M9P7	Vibrio_phage	37.2	1.2e-12
WP_038220749.1|3293694_3293982_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	61.7	4.9e-27
WP_041573733.1|3293981_3294557_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	59.8	1.2e-53
WP_013185006.1|3294556_3296107_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	60.5	1.5e-154
WP_045107702.1|3296109_3297675_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	50.7	8.1e-140
WP_050986641.1|3297658_3298387_+|capsid	minor capsid protein	capsid	C9DGN7	Escherichia_phage	64.6	1.6e-74
WP_143767657.1|3298467_3298959_+	hypothetical protein	NA	C9DGN7	Escherichia_phage	32.5	1.5e-15
WP_013185008.1|3298955_3299426_+	phage virion morphogenesis protein	NA	C9DGN8	Escherichia_phage	43.5	2.3e-21
WP_013185009.1|3299592_3300810_+|protease	protease	protease	C9DGP0	Escherichia_phage	40.7	2.9e-60
WP_013185010.1|3300809_3301733_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	58.4	6.3e-108
WP_013185011.1|3301794_3302103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185012.1|3302099_3302552_+	DUF1320 family protein	NA	A0A1B0T6F3	Thiobacimonas_phage	30.0	6.2e-08
WP_013185013.1|3302551_3303094_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	48.8	1.1e-40
WP_065814204.1|3303090_3303267_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_013185015.1|3303266_3304739_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	52.8	1.3e-134
WP_013185016.1|3304754_3305114_+|tail	tail tube protein	tail	C9DGP8	Escherichia_phage	42.1	1.2e-19
WP_013185017.1|3305116_3305470_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	49.1	6.1e-19
WP_013185019.1|3305602_3307450_+	hypothetical protein	NA	M4MHE6	Vibrio_phage	26.5	5.8e-36
WP_013185020.1|3307449_3308850_+	DNA circulation protein	NA	NA	NA	NA	NA
WP_010847256.1|3308842_3309931_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	41.5	3.9e-72
WP_013185021.1|3309927_3310473_+|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	35.9	3.7e-23
WP_013185022.1|3310469_3310919_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.4	3.8e-34
WP_013185023.1|3310919_3311993_+|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	48.7	6.9e-90
WP_013185024.1|3311983_3312565_+	DUF2313 domain-containing protein	NA	A0A2I7S9L6	Vibrio_phage	32.6	6.1e-24
WP_013185025.1|3312574_3313591_+	hypothetical protein	NA	A0A0C4UQS2	Shigella_phage	48.5	1.9e-17
WP_041573734.1|3313593_3314127_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	43.8	7.0e-27
WP_013185027.1|3314252_3314684_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	54.1	3.6e-13
WP_013185028.1|3314870_3315146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013185029.1|3315425_3316079_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_013185031.1|3316329_3316596_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	63.1	1.6e-16
WP_038251985.1|3316746_3317181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010848814.1|3317262_3317592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010848815.1|3318326_3318746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010848816.1|3319055_3319667_-	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	61.5	4.3e-12
WP_013185035.1|3320478_3322374_+	AAA family ATPase	NA	A0A0M4R313	Salmonella_phage	68.6	1.6e-270
WP_010848820.1|3322386_3322764_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	45.0	2.5e-26
WP_013185036.1|3322978_3323179_+	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	56.2	3.8e-10
WP_013185037.1|3323289_3324327_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	64.4	9.5e-129
WP_010848822.1|3324397_3324679_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_013185039.1|3325395_3325674_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143767658.1|3325680_3326226_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_041573924.1|3326921_3328433_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	30.4	4.4e-26
WP_013185042.1|3328521_3328785_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.8	1.9e-17
WP_013185043.1|3329061_3330723_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	79.2	7.8e-266
WP_013185044.1|3330719_3331073_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	80.3	4.8e-48
WP_013185045.1|3331203_3331638_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	60.3	3.9e-44
WP_013185046.1|3331637_3331940_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	67.7	2.0e-31
WP_041573735.1|3331932_3332271_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	53.6	2.4e-25
WP_013185048.1|3332267_3333485_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	76.5	4.0e-187
WP_013185049.1|3333487_3334036_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	70.0	1.1e-64
WP_013185050.1|3334075_3335230_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	68.0	4.4e-143
WP_012989078.1|3335392_3335581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012989079.1|3335787_3336630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012989080.1|3336632_3337367_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_013185052.1|3337870_3340303_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.2	6.7e-149
WP_013185053.1|3340306_3340717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156148029.1|3340709_3340865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013185054.1|3341058_3341241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185055.1|3341480_3341693_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	42.3	8.7e-05
WP_013185056.1|3341963_3343226_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.6	5.7e-67
3344432:3344446	attR	TGCCGGTATTGCCGT	NA	NA	NA	NA
>prophage 16
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	3474402	3566137	4432103	integrase,transposase	uncultured_virus(20.0%)	88	3482800:3482853	3511422:3511475
WP_013141539.1|3474402_3475443_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	80.9	6.8e-167
WP_143767660.1|3475933_3476155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071837867.1|3476129_3476567_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_013185205.1|3476637_3476961_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	39.6	2.6e-08
WP_013185171.1|3477010_3477310_+	antirestriction protein	NA	NA	NA	NA	NA
WP_013185172.1|3477431_3477965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185173.1|3477978_3478296_+	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_013185174.1|3478375_3479299_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_013185175.1|3479410_3480097_+	N-6 DNA methylase	NA	A0A2I7RHV5	Vibrio_phage	30.6	2.4e-19
WP_013185176.1|3480329_3481223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185177.1|3481432_3482440_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3482800:3482853	attL	TTGGTGCCCGGACTCGGAATCGAACCAAGGACACGGGGATTTTCAATCCCCTGC	NA	NA	NA	NA
WP_013185178.1|3483005_3483578_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_010846344.1|3483596_3485369_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_013185179.1|3485596_3486898_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_010846342.1|3487038_3488463_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_010846341.1|3488820_3489354_+	FxsA family protein	NA	NA	NA	NA	NA
WP_010846340.1|3489529_3489823_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	36.8	1.5e-10
WP_010846339.1|3489877_3491524_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	67.9	8.4e-188
WP_010846338.1|3491683_3492025_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_013185180.1|3492253_3493282_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_010846335.1|3493322_3493889_+	elongation factor P	NA	NA	NA	NA	NA
WP_010846333.1|3494092_3494407_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_010846332.1|3494444_3494657_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	3.1e-18
WP_010846331.1|3494875_3495046_+	helix-turn-helix transcriptional regulator	NA	S5M643	Brevibacillus_phage	45.7	7.0e-05
WP_013185182.1|3495250_3496201_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_038251398.1|3496594_3497896_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010846327.1|3497990_3498371_+	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_013185184.1|3498386_3499880_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010846325.1|3500627_3501641_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_013185185.1|3501769_3502180_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_010846323.1|3502148_3502604_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_013185187.1|3502745_3502952_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_013185188.1|3503018_3503345_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041573742.1|3503466_3503697_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_013185190.1|3503696_3504044_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	55.7	9.8e-30
WP_013184669.1|3504056_3504941_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_013184723.1|3505902_3506871_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	30.3	1.8e-20
WP_013185192.1|3508066_3508765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113967499.1|3508739_3509177_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_156148018.1|3509135_3509279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185193.1|3509247_3509571_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	39.6	2.6e-08
WP_143767662.1|3509672_3509972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185194.1|3510059_3511076_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013185122.1|3511540_3512428_+	ParA family protein	NA	NA	NA	NA	NA
3511422:3511475	attR	TTGGTGCCCGGACTCGGAATCGAACCAAGGACACGGGGATTTTCAATCCCCTGC	NA	NA	NA	NA
WP_013185195.1|3512424_3512814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185196.1|3512797_3514174_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	50.7	4.5e-110
WP_013185058.1|3515840_3516422_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_013185059.1|3516442_3516700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185198.1|3516795_3518019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185200.1|3518487_3519213_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_013185201.1|3519214_3521209_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	3.9e-38
WP_013185202.1|3521252_3521453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013185203.1|3521485_3521950_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_010846537.1|3522028_3522238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185204.1|3522255_3522768_+	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	74.4	1.3e-46
WP_071837867.1|3524469_3524907_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_013185205.1|3524977_3525301_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	39.6	2.6e-08
WP_013185207.1|3525387_3526797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013185208.1|3527202_3528252_-	Abi family protein	NA	NA	NA	NA	NA
WP_013185211.1|3529269_3529806_+	PilL protein	NA	NA	NA	NA	NA
WP_013185212.1|3529802_3530501_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_013185213.1|3530479_3531019_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_013185214.1|3531015_3533082_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_013185215.1|3533090_3533849_+	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_013185216.1|3534040_3535471_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.8	2.7e-105
WP_013185217.1|3535480_3535954_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	41.5	6.4e-32
WP_013185218.1|3535946_3537191_+	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	39.2	4.1e-70
WP_013185219.1|3537330_3538023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013185220.1|3538296_3538626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185221.1|3538622_3538859_+	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_167335073.1|3538930_3539272_+	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_013185223.1|3539282_3539657_+	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_013185143.1|3539653_3540310_+	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_013185224.1|3540306_3541143_+	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_013185225.1|3541132_3542563_+	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_013185226.1|3542562_3542919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185227.1|3542906_3543308_+	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_013185228.1|3543307_3546085_+	conjugative transfer ATPase	NA	NA	NA	NA	NA
WP_013185230.1|3547013_3547349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050986645.1|3547370_3550397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013184056.1|3550552_3551305_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.5	1.2e-53
WP_013184057.1|3551316_3552861_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.2	5.4e-128
WP_050986646.1|3552986_3555707_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.0	3.6e-34
WP_013185231.1|3555755_3557453_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_013185232.1|3557915_3561179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185233.1|3561394_3562186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013185235.1|3564066_3565089_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013185236.1|3565252_3566137_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	3642053	3692665	4432103	integrase,transposase,tRNA	Escherichia_phage(22.22%)	40	3644588:3644603	3700336:3700351
WP_013185301.1|3642053_3644867_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	26.9	2.1e-85
3644588:3644603	attL	TGAAGCGCTGGCAGAA	NA	NA	NA	NA
WP_013185302.1|3644866_3645373_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_010846291.1|3645483_3645954_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_010846292.1|3645934_3646888_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_013185303.1|3647733_3648492_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010846295.1|3648716_3649538_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_041573747.1|3649975_3651136_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.9	6.2e-52
WP_013185305.1|3651153_3654378_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_010846298.1|3654611_3654887_-	helix-turn-helix transcriptional regulator	NA	K4K6E9	Caulobacter_phage	40.0	2.7e-06
WP_013185306.1|3654904_3655738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010846300.1|3655803_3656376_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_013185307.1|3656501_3657254_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_013185308.1|3657384_3660072_-	outer membrane usher protein	NA	NA	NA	NA	NA
WP_010846304.1|3660627_3661167_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_010846305.1|3661895_3662612_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_013185310.1|3662750_3663974_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_010846308.1|3664052_3665393_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.7	3.6e-80
WP_013185311.1|3665474_3666254_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_010846310.1|3666599_3667877_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_013185313.1|3668214_3668985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010846312.1|3668985_3670110_-	patatin family protein	NA	NA	NA	NA	NA
WP_010846313.1|3670515_3670917_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_010846314.1|3671129_3672719_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.0	6.3e-31
WP_010846315.1|3672920_3673766_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_013185314.1|3674013_3674391_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041573748.1|3674942_3675704_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.6	5.4e-12
WP_010846316.1|3675829_3676270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185317.1|3676287_3677010_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013185318.1|3677014_3677584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041573749.1|3678781_3680470_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	8.8e-31
WP_045107655.1|3680654_3681128_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013141539.1|3681687_3682728_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	80.9	6.8e-167
WP_013185322.1|3682883_3683849_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013185323.1|3684007_3685624_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_010845595.1|3685636_3685966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010845594.1|3686026_3686392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013185324.1|3687039_3688656_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_010845596.1|3689662_3690988_+	membrane protein	NA	NA	NA	NA	NA
WP_010845597.1|3691482_3691626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010845598.1|3692101_3692665_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.0	1.9e-51
3700336:3700351	attR	TGAAGCGCTGGCAGAA	NA	NA	NA	NA
>prophage 18
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	3760164	3893597	4432103	portal,tRNA,capsid,bacteriocin,protease,transposase,tail,head,terminase	uncultured_Caudovirales_phage(25.0%)	110	NA	NA
WP_013185355.1|3760164_3760419_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_010848678.1|3760557_3761904_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.0	2.2e-157
WP_013185356.1|3762611_3764180_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_010848681.1|3764460_3765246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010848682.1|3765238_3765877_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_013185357.1|3765970_3767233_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_013185358.1|3767348_3769901_+	nitrite reductase large subunit	NA	NA	NA	NA	NA
WP_013185359.1|3769897_3770227_+	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_010848686.1|3770389_3771358_+	glucokinase	NA	NA	NA	NA	NA
WP_041573751.1|3771660_3773406_+	beta-ketoacyl synthase	NA	NA	NA	NA	NA
WP_041573752.1|3774005_3774842_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_010848690.1|3774854_3775262_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010848691.1|3775790_3776180_-|transposase	transposase	transposase	Q716C2	Shigella_phage	64.6	1.1e-32
WP_010848692.1|3776373_3776889_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	65.5	8.8e-59
WP_013185362.1|3777138_3779970_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.5	1.7e-308
WP_010848694.1|3780391_3780958_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_013185364.1|3781064_3782261_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_010848696.1|3782326_3783406_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	4.4e-28
WP_041573753.1|3783503_3784913_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	76.3	6.1e-195
WP_013185366.1|3785336_3785732_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_013185370.1|3787599_3788583_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_013185371.1|3788630_3789659_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_013185372.1|3789819_3793074_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_013185374.1|3793250_3794540_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013185375.1|3794539_3796822_-	N-6 DNA methylase	NA	A0A220A2U5	Liberibacter_phage	25.7	9.7e-25
WP_143767665.1|3796977_3797196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185377.1|3797249_3797660_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_010848768.1|3797960_3798473_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_010848769.1|3798614_3799232_-	repressor LexA	NA	U5P451	Shigella_phage	44.6	1.4e-10
WP_010848770.1|3799350_3799722_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_013185378.1|3799858_3802327_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_010848772.1|3802445_3803300_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_038219455.1|3803313_3803841_-	chorismate lyase	NA	NA	NA	NA	NA
WP_013185381.1|3804022_3805669_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_010848775.1|3805934_3807308_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_010848776.1|3807504_3807732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010848777.1|3807709_3808036_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_010848779.1|3808189_3809020_+	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_010848780.1|3809171_3809813_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_013185382.1|3809958_3810525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041573754.1|3810773_3812498_-	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_010848783.1|3812574_3813882_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_038219458.1|3813944_3815543_-	malate synthase A	NA	NA	NA	NA	NA
WP_013185387.1|3817266_3817608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041573755.1|3817579_3818053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185389.1|3818139_3818424_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_013185390.1|3818435_3819260_+	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	48.4	5.1e-24
WP_071827978.1|3819642_3819843_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	46.6	2.0e-06
WP_010848794.1|3820175_3820535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185394.1|3823929_3824850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071837872.1|3824846_3825242_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_013185395.1|3825366_3826401_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.5	2.4e-132
WP_013185396.1|3826444_3826993_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	69.4	1.0e-65
WP_013185397.1|3826995_3828213_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	75.8	4.5e-186
WP_041573756.1|3828209_3828548_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	55.5	1.3e-26
WP_013185399.1|3828540_3828843_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	63.5	1.6e-28
WP_013185400.1|3828843_3829278_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	60.8	6.1e-45
WP_013185402.1|3829556_3829916_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	73.5	2.5e-44
WP_013185403.1|3829927_3831589_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	78.5	1.0e-265
WP_013185404.1|3831867_3832125_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.8	8.3e-18
WP_010849030.1|3832465_3833407_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_010848645.1|3839046_3839613_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_013185408.1|3839792_3840824_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	36.4	4.8e-32
WP_013185409.1|3840816_3841470_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_013185410.1|3841597_3842413_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_010848639.1|3842568_3842964_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_013185411.1|3842981_3843689_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_013185412.1|3843804_3845526_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013185413.1|3845599_3846301_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_013185414.1|3846763_3847027_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_013185415.1|3847123_3848455_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_013185417.1|3848857_3849817_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_010848632.1|3849829_3853312_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.4	3.6e-204
WP_113935493.1|3853327_3853921_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	42.2	4.1e-28
WP_041573757.1|3853917_3855102_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_013185420.1|3855106_3855904_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_010848628.1|3855907_3856360_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_010848627.1|3856573_3857602_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_010848626.1|3857606_3858104_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_013185421.1|3858209_3860600_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_013185422.1|3860634_3861987_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_010848623.1|3861996_3862860_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010848622.1|3862869_3863625_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	9.3e-25
WP_010848621.1|3863888_3865085_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_010848620.1|3865241_3865799_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_010848619.1|3865974_3866703_-	UMP kinase	NA	NA	NA	NA	NA
WP_013185424.1|3866842_3867700_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_010848617.1|3867920_3868646_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_010848616.1|3869023_3869821_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_013185425.1|3869985_3872640_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_010848614.1|3872680_3873505_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_010848608.1|3873933_3874320_+	DUF3461 family protein	NA	NA	NA	NA	NA
WP_010848607.1|3874418_3874865_-	flavodoxin	NA	NA	NA	NA	NA
WP_010848606.1|3874900_3875653_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_013185427.1|3875654_3875981_-	YqcC family protein	NA	NA	NA	NA	NA
WP_013185429.1|3876578_3877130_-	SecY-interacting protein	NA	NA	NA	NA	NA
WP_013185430.1|3877562_3879254_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_013185431.1|3879398_3880244_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	38.1	5.0e-43
WP_013185432.1|3880500_3881256_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	29.9	3.1e-12
WP_013185433.1|3881324_3882722_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_013185434.1|3882727_3884065_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_041573964.1|3884116_3885907_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	23.8	9.3e-23
WP_013185436.1|3885927_3886260_-|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_013185437.1|3886444_3887881_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_010848594.1|3888255_3889353_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_010848593.1|3889345_3889741_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_013185438.1|3889762_3890689_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_013185439.1|3891093_3892302_+	cysteine desulfurase CsdA	NA	A0A2K9L2Y3	Tupanvirus	30.5	1.1e-59
WP_013185440.1|3892320_3892779_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_013185441.1|3892784_3893597_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	34.3	3.5e-17
>prophage 19
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	3930292	4029979	4432103	portal,tRNA,capsid,protease,transposase,tail,head,terminase,integrase	uncultured_Caudovirales_phage(24.24%)	92	3972249:3972293	3990113:3990157
WP_013185461.1|3930292_3930946_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_010847805.1|3930980_3931799_-	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_038219578.1|3931981_3934333_+	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_013185463.1|3934441_3935746_+	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_013185464.1|3935723_3936725_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_013185465.1|3936717_3937527_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_010847810.1|3937572_3937950_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_010847811.1|3937953_3938781_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A096XT93	Enterococcus_phage	44.9	2.8e-06
WP_010847812.1|3938828_3939314_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	40.7	1.8e-29
WP_010847814.1|3939542_3940964_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_013185467.1|3941339_3942071_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_010847819.1|3942200_3944453_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.4	2.1e-88
WP_010847820.1|3944492_3946388_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.5	5.3e-93
WP_010847821.1|3946461_3947070_-	esterase YqiA	NA	NA	NA	NA	NA
WP_010847822.1|3947069_3947909_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_010847823.1|3948006_3948648_-	ADP-ribose diphosphatase	NA	NA	NA	NA	NA
WP_013185468.1|3948864_3950229_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_010847825.1|3950408_3951092_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	47.1	2.3e-38
WP_010847826.1|3951098_3952259_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	46.0	5.2e-91
WP_010847827.1|3952264_3953041_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_010847829.1|3953394_3954048_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	42.9	7.0e-45
WP_010847831.1|3954503_3954779_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_013185469.1|3954881_3956306_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.1	2.1e-38
WP_013185470.1|3956419_3959269_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_013185471.1|3959335_3960310_-	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_013185472.1|3960580_3961201_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_013185473.1|3961217_3962390_+	multifunctional CCA addition/repair protein	NA	A0A1V0E714	Klebsiella_phage	40.3	9.3e-72
WP_013185474.1|3962472_3962826_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_010847838.1|3962934_3963588_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_010847839.1|3963896_3964937_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013185475.1|3965394_3966432_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.6	1.3e-104
WP_001144069.1|3966868_3967084_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010847841.1|3967198_3968947_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.8	2.5e-73
WP_013185476.1|3969259_3971110_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.2	3.2e-34
WP_013185477.1|3971164_3971926_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
3972249:3972293	attL	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCA	NA	NA	NA	NA
WP_013185478.1|3972489_3972753_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	66.2	5.0e-18
WP_041573759.1|3973215_3974418_-|tail	tail fiber protein	tail	A0A2H4PRH0	Proteus_phage	55.6	4.3e-40
WP_013185480.1|3974714_3976376_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	78.8	1.9e-267
WP_013185481.1|3976372_3976726_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.2	4.8e-48
WP_013185482.1|3976858_3977287_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	56.4	1.1e-41
WP_013185483.1|3977286_3977583_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	63.5	1.7e-30
WP_013185484.1|3977575_3977914_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	50.5	9.6e-22
WP_041573760.1|3977910_3979131_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	77.1	9.0e-187
WP_013185486.1|3979130_3979679_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	74.2	3.7e-63
WP_013185487.1|3979723_3980875_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	68.8	1.0e-147
WP_013185488.1|3981293_3981980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038219546.1|3981972_3982389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038265489.1|3982385_3982865_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_013183332.1|3983444_3983768_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	41.6	1.1e-09
WP_156148018.1|3983736_3983880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013183333.1|3983865_3984276_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013185491.1|3984399_3986814_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	39.6	1.4e-146
WP_013185492.1|3986817_3987228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158309332.1|3987220_3987466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013185494.1|3987566_3987749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185495.1|3988089_3988311_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013185496.1|3988486_3989896_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_010847864.1|3991873_3992155_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	41.4	9.1e-10
3990113:3990157	attR	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCA	NA	NA	NA	NA
WP_010847870.1|3994166_3994436_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	48.2	1.8e-15
WP_010847874.1|3995354_3995783_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	2.4e-25
WP_013184479.1|3995839_3996982_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	69.0	4.9e-134
WP_013185498.1|3996991_3997318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013185499.1|3997567_3997834_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	68.6	9.8e-30
WP_010847794.1|3998235_3999405_+	MFS transporter	NA	NA	NA	NA	NA
WP_010847793.1|3999543_3999723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185501.1|3999736_4001092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185502.1|4001612_4002548_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_010847789.1|4002582_4003179_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013185503.1|4003441_4005463_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_010847787.1|4005517_4006762_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_010847786.1|4007543_4008212_+	DedA family protein	NA	NA	NA	NA	NA
WP_010847785.1|4008422_4008728_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_010847784.1|4008729_4009131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010847783.1|4009123_4009405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010847782.1|4009685_4010081_+	DoxX family protein	NA	NA	NA	NA	NA
WP_010847781.1|4010169_4011063_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010847780.1|4011219_4011918_+	pirin family protein	NA	NA	NA	NA	NA
WP_010847779.1|4012470_4013334_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.1	1.3e-49
WP_041573966.1|4013397_4015278_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_010847777.1|4015264_4015657_+	YraN family protein	NA	NA	NA	NA	NA
WP_010847776.1|4015708_4016299_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.9	1.3e-10
WP_010847775.1|4016310_4016886_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_010847774.1|4016991_4017543_+	DUF2931 family protein	NA	NA	NA	NA	NA
WP_010847773.1|4017529_4017682_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_010847772.1|4017858_4018587_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_013185510.1|4018591_4019245_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_013185511.1|4019481_4021815_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.4	1.1e-39
WP_010847768.1|4022147_4022276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013185512.1|4022498_4026956_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_010847766.1|4026966_4028385_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013185514.1|4028708_4029218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010847764.1|4029493_4029979_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	45.5	1.8e-29
>prophage 20
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	4051878	4101402	4432103	integrase,transposase,tRNA,protease	Escherichia_phage(11.11%)	42	4059977:4059991	4092553:4092567
WP_013141539.1|4051878_4052919_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	80.9	6.8e-167
WP_013185531.1|4054273_4054462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185532.1|4054833_4056066_+	alanine racemase	NA	NA	NA	NA	NA
WP_010847723.1|4056259_4056670_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_010847722.1|4056810_4057002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185534.1|4057329_4057518_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_010847721.1|4057580_4057988_+	HicB family protein	NA	A0A0R6PK80	Moraxella_phage	31.4	1.4e-14
WP_010847720.1|4058385_4059729_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_013185535.1|4059927_4060464_+	ribosome-associated protein	NA	NA	NA	NA	NA
4059977:4059991	attL	AAGAAGAAGAAATAA	NA	NA	NA	NA
WP_013185536.1|4060699_4060954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185537.1|4061006_4064672_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_013185538.1|4064671_4065292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185539.1|4065291_4066530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041573763.1|4066526_4067399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185541.1|4067565_4068099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185542.1|4068091_4069012_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_013184177.1|4069291_4070176_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_010847716.1|4070604_4071552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185544.1|4072449_4072623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013185545.1|4072666_4073359_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_013185546.1|4073487_4074378_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013185547.1|4074532_4075813_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_013185548.1|4076205_4077504_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_010847709.1|4077504_4077756_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013185550.1|4078736_4079777_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_013183573.1|4080472_4081234_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.0	1.4e-12
WP_013185552.1|4081199_4082483_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.5	2.6e-99
WP_143767689.1|4082611_4083808_-	MFS transporter	NA	NA	NA	NA	NA
WP_013185554.1|4083809_4084415_-	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_050986650.1|4084414_4085701_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_013185556.1|4085690_4086371_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_013185557.1|4086363_4086921_-	DUF84 family protein	NA	NA	NA	NA	NA
WP_013185560.1|4089590_4089785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013185561.1|4090008_4090188_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	49.2	1.0e-06
WP_013185562.1|4090361_4090571_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	45.6	8.3e-08
WP_013185563.1|4090724_4091981_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.0e-73
WP_010847689.1|4092613_4093831_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
4092553:4092567	attR	AAGAAGAAGAAATAA	NA	NA	NA	NA
WP_010847688.1|4093924_4095004_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_010847687.1|4095003_4096104_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_010847686.1|4096384_4097893_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	9.2e-48
WP_010847685.1|4098011_4098491_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_013185565.1|4098504_4101402_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.6	3.2e-142
>prophage 21
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	4104650	4151504	4432103	integrase,transposase	Stx2-converting_phage(20.0%)	35	4095465:4095482	4155271:4155288
4095465:4095482	attL	CATAACGTGTTCCCTGAT	NA	NA	NA	NA
WP_013183332.1|4104650_4104974_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	41.6	1.1e-09
WP_156148018.1|4104942_4105086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013183333.1|4105071_4105482_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013183081.1|4105575_4106460_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_013185570.1|4106611_4106896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013185571.1|4106967_4107585_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.5	6.5e-16
WP_013184056.1|4107650_4108403_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.5	1.2e-53
WP_013184057.1|4108414_4109959_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.2	5.4e-128
WP_013183349.1|4110170_4110518_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.4	2.9e-42
WP_041573764.1|4112403_4112985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010848468.1|4113525_4114125_-	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_041573765.1|4114139_4115291_-	MFS transporter	NA	NA	NA	NA	NA
WP_013185578.1|4115443_4116097_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	28.3	5.3e-08
WP_010848471.1|4116122_4117184_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_010848472.1|4117183_4118434_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	3.4e-32
WP_013185579.1|4118660_4121375_-	HTH-type transcriptional regulator MalT	NA	NA	NA	NA	NA
WP_013185580.1|4121793_4124244_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	7.0e-13
WP_013185581.1|4124269_4126420_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_013185582.1|4126587_4127478_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_013185583.1|4127490_4129047_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_013185584.1|4129139_4130339_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_013185585.1|4130794_4131904_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	51.7	5.6e-18
WP_013185586.1|4131938_4133195_+	maltoporin	NA	NA	NA	NA	NA
WP_013185587.1|4133194_4134166_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_010848483.1|4136860_4137724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010848487.1|4139342_4139603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010848488.1|4139650_4140091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013185596.1|4141574_4143314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071837873.1|4145160_4145937_-	DNA helicase	NA	NA	NA	NA	NA
WP_013185600.1|4146806_4147532_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_013185601.1|4147805_4149161_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_013185602.1|4149337_4150180_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_013185603.1|4150517_4150688_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013185604.1|4150827_4151196_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_013185606.1|4151195_4151504_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	58.3	3.2e-24
4155271:4155288	attR	ATCAGGGAACACGTTATG	NA	NA	NA	NA
>prophage 22
NZ_LN681227	Xenorhabdus nematophila AN6/1 chromosome I	4432103	4290644	4425029	4432103	plate,transposase,tRNA	Planktothrix_phage(11.76%)	113	NA	NA
WP_010848428.1|4290644_4291061_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	9.9e-45
WP_010848429.1|4291138_4291846_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_013185688.1|4292091_4293108_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	1.2e-19
WP_010848431.1|4293104_4294085_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.0e-15
WP_013185689.1|4294097_4295015_-	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_010848433.1|4295025_4296045_-	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_010848434.1|4296186_4297797_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010848435.1|4298249_4298465_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_013185690.1|4298797_4300882_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_010848438.1|4300891_4301812_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_013185691.1|4302008_4302572_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_013185692.1|4302801_4304058_+	valine--pyruvate transaminase	NA	NA	NA	NA	NA
WP_010848441.1|4304797_4304956_+	putative rSAM-modified RiPP, XyeA family	NA	NA	NA	NA	NA
WP_010848442.1|4305016_4306195_+	XyeB family radical SAM/SPASM peptide maturase	NA	NA	NA	NA	NA
WP_013185693.1|4306207_4307113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185694.1|4307087_4308365_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013185695.1|4308367_4310473_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.5	3.3e-27
WP_038218955.1|4311009_4311339_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_010848447.1|4311415_4312705_-	DUF3748 domain-containing protein	NA	NA	NA	NA	NA
WP_010848448.1|4312838_4313456_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_010848449.1|4313494_4315228_-	NAD-dependent DNA ligase LigB	NA	G3M9X7	Bacillus_virus	23.6	1.7e-21
WP_010848450.1|4315534_4316158_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	32.7	1.5e-12
WP_013185697.1|4316212_4316488_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_010848452.1|4316506_4318621_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	36.6	2.8e-10
WP_010848453.1|4318626_4319334_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_010848454.1|4319358_4321440_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_010848455.1|4321523_4322738_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_010848457.1|4322979_4324368_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	77.2	5.7e-52
WP_013185698.1|4324569_4326342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185699.1|4326331_4327249_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_013185700.1|4327319_4327757_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_010848461.1|4328117_4329941_-	ribosome-dependent GTPase TypA	NA	NA	NA	NA	NA
WP_010848462.1|4330548_4330776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041573772.1|4331187_4331646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050986652.1|4331710_4332046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185705.1|4332163_4332754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185706.1|4333236_4333488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071837874.1|4333480_4333918_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_013185205.1|4333988_4334312_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	39.6	2.6e-08
WP_041573773.1|4334348_4334543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185709.1|4334529_4335024_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_013185710.1|4335005_4335878_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	24.1	1.5e-05
WP_013185713.1|4336327_4337728_-	membrane protein	NA	NA	NA	NA	NA
WP_013185714.1|4337810_4341416_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_010848907.1|4341412_4342855_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_013185715.1|4342860_4343532_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_010848905.1|4343528_4344326_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_013185716.1|4344325_4347061_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	28.4	2.5e-88
WP_010848903.1|4347070_4347838_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_010848902.1|4347840_4349193_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_013185717.1|4349195_4349750_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_013185718.1|4349733_4351029_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_010848899.1|4351034_4352087_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_010848898.1|4352050_4353883_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_010848897.1|4353883_4354324_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_010848896.1|4354326_4355805_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_010848895.1|4355824_4356322_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_010848894.1|4357252_4357771_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_013185719.1|4358400_4360074_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_013185720.1|4360189_4364602_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010848891.1|4364796_4365774_+	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_013185721.1|4365867_4366074_+	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_113935497.1|4366171_4366261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156148030.1|4368563_4368710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013185727.1|4371470_4372664_-	CmlA/FloR family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	30.9	4.4e-29
WP_113967477.1|4373198_4373384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081480208.1|4373723_4374842_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.5	1.2e-31
WP_010849017.1|4375035_4375341_+	MFS transporter	NA	NA	NA	NA	NA
WP_010849018.1|4375344_4376094_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013184669.1|4377280_4378165_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_013185735.1|4379407_4380103_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	38.2	8.6e-33
WP_013185737.1|4380320_4380647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010846212.1|4380647_4381127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010846211.1|4381357_4383022_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_013185738.1|4383072_4384506_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_010846209.1|4384783_4385230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010846207.1|4385607_4386171_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_041573775.1|4386522_4388643_+	intracellular growth attenuator protein IgaA	NA	NA	NA	NA	NA
WP_013185741.1|4388623_4389046_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_013185742.1|4389128_4390001_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_013185743.1|4390199_4391822_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.7	2.6e-141
WP_013185744.1|4391888_4392584_-	pirin family protein	NA	NA	NA	NA	NA
WP_013183081.1|4392857_4393742_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_010846200.1|4393867_4394797_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013185745.1|4394809_4396054_-	AMP-dependent ligase	NA	NA	NA	NA	NA
WP_013185746.1|4396068_4398504_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_013185747.1|4398505_4399636_-	acyl-protein synthase	NA	NA	NA	NA	NA
WP_010846196.1|4400756_4400906_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_010846195.1|4400908_4401346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013185748.1|4401497_4402712_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013185749.1|4403011_4404502_+	inorganic phosphate transporter PitA	NA	NA	NA	NA	NA
WP_010846191.1|4404627_4404957_-	universal stress protein UspB	NA	NA	NA	NA	NA
WP_013185752.1|4406511_4406679_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013185753.1|4406778_4407198_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013185754.1|4407194_4407506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013185755.1|4408078_4410151_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_010846184.1|4410479_4411421_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_013185756.1|4411491_4411779_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_010846182.1|4411791_4412568_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_010846181.1|4412584_4413088_+	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
WP_010846180.1|4413103_4414222_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	M4QRZ2	Synechococcus_phage	42.5	1.6e-12
WP_010846179.1|4414262_4415036_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_013185757.1|4415039_4415837_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_013185758.1|4415839_4417468_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_013185759.1|4417460_4417997_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_013185760.1|4417993_4419208_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_013185761.1|4419293_4420637_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_010846171.1|4420774_4421053_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_013185762.1|4421049_4421550_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013185763.1|4421637_4422579_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_013185764.1|4422921_4423311_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_010846167.1|4423310_4423574_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013141539.1|4423988_4425029_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	80.9	6.8e-167
>prophage 1
NZ_LN681228	Xenorhabdus nematophila AN6/1 plasmid II, complete sequence	154559	17873	133140	154559	transposase	Enterobacteria_phage(28.57%)	95	NA	NA
WP_143767691.1|17873_19044_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	36.8	4.2e-16
WP_041573977.1|19264_24751_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_013141551.1|24899_25607_+	DsbC family protein	NA	NA	NA	NA	NA
WP_013141552.1|25603_28048_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_013141553.1|28062_28380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141554.1|28376_28907_+	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_013141555.1|28869_30135_+	conjugal transfer protein TraW	NA	NA	NA	NA	NA
WP_013141556.1|30131_30803_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_013141557.1|30799_31807_+	conjugal transfer protein TraU	NA	NA	NA	NA	NA
WP_041573978.1|31922_34727_+	conjugal transfer mating pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_013141559.1|34764_35628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041979271.1|35749_36391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141561.1|36683_37004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141563.1|37242_37494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141564.1|37712_38681_+	AAA domain-containing protein	NA	L7TKP0	Rhizobium_phage	32.6	1.0e-28
WP_013141565.1|38691_39597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038220030.1|39756_40749_+	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	53.5	6.2e-53
WP_041573979.1|42045_43323_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_013141568.1|43408_45205_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_038220028.1|45266_45602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141570.1|46496_46997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141572.1|48305_48695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041573981.1|48684_49140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041979292.1|49144_49369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038220026.1|49560_49791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041573982.1|49994_51620_+	DNA cytosine methyltransferase	NA	A0A218MKT0	uncultured_virus	23.8	9.4e-06
WP_038220024.1|51680_52112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038220023.1|52184_52739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141579.1|52973_53267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141580.1|53334_53721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141582.1|56565_56769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141583.1|56840_57446_+	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_013141584.1|57438_57705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141585.1|57701_57914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021293661.1|57983_58541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041573983.1|58616_59468_+	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	30.6	7.3e-10
WP_013141588.1|59674_59824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141589.1|59930_60317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041574007.1|60493_62221_+	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	33.5	5.8e-14
WP_041573984.1|62207_62489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021326768.1|62561_62801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141592.1|62810_62927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141593.1|63056_64457_-|transposase	ISKra4-like element ISXne1 family transposase	transposase	NA	NA	NA	NA
WP_081480233.1|64585_65224_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_041573985.1|65262_65553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141597.1|66061_66403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041573986.1|66595_66937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141600.1|67350_69318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143767692.1|70726_70930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141603.1|70957_73936_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	43.8	1.1e-238
WP_013141604.1|73965_74589_-	recombinase family protein	NA	NA	NA	NA	NA
WP_041573990.1|75118_75814_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.0	1.5e-40
WP_143767693.1|75828_76314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141608.1|76306_77200_-	AAA domain-containing protein	NA	A0A2L0UZ48	Agrobacterium_phage	37.7	1.5e-18
WP_050986661.1|77196_78393_-	MFS transporter	NA	NA	NA	NA	NA
WP_143767694.1|78407_79607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156148031.1|79684_79855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141611.1|80243_81263_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_162097870.1|81399_81540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141611.1|81995_83015_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013141613.1|83677_84169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141614.1|84474_85350_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_050986662.1|85416_86106_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	29.1	2.7e-10
WP_071837887.1|86109_88287_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_013141615.1|88670_88958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045107714.1|89089_89497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141617.1|89993_91022_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013141619.1|93701_94121_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	35.5	2.7e-13
WP_143767695.1|94206_94962_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	39.5	2.5e-30
WP_113935478.1|94942_95476_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_010847891.1|95504_95945_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041573992.1|97032_97950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038220575.1|98780_99329_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	49.7	2.0e-40
WP_013141628.1|105559_106135_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.7	5.8e-27
WP_013141629.1|106131_106404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141630.1|106551_108336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141631.1|108335_109088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041573993.1|109084_110389_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_041574015.1|110397_111111_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_041573994.1|111136_111451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141635.1|111494_112370_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_013141637.1|112794_113205_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013141640.1|113986_114817_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	54.9	5.2e-85
WP_013141641.1|114824_115436_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.7	7.3e-36
WP_113935518.1|116232_117481_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	31.8	1.4e-17
WP_013141646.1|118164_121206_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	23.3	2.1e-35
WP_038220575.1|121337_121886_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	49.7	2.0e-40
WP_041573992.1|123738_124656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041573995.1|125784_126291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081480233.1|126660_127299_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_013141593.1|127427_128828_+|transposase	ISKra4-like element ISXne1 family transposase	transposase	NA	NA	NA	NA
WP_013141651.1|128976_130017_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_013141652.1|130016_130295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141539.1|130745_131786_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	80.9	6.8e-167
WP_013184655.1|131931_133140_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.4	8.7e-49
