The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004379	Burkholderia pseudomallei 1026b chromosome 1, complete sequence	4092218	16045	25289	4092218		unidentified_phage(16.67%)	7	NA	NA
WP_004522151.1|16045_17593_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
WP_004194373.1|17629_18157_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004532195.1|18153_18837_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_004194137.1|18901_19717_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004538732.1|19900_21907_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.5	8.2e-52
WP_004522147.1|21940_23071_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	1.7e-22
WP_004194034.1|23336_25289_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
>prophage 2
NZ_CP004379	Burkholderia pseudomallei 1026b chromosome 1, complete sequence	4092218	308318	408607	4092218	tail,portal,tRNA,protease,holin,head,capsid,plate,terminase	Burkholderia_phage(80.7%)	107	NA	NA
WP_004521984.1|308318_309617_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004527811.1|309683_310766_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	6.7e-08
WP_004534980.1|310809_311667_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004186955.1|311746_312055_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_004521981.1|312069_312666_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_004521980.1|312949_313738_+	dioxygenase	NA	NA	NA	NA	NA
WP_004527813.1|314089_315691_-	APC family permease	NA	NA	NA	NA	NA
WP_004196837.1|316124_316328_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	73.1	6.3e-21
WP_004198058.1|316514_317777_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_004198059.1|318439_319045_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004198060.1|319006_319582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198061.1|319541_320825_-	MFS transporter	NA	NA	NA	NA	NA
WP_004553840.1|320983_321628_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004527819.1|321965_322589_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_004535010.1|322680_323583_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004535007.1|323710_324847_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004539229.1|324823_325129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004553841.1|325203_326322_-	acyltransferase	NA	NA	NA	NA	NA
WP_076811889.1|326320_326800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199982.1|326759_327263_-	lipoprotein	NA	NA	NA	NA	NA
WP_004553842.1|327866_330032_+	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	27.1	1.9e-46
WP_076873039.1|330613_331012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185238.1|331087_331324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204906.1|331426_331657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004521964.1|331890_332247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199991.1|332272_333541_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004521963.1|333555_335817_+	peptidase domain-containing ABC transporter	NA	A0A2R8FG22	Brazilian_cedratvirus	31.9	2.3e-10
WP_004199995.1|335813_337262_+	TolC family protein	NA	NA	NA	NA	NA
WP_004521960.1|337471_338440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199998.1|338565_339417_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_004200000.1|339567_339681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004553845.1|339688_343582_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004200003.1|343578_344568_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004527834.1|344572_345505_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004521957.1|345703_346825_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004549921.1|346914_349584_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.1	1.7e-89
WP_004200010.1|349617_350718_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004527836.1|350681_352520_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004204912.1|352599_353082_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004527837.1|353139_353643_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004521953.1|353715_355206_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004521952.1|355222_355741_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004531875.1|355777_356449_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521950.1|356823_357438_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004521949.1|357546_358893_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004521948.1|358889_359675_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004553848.1|359776_360142_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	87.6	3.3e-52
WP_111963042.1|360245_360836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076880366.1|361231_361834_-	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	87.9	5.6e-81
WP_004527843.1|361731_362145_-|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	100.0	8.0e-71
WP_004552669.1|362137_362464_-	hypothetical protein	NA	A4JWY2	Burkholderia_virus	99.1	2.3e-52
WP_031313497.1|363235_363853_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_004552667.1|363855_365112_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	26.2	3.6e-21
WP_006027262.1|365779_366076_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	99.0	5.6e-50
WP_004202809.1|366078_366435_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_004531045.1|366478_367534_-|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	100.0	4.0e-207
WP_004531046.1|367530_369300_-|terminase	terminase ATPase subunit family protein	terminase	K4NXI4	Burkholderia_phage	100.0	0.0e+00
WP_004552664.1|369443_370253_+|capsid	GPO family capsid scaffolding protein	capsid	K4PAW2	Burkholderia_phage	100.0	4.2e-148
WP_004531048.1|370286_371300_+|capsid	phage major capsid protein, P2 family	capsid	K4NZP8	Burkholderia_phage	100.0	7.2e-190
WP_004531049.1|371296_371986_+|terminase	terminase endonuclease subunit	terminase	K4NX86	Burkholderia_phage	100.0	2.5e-117
WP_004531050.1|372085_372565_+|head	head completion/stabilization protein	head	K4NZV5	Burkholderia_phage	100.0	5.8e-81
WP_004524437.1|372564_372816_+	hypothetical protein	NA	K4NXI9	Burkholderia_phage	100.0	7.6e-40
WP_004524438.1|372812_373019_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	100.0	2.4e-31
WP_004524439.1|373033_373378_+	membrane protein	NA	K4NZQ3	Burkholderia_phage	100.0	2.9e-50
WP_004524440.1|373379_373652_+|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	100.0	8.8e-42
WP_004531051.1|373648_374461_+	DUF3380 domain-containing protein	NA	K4NZW0	Burkholderia_phage	100.0	1.2e-150
WP_038741668.1|374457_374898_+	protein lysB	NA	K4NXJ2	Burkholderia_phage	99.3	7.2e-70
WP_004531054.1|375002_375419_+|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	100.0	3.3e-72
WP_004531055.1|375415_375883_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	100.0	1.2e-78
WP_009897040.1|376009_376540_+	hypothetical protein	NA	K4NX96	Burkholderia_phage	100.0	3.0e-94
WP_004531056.1|376705_377482_-	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	100.0	1.6e-149
WP_004531057.1|377655_378336_+|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	100.0	3.0e-123
WP_004531058.1|378332_378695_+|plate	bacteriophage baseplate assembly protein W	plate	K4PAX6	Burkholderia_phage	100.0	1.7e-61
WP_014696810.1|378691_379597_+|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	99.7	8.8e-163
WP_004531060.1|379589_380144_+|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	100.0	2.2e-100
WP_038803061.1|380154_382518_+	phage Tail collar domain protein	NA	K4NZW8	Burkholderia_phage	100.0	0.0e+00
WP_004531062.1|382534_383206_+|tail	phage tail fiber assembly protein	tail	K4NXJ9	Burkholderia_phage	100.0	3.0e-115
WP_014696808.1|383261_384434_+|tail	phage tail sheath protein	tail	K4PAY0	Burkholderia_phage	100.0	1.5e-223
WP_004524455.1|384449_384959_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	100.0	4.9e-94
WP_004531064.1|385016_385361_+|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	100.0	1.0e-55
WP_004552648.1|385369_385483_+|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	100.0	5.4e-14
WP_004555835.1|385485_388446_+	hypothetical protein	NA	K4NZX3	Burkholderia_phage	100.0	0.0e+00
WP_009976644.1|388463_388889_+|tail	phage tail protein	tail	K4NXK5	Burkholderia_phage	99.3	1.5e-72
WP_004552642.1|388888_389989_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	100.0	3.6e-203
WP_004549903.1|390002_390434_-	hypothetical protein	NA	A0A089FKT7	Burkholderia_phage	100.0	8.6e-76
WP_004549902.1|390868_391591_-	hypothetical protein	NA	K4NZS4	Burkholderia_phage	100.0	1.1e-126
WP_004549901.1|391643_392102_-	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	100.0	5.2e-79
WP_004531068.1|392185_392422_+	hypothetical protein	NA	K4NZX7	Burkholderia_phage	100.0	2.4e-35
WP_004549900.1|392425_392722_+	phage DNA-binding protein	NA	E5E3P2	Burkholderia_phage	84.3	5.4e-37
WP_004549899.1|392709_392958_+	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	100.0	3.0e-41
WP_004524465.1|393043_393589_+	Bro-N domain-containing protein	NA	K4NZS9	Burkholderia_phage	100.0	7.8e-98
WP_004549898.1|393604_393823_+	hypothetical protein	NA	K4NXB1	Burkholderia_phage	100.0	1.1e-34
WP_004524466.1|393828_394026_+	hypothetical protein	NA	K4NZY3	Burkholderia_phage	100.0	1.6e-29
WP_045586665.1|394069_394264_+	hypothetical protein	NA	K4NXL1	Burkholderia_phage	98.4	4.8e-26
WP_004531069.1|394267_394507_+	hypothetical protein	NA	K4PAZ5	Burkholderia_phage	100.0	1.4e-35
WP_004524469.1|394675_394882_+	hypothetical protein	NA	K4NZT3	Burkholderia_phage	100.0	2.7e-35
WP_004531070.1|394884_395244_+	hypothetical protein	NA	K4NXB4	Burkholderia_phage	100.0	1.1e-60
WP_004524471.1|395240_395495_+	hypothetical protein	NA	K4NZY7	Burkholderia_phage	100.0	4.5e-40
WP_014696807.1|395506_398299_+	hypothetical protein	NA	K4NXL6	Burkholderia_phage	100.0	0.0e+00
WP_076836148.1|398999_399341_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004189647.1|400368_401052_-	response regulator	NA	NA	NA	NA	NA
WP_004523096.1|401052_403461_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004553747.1|403462_404053_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004523097.1|404049_405459_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|405900_406758_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004525854.1|406867_407503_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004553746.1|407623_408607_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
>prophage 3
NZ_CP004379	Burkholderia pseudomallei 1026b chromosome 1, complete sequence	4092218	632237	677230	4092218	transposase,tail,portal,holin,integrase,head,capsid,plate,lysis,terminase	Burkholderia_phage(58.49%)	59	625917:625934	680009:680026
625917:625934	attL	CGCGGCGAGCGCGTCGAG	NA	NA	NA	NA
WP_038742464.1|632237_633347_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	79.6	1.5e-167
WP_004556612.1|633214_633550_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014696839.1|634236_637029_-	hypothetical protein	NA	K4NXL6	Burkholderia_phage	99.6	0.0e+00
WP_004524471.1|637040_637295_-	hypothetical protein	NA	K4NZY7	Burkholderia_phage	100.0	4.5e-40
WP_004531070.1|637291_637651_-	hypothetical protein	NA	K4NXB4	Burkholderia_phage	100.0	1.1e-60
WP_004524469.1|637653_637860_-	hypothetical protein	NA	K4NZT3	Burkholderia_phage	100.0	2.7e-35
WP_004531069.1|638028_638268_-	hypothetical protein	NA	K4PAZ5	Burkholderia_phage	100.0	1.4e-35
WP_004524467.1|638271_638466_-	hypothetical protein	NA	K4NXL1	Burkholderia_phage	100.0	1.6e-26
WP_004524466.1|638509_638707_-	hypothetical protein	NA	K4NZY3	Burkholderia_phage	100.0	1.6e-29
WP_004551086.1|638712_638931_-	hypothetical protein	NA	A4JWR5	Burkholderia_virus	100.0	8.3e-35
WP_004551085.1|639015_639264_-	ogr/Delta-like zinc finger family protein	NA	A4JWR6	Burkholderia_virus	100.0	6.8e-41
WP_004534427.1|639251_639548_-	hypothetical protein	NA	E5E3P2	Burkholderia_phage	86.5	8.4e-38
WP_004534406.1|639551_639788_-	hypothetical protein	NA	A4JWR7	Burkholderia_virus	100.0	3.1e-35
WP_004534376.1|639870_640302_+	helix-turn-helix domain-containing protein	NA	A4JWR8	Burkholderia_virus	100.0	9.9e-72
WP_004551084.1|640351_641095_+	hypothetical protein	NA	A4JWR9	Burkholderia_virus	100.0	1.8e-100
WP_004551083.1|641134_642034_+	hypothetical protein	NA	A4JWS0	Burkholderia_virus	99.3	2.1e-164
WP_004553037.1|642041_643139_-	phage late control D family protein	NA	A4JWX2	Burkholderia_virus	99.5	8.9e-202
WP_009914999.1|643138_643564_-|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	100.0	3.3e-72
WP_009971807.1|643581_646542_-	membrane protein	NA	A4JWS3	Burkholderia_virus	99.4	0.0e+00
WP_004552648.1|646544_646658_-|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	100.0	5.4e-14
WP_004531064.1|646666_647011_-|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	100.0	1.0e-55
WP_014696837.1|647069_647579_-|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	98.8	3.2e-93
WP_014696836.1|647594_648767_-|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	99.5	3.7e-222
WP_004552361.1|648822_649494_-|tail	tail assembly chaperone	tail	A4JWS8	Burkholderia_virus	98.7	8.6e-115
WP_038803061.1|649510_651874_-	phage Tail collar domain protein	NA	K4NZW8	Burkholderia_phage	100.0	0.0e+00
WP_004531060.1|651884_652439_-|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	100.0	2.2e-100
WP_014696810.1|652431_653337_-|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	99.7	8.8e-163
WP_004531058.1|653333_653696_-|plate	bacteriophage baseplate assembly protein W	plate	K4PAX6	Burkholderia_phage	100.0	1.7e-61
WP_004531057.1|653692_654373_-|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	100.0	3.0e-123
WP_038742039.1|654544_655303_+	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	95.1	1.5e-136
WP_004553024.1|655702_656170_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	92.3	2.8e-72
WP_004553023.1|656166_656583_-|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	94.9	1.3e-68
WP_045586530.1|656687_657128_-|lysis	LysB family phage lysis regulatory protein	lysis	K4NXJ2	Burkholderia_phage	93.2	1.1e-65
WP_004553022.1|657124_657937_-	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	98.9	6.5e-149
WP_004524440.1|657933_658206_-|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	100.0	8.8e-42
WP_004553021.1|658207_658552_-	membrane protein	NA	K4NZQ3	Burkholderia_phage	99.1	6.5e-50
WP_004553020.1|658566_658773_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	95.6	1.7e-29
WP_004551072.1|658769_659021_-	hypothetical protein	NA	K4NXI9	Burkholderia_phage	95.2	9.2e-38
WP_004553019.1|659020_659500_-|head	head completion/stabilization protein	head	K4NZV5	Burkholderia_phage	96.2	9.3e-79
WP_014696834.1|659599_660289_-|terminase	terminase endonuclease subunit	terminase	K4NX86	Burkholderia_phage	96.9	2.6e-114
WP_014696833.1|660285_661299_-|capsid	phage major capsid protein, P2 family	capsid	K4NZP8	Burkholderia_phage	97.0	6.3e-186
WP_004553016.1|661332_662142_-|capsid	GPO family capsid scaffolding protein	capsid	K4PAW2	Burkholderia_phage	90.7	5.3e-135
WP_014696832.1|662285_664055_+|terminase	terminase ATPase subunit family protein	terminase	K4NXI4	Burkholderia_phage	98.8	0.0e+00
WP_004553015.1|664051_665107_+|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	98.9	4.9e-205
WP_158331355.1|665581_666142_+	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
WP_038742020.1|666511_667210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038742018.1|667212_668097_-	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	43.5	1.1e-35
WP_014696831.1|668336_668807_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085952178.1|668854_669966_-|transposase	IS3-like element ISBp1 family transposase	transposase	NA	NA	NA	NA
WP_076804979.1|670142_670322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004553012.1|670493_671081_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	50.0	9.1e-44
WP_009932253.1|671132_671453_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	58.6	1.0e-12
WP_009922658.1|671460_671778_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	57.0	6.2e-15
WP_004530410.1|671777_672695_+	DUF4935 domain-containing protein	NA	A4PE40	Ralstonia_virus	40.6	4.0e-46
WP_009932250.1|672948_673491_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	55.8	8.1e-47
WP_009932249.1|673748_674201_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	58.8	2.3e-31
WP_004530408.1|674200_675280_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	99.0	2.2e-160
WP_004525721.1|675436_675685_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.6	4.0e-41
WP_004195754.1|676585_677230_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	30.4	5.7e-07
680009:680026	attR	CTCGACGCGCTCGCCGCG	NA	NA	NA	NA
>prophage 4
NZ_CP004379	Burkholderia pseudomallei 1026b chromosome 1, complete sequence	4092218	899908	908347	4092218	protease,portal	Burkholderia_phage(50.0%)	10	NA	NA
WP_004554066.1|899908_900430_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_004554067.1|901143_902199_+|portal	phage portal protein	portal	A4JWV0	Burkholderia_virus	99.4	7.5e-206
WP_004524431.1|902305_902578_+	BrnT family toxin	NA	K4NX81	Burkholderia_phage	100.0	1.0e-45
WP_004524430.1|902537_902810_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	100.0	6.3e-48
WP_004554069.1|903421_903778_-	hypothetical protein	NA	A0A089GLD7	Burkholderia_phage	100.0	1.3e-37
WP_004531044.1|904060_904762_-	hypothetical protein	NA	A0A089FKS8	Burkholderia_phage	100.0	1.0e-134
WP_004554070.1|905007_905481_-	DUF4065 domain-containing protein	NA	K4NZT7	Burkholderia_phage	100.0	2.8e-88
WP_004190026.1|906414_907149_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_004189241.1|907242_907875_+	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004189793.1|907894_908347_+	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
>prophage 5
NZ_CP004379	Burkholderia pseudomallei 1026b chromosome 1, complete sequence	4092218	1685507	1696459	4092218	protease	Streptococcus_phage(16.67%)	10	NA	NA
WP_004197486.1|1685507_1687622_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_004185496.1|1687922_1688432_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_071810810.1|1688623_1688842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189780.1|1689104_1689683_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004189552.1|1689950_1691210_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_009929279.1|1691182_1691365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552979.1|1691377_1692982_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004196460.1|1693111_1693315_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|1693847_1694162_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196461.1|1694158_1696459_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
>prophage 6
NZ_CP004379	Burkholderia pseudomallei 1026b chromosome 1, complete sequence	4092218	2237230	2302631	4092218	tail,portal,protease,holin,integrase,head,capsid,terminase	Burkholderia_virus(95.95%)	83	2281700:2281721	2313256:2313277
WP_004526624.1|2237230_2238331_-|integrase	tyrosine-type recombinase/integrase	integrase	Q6JIJ8	Burkholderia_virus	100.0	5.4e-215
WP_004526625.1|2238330_2238555_-	DUF4224 domain-containing protein	NA	Q6JIJ7	Burkholderia_virus	100.0	2.9e-35
WP_004526626.1|2238600_2238825_+	hypothetical protein	NA	Q6JIJ6	Burkholderia_virus	100.0	1.8e-37
WP_004552963.1|2238906_2239116_+	hypothetical protein	NA	Q6JIJ5	Burkholderia_virus	100.0	1.8e-34
WP_004526628.1|2239124_2239370_+	hypothetical protein	NA	Q6JIJ4	Burkholderia_virus	100.0	1.5e-37
WP_004552962.1|2239442_2240453_-	phage Gp37/Gp68 family protein	NA	Q6JIJ3	Burkholderia_virus	99.7	7.7e-200
WP_004526630.1|2240410_2240749_-	hypothetical protein	NA	Q6JIJ2	Burkholderia_virus	100.0	3.1e-60
WP_015973597.1|2240738_2240981_-	hypothetical protein	NA	Q6JIJ1	Burkholderia_virus	100.0	1.9e-40
WP_004526632.1|2240973_2241231_-	hypothetical protein	NA	Q6JIJ0	Burkholderia_virus	100.0	1.7e-42
WP_004526633.1|2241227_2243156_-	hypothetical protein	NA	Q6JII8	Burkholderia_virus	98.8	9.4e-263
WP_004526634.1|2243170_2243449_-	hypothetical protein	NA	Q6JII7	Burkholderia_virus	100.0	3.0e-45
WP_004526635.1|2243448_2243844_-	hypothetical protein	NA	Q6JII6	Burkholderia_virus	100.0	9.4e-69
WP_004526636.1|2243846_2244512_-	hypothetical protein	NA	Q6JII5	Burkholderia_virus	100.0	2.0e-124
WP_004526637.1|2244525_2245233_-	hypothetical protein	NA	Q6JII4	Burkholderia_virus	100.0	7.7e-130
WP_004548444.1|2245506_2246319_-	prohibitin family protein	NA	Q6JII3	Burkholderia_virus	100.0	1.1e-145
WP_004537646.1|2246315_2246465_-	bacteriophage protein Gp44	NA	Q8W6Q6	Burkholderia_virus	100.0	3.3e-19
WP_004552960.1|2246715_2247306_+	hypothetical protein	NA	Q6JII1	Burkholderia_virus	100.0	6.4e-106
WP_004549687.1|2247480_2247699_-	hypothetical protein	NA	Q6JIH9	Burkholderia_virus	100.0	5.7e-36
WP_009946438.1|2247746_2248094_-	hypothetical protein	NA	Q6JIH8	Burkholderia_virus	100.0	3.8e-58
WP_004526640.1|2248578_2248854_-	hypothetical protein	NA	Q6JIH4	Burkholderia_virus	100.0	7.2e-44
WP_004552956.1|2249355_2250249_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	99.7	4.3e-170
WP_004552955.1|2250403_2251693_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	100.0	1.5e-235
WP_015973603.1|2252036_2252438_-	hypothetical protein	NA	Q6JIH0	Burkholderia_virus	100.0	1.7e-65
WP_004552953.1|2252501_2252816_+	transcriptional regulator	NA	Q6JIG9	Burkholderia_virus	100.0	3.0e-54
WP_015973604.1|2252932_2253265_+	hypothetical protein	NA	Q6JIG8	Burkholderia_virus	100.0	1.4e-57
WP_004552951.1|2253261_2253480_-	hypothetical protein	NA	Q6JIG7	Burkholderia_virus	100.0	1.1e-31
WP_009896483.1|2253694_2254135_+	hypothetical protein	NA	Q6JIG6	Burkholderia_virus	100.0	2.9e-79
WP_004552950.1|2254363_2255884_+	DNA cytosine methyltransferase	NA	Q6JIG4	Burkholderia_virus	99.8	2.0e-252
WP_004552949.1|2255885_2256707_+	hypothetical protein	NA	Q6JIG3	Burkholderia_virus	100.0	2.8e-147
WP_004526650.1|2256703_2256964_+	helix-turn-helix domain-containing protein	NA	Q6JIG2	Burkholderia_virus	100.0	4.2e-41
WP_015973608.1|2257117_2258110_+	hypothetical protein	NA	Q6JIG0	Burkholderia_virus	100.0	5.3e-177
WP_004552947.1|2258106_2258658_+	DUF1064 domain-containing protein	NA	Q6JIF9	Burkholderia_virus	100.0	1.9e-96
WP_004549836.1|2258654_2259029_+	hypothetical protein	NA	Q6JIF8	Burkholderia_virus	100.0	8.6e-64
WP_004526654.1|2259025_2259451_+	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	100.0	1.5e-80
WP_009910613.1|2259761_2260022_+	hypothetical protein	NA	Q6JIF5	Burkholderia_virus	100.0	6.2e-45
WP_004552943.1|2260030_2260678_+	hypothetical protein	NA	Q6JIF4	Burkholderia_virus	100.0	7.5e-116
WP_015973610.1|2260751_2262146_+	ATP-binding protein	NA	Q6JIF3	Burkholderia_virus	100.0	1.2e-267
WP_004552941.1|2262486_2262873_-	helix-turn-helix transcriptional regulator	NA	Q8W6N2	Burkholderia_virus	100.0	1.6e-65
WP_004549735.1|2262869_2263127_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q8W6N1	Burkholderia_virus	100.0	2.4e-41
WP_004552939.1|2263185_2263542_+	HNH endonuclease	NA	Q6JIE9	Burkholderia_virus	100.0	3.3e-65
WP_015973592.1|2263689_2264175_+|terminase	phage terminase small subunit P27 family	terminase	Q6JIN1	Burkholderia_virus	100.0	5.9e-89
WP_004526664.1|2264184_2265900_+|terminase	terminase large subunit	terminase	Q6JIN0	Burkholderia_virus	100.0	0.0e+00
WP_004552937.1|2265896_2267210_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	100.0	1.2e-248
WP_004526666.1|2267190_2267877_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	100.0	7.7e-127
WP_004526667.1|2267879_2269136_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	100.0	4.9e-228
WP_004526668.1|2269427_2269790_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	100.0	4.4e-57
WP_015973594.1|2269791_2270121_+|head	phage head closure protein	head	Q6JIM4	Burkholderia_virus	100.0	1.2e-56
WP_004526670.1|2270113_2270536_+	HK97 gp10 family phage protein	NA	Q6JIM3	Burkholderia_virus	100.0	1.5e-69
WP_004526671.1|2270532_2270880_+	DUF3168 domain-containing protein	NA	Q6JIM2	Burkholderia_virus	100.0	4.5e-59
WP_004526672.1|2270941_2271400_+	hypothetical protein	NA	Q6JIM1	Burkholderia_virus	100.0	4.9e-61
WP_004526673.1|2271427_2271892_+|tail	tail assembly protein	tail	Q6JIM0	Burkholderia_virus	100.0	9.3e-84
WP_004526674.1|2271891_2272176_+	DUF4035 domain-containing protein	NA	Q6JIL9	Burkholderia_virus	100.0	6.8e-45
WP_004552935.1|2272189_2276254_+|tail	phage tail tape measure protein	tail	Q6JIL8	Burkholderia_virus	100.0	0.0e+00
WP_004548805.1|2276250_2276589_+|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	100.0	8.0e-61
WP_004552934.1|2276597_2277986_+|tail	tail fiber domain-containing protein	tail	Q6JIL6	Burkholderia_virus	100.0	5.0e-274
WP_004526678.1|2277982_2278666_+|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	100.0	1.3e-134
WP_004526679.1|2278715_2279468_+	C40 family peptidase	NA	Q6JIL4	Burkholderia_virus	100.0	7.1e-150
WP_004526680.1|2279464_2280049_+|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	99.5	6.8e-100
WP_004552932.1|2280045_2283351_+|tail	phage tail protein	tail	Q6JIL2	Burkholderia_virus	100.0	0.0e+00
2281700:2281721	attL	CGCTCGCCGAGCGCTTCGACGC	NA	NA	NA	NA
WP_004552931.1|2283395_2283662_+	hypothetical protein	NA	Q8W6S9	Burkholderia_virus	100.0	2.5e-49
WP_004552930.1|2283661_2284396_+	hypothetical protein	NA	Q8W6S8	Burkholderia_virus	100.0	1.2e-146
WP_004552929.1|2284438_2284651_+|holin	class II holin gp23	holin	Q8W6S7	Burkholderia_virus	100.0	6.6e-29
WP_004552928.1|2284643_2285135_+	lysozyme	NA	Q6JIK8	Burkholderia_virus	100.0	7.8e-89
WP_004552927.1|2285134_2285680_+	lysozyme	NA	Q8W6S5	Burkholderia_virus	100.0	4.3e-88
WP_004526686.1|2285822_2286611_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	100.0	6.9e-156
WP_004526687.1|2286863_2287598_+	hypothetical protein	NA	Q8W6S3	Burkholderia_virus	100.0	1.6e-130
WP_004552925.1|2287779_2288340_+	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	100.0	7.5e-104
WP_004552924.1|2288336_2289071_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	100.0	3.6e-138
WP_004526688.1|2289098_2290190_+	DUF3396 domain-containing protein	NA	Q8W6S0	Burkholderia_virus	100.0	1.5e-212
WP_011325405.1|2290322_2290964_-	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	100.0	1.2e-118
WP_015967370.1|2291049_2291721_+	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	100.0	6.8e-136
WP_004536460.1|2292159_2292618_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_004266561.1|2292769_2293588_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004191764.1|2294259_2294451_+	lipoprotein	NA	NA	NA	NA	NA
WP_004531119.1|2294704_2296096_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_004531120.1|2296103_2296421_-	DUF2288 domain-containing protein	NA	NA	NA	NA	NA
WP_004193897.1|2296685_2298311_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	35.4	2.3e-68
WP_004192280.1|2298290_2298404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004531123.1|2298415_2298589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192768.1|2298666_2299368_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	44.8	9.9e-13
WP_004526695.1|2299664_2300573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004521810.1|2301120_2301951_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_038741908.1|2302244_2302631_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4R586	Salmonella_phage	52.2	3.9e-19
2313256:2313277	attR	GCGTCGAAGCGCTCGGCGAGCG	NA	NA	NA	NA
>prophage 7
NZ_CP004379	Burkholderia pseudomallei 1026b chromosome 1, complete sequence	4092218	2353222	2400965	4092218	transposase,plate,coat	uncultured_Caudovirales_phage(33.33%)	38	NA	NA
WP_004534956.1|2353222_2355073_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004536269.1|2355100_2356516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004550614.1|2356539_2356806_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_076830677.1|2357065_2357293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552908.1|2357326_2360125_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.1	5.2e-28
WP_004535790.1|2360127_2360961_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_038741925.1|2361097_2361655_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_004531151.1|2361651_2362245_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_004546127.1|2362241_2364650_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_004556888.1|2364758_2368094_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004556889.1|2369652_2369895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004552903.1|2369912_2370218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004552902.1|2370230_2373071_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.9	1.4e-20
WP_004526759.1|2373072_2373948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004531157.1|2373944_2376788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004531158.1|2376905_2377826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004526762.1|2377956_2378208_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_122657026.1|2378165_2379074_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_004552900.1|2379703_2379997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080014833.1|2380939_2381632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009951519.1|2382204_2382372_-	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	50.0	9.5e-07
WP_004538387.1|2383129_2383576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153260188.1|2384719_2385145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038741900.1|2385803_2386724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004552896.1|2386983_2388297_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_038728684.1|2389189_2389459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193855.1|2389721_2390003_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004552893.1|2390470_2391454_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004538381.1|2391498_2392785_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196705.1|2393201_2394095_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004531175.1|2394432_2394654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004526780.1|2394739_2394925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004526781.1|2394911_2395457_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526782.1|2395509_2396070_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526783.1|2396146_2396671_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526784.1|2396688_2397528_+	molecular chaperone	NA	NA	NA	NA	NA
WP_004534736.1|2397572_2399984_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004521738.1|2399999_2400965_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 8
NZ_CP004379	Burkholderia pseudomallei 1026b chromosome 1, complete sequence	4092218	3202765	3208455	4092218	transposase	Ralstonia_virus(50.0%)	9	NA	NA
WP_004527234.1|3202765_3202999_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.6	4.3e-13
WP_004531416.1|3203034_3203262_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	75.8	3.8e-22
WP_009937072.1|3203515_3203911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144434369.1|3204121_3205231_+|transposase	IS3-like element ISBp1 family transposase	transposase	NA	NA	NA	NA
WP_004527236.1|3205402_3205828_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	3.8e-15
WP_004527237.1|3205824_3206331_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.1	5.1e-19
WP_038763587.1|3206672_3207275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009920998.1|3207281_3208007_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	44.0	5.8e-32
WP_076811937.1|3208191_3208455_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.5	5.0e-26
>prophage 9
NZ_CP004379	Burkholderia pseudomallei 1026b chromosome 1, complete sequence	4092218	3406936	3475449	4092218	tail,portal,tRNA,protease,integrase,head,capsid,plate,terminase	uncultured_Caudovirales_phage(26.32%)	83	3448328:3448345	3464495:3464512
WP_004527342.1|3406936_3408415_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_004193249.1|3408458_3409430_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_004205123.1|3409533_3410472_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004192752.1|3410519_3411917_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.8	1.8e-42
WP_004195907.1|3412148_3412871_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004191635.1|3412927_3413503_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	39.3	5.3e-12
WP_004193779.1|3413583_3414075_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	33.3	4.2e-10
WP_004550230.1|3414099_3414900_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004552789.1|3415235_3416021_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004552788.1|3416211_3417123_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_004532151.1|3417128_3417380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191664.1|3417423_3418227_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_004527347.1|3418506_3418779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191077.1|3418962_3419142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192883.1|3419686_3419914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552787.1|3420677_3421079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552786.1|3421954_3422278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552785.1|3422299_3422767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552784.1|3423414_3424029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009929444.1|3424329_3425010_-	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	79.5	9.1e-104
WP_009929443.1|3425091_3425556_+	hypothetical protein	NA	C7BGE3	Burkholderia_phage	60.4	7.4e-49
WP_004552781.1|3425555_3425837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004552780.1|3425898_3426324_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	48.3	4.9e-15
WP_004552779.1|3426320_3426827_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	8.7e-19
WP_004552778.1|3426819_3427293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004552777.1|3427249_3427768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004552776.1|3427764_3428508_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	42.9	8.0e-37
WP_004552775.1|3428543_3429332_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	96.2	4.4e-150
WP_004552774.1|3429474_3429999_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	93.4	6.0e-79
WP_004552773.1|3429998_3430496_-	lysozyme	NA	A4JX20	Burkholderia_virus	78.8	2.9e-67
WP_004533694.1|3430488_3430683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552772.1|3430758_3431811_-	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.2	2.7e-78
WP_004540041.1|3431820_3432027_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	4.0e-15
WP_004552771.1|3432001_3432883_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.0	8.6e-30
WP_004552770.1|3432891_3435306_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	34.2	9.5e-71
WP_004552769.1|3435393_3435696_-|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.5e-05
WP_004552768.1|3435765_3436269_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.6	4.3e-42
WP_004552767.1|3436279_3437449_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.7	3.4e-159
WP_004552766.1|3437514_3437967_-|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	75.0	2.7e-43
WP_004552413.1|3437982_3439446_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	78.2	1.6e-214
WP_004539949.1|3439433_3440009_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.7	6.0e-32
WP_004533630.1|3440001_3440895_-|plate	baseplate J protein	plate	D5LGZ3	Escherichia_phage	40.7	1.9e-48
WP_004552765.1|3440891_3441236_-	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004552764.1|3441232_3441439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552763.1|3441503_3442184_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	35.1	2.4e-19
WP_009935706.1|3442186_3442720_-	hypothetical protein	NA	Q9JML9	Wolbachia_phage	39.5	3.6e-23
WP_004539763.1|3442709_3443240_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.0	9.2e-11
WP_004552761.1|3443241_3443532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004550216.1|3443535_3444561_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	1.7e-109
WP_004552760.1|3444595_3444940_-|head	head decoration protein	head	NA	NA	NA	NA
WP_004552759.1|3444966_3446067_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	36.1	1.1e-47
WP_004552758.1|3446063_3447557_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.2	7.5e-135
WP_004552757.1|3447553_3447760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552756.1|3447770_3449756_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.4	2.1e-180
3448328:3448345	attL	CGACCGACGCGCGCGGCG	NA	NA	NA	NA
WP_004552755.1|3449718_3450288_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009935698.1|3450652_3451027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533678.1|3451374_3451962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552754.1|3452179_3454672_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	4.7e-97
WP_004552753.1|3454791_3455262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552751.1|3455568_3455922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038741767.1|3455935_3456463_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	7.4e-29
WP_045586622.1|3456551_3456821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909040.1|3456929_3457415_+	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	41.2	4.4e-12
WP_128972304.1|3457362_3457818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004550209.1|3457946_3458165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004552748.1|3458216_3458552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004534172.1|3458548_3459154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004552747.1|3459150_3459600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004540046.1|3459599_3460916_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004552746.1|3461029_3461359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004552745.1|3461367_3461841_+	hypothetical protein	NA	B5TA88	Burkholderia_phage	71.4	3.0e-05
WP_009890227.1|3461849_3462092_+	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	59.2	9.3e-19
WP_004552744.1|3462042_3463344_-|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	58.9	1.4e-148
WP_038716247.1|3463503_3466185_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.3	9.3e-27
3464495:3464512	attR	CGCCGCGCGCGTCGGTCG	NA	NA	NA	NA
WP_038741765.1|3466171_3467470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524740.1|3467449_3467995_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_028359068.1|3468063_3469251_+	cupin	NA	NA	NA	NA	NA
WP_004193059.1|3469977_3470754_-	MBL fold metallo-hydrolase	NA	U5PVD0	Bacillus_phage	26.6	3.3e-09
WP_004524737.1|3470758_3471901_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_004191516.1|3472011_3472914_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_045586624.1|3472958_3473576_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191887.1|3473572_3474775_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004192745.1|3474783_3475449_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 10
NZ_CP004379	Burkholderia pseudomallei 1026b chromosome 1, complete sequence	4092218	3761960	3770803	4092218		Tanapox_virus(16.67%)	8	NA	NA
WP_009955224.1|3761960_3762803_+	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.0	1.6e-17
WP_004522362.1|3763145_3764069_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	2.4e-43
WP_004552706.1|3764247_3765543_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004550116.1|3765769_3766672_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	3.3e-53
WP_004189725.1|3767007_3767325_-	competence protein ComE	NA	NA	NA	NA	NA
WP_004552705.1|3767396_3768389_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.6	2.6e-27
WP_009921652.1|3768447_3769371_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.1	1.3e-15
WP_004537711.1|3769402_3770803_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	4.2e-79
>prophage 1
NZ_CP004380	Burkholderia pseudomallei 1026b chromosome 2, complete sequence	3145454	119423	149074	3145454	transposase,plate	Acanthocystis_turfacea_Chlorella_virus(20.0%)	20	NA	NA
WP_004190585.1|119423_120827_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190689.1|120842_122159_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004524806.1|122161_125791_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_122985123.1|125772_126729_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004529325.1|126713_126941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552196.1|126939_129549_+	serine/threonine protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	26.6	5.0e-09
WP_004190988.1|129601_130681_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004524810.1|130743_131322_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190849.1|131314_132823_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004190698.1|132882_133374_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_009935240.1|133392_133941_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004553897.1|133945_135817_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_100227576.1|135813_137259_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004533146.1|137271_139938_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	5.2e-78
WP_004203275.1|139934_142139_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004539259.1|142154_142865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157726745.1|144574_144808_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	58.6	3.9e-14
WP_076823047.1|145815_146106_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004546292.1|146116_147268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085965013.1|147894_149074_+|transposase	IS3-like element ISBps1 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	2.2e-60
>prophage 2
NZ_CP004380	Burkholderia pseudomallei 1026b chromosome 2, complete sequence	3145454	902916	931550	3145454	transposase,plate	Acinetobacter_phage(33.33%)	21	NA	NA
WP_080015562.1|902916_903501_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004557777.1|903818_904106_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004553525.1|904190_904634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004533180.1|904665_906195_+	type III secretion system effector BopC	NA	NA	NA	NA	NA
WP_004528803.1|907255_907888_-	GTP cyclohydrolase I	NA	A0A0P0HSD2	Acinetobacter_phage	30.6	9.9e-20
WP_004551882.1|907892_908186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004528802.1|908144_908390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004553524.1|908349_909573_-	peptidase	NA	NA	NA	NA	NA
WP_045586959.1|910281_914349_-	type VI secretion system protein ImpL	NA	NA	NA	NA	NA
WP_004184888.1|914360_915026_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004536933.1|915022_916420_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004533362.1|916452_917250_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004553521.1|917259_917652_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004551877.1|917680_918433_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004528797.1|918429_919494_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004553520.1|919511_922154_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004553519.1|922179_925203_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.2e-22
WP_014696879.1|925229_928313_-	AAA domain-containing protein	NA	A0A223W0B1	Agrobacterium_phage	29.8	7.1e-79
WP_004525341.1|928299_929322_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004553517.1|929309_931052_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004530572.1|931088_931550_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP004380	Burkholderia pseudomallei 1026b chromosome 2, complete sequence	3145454	2165989	2233775	3145454	holin,plate	Aeromonas_phage(25.0%)	51	NA	NA
WP_004535035.1|2165989_2166940_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_004523149.1|2167207_2168152_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004530060.1|2168623_2170327_+	thermolysin metallopeptidase	NA	NA	NA	NA	NA
WP_004530059.1|2170444_2171671_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_004200640.1|2171725_2172868_-	porin	NA	NA	NA	NA	NA
WP_004198249.1|2172976_2173099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004530058.1|2173095_2174133_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_004186939.1|2174129_2175683_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_004551409.1|2175845_2176718_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186920.1|2176861_2177737_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_004530057.1|2177823_2179479_-	APC family permease	NA	NA	NA	NA	NA
WP_004186918.1|2179659_2180523_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004530056.1|2180632_2181778_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004535147.1|2181798_2183040_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004530055.1|2183091_2183877_-	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004523138.1|2183873_2185046_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004186901.1|2185050_2186976_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004186960.1|2186978_2189042_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186987.1|2189102_2189636_-	4-vinyl reductase	NA	NA	NA	NA	NA
WP_004535113.1|2189786_2190758_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004523136.1|2190830_2192105_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	5.3e-105
WP_009933096.1|2192116_2192368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198247.1|2192537_2193563_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004523135.1|2193740_2194940_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_009971500.1|2195387_2196404_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_023358579.1|2196592_2198158_+	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_009971496.1|2198290_2199958_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.4	3.5e-56
WP_004547675.1|2200481_2201735_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004528656.1|2202461_2204045_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_038724161.1|2204041_2204224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524284.1|2204349_2205345_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004528658.1|2205633_2207220_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_024428512.1|2207216_2208536_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004547901.1|2208425_2208728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004528661.1|2208769_2209669_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004536812.1|2210219_2210495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190471.1|2210815_2211241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190863.1|2211263_2211623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190265.1|2211681_2215185_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004525553.1|2215181_2216840_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004525552.1|2216922_2218284_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004202226.1|2218280_2218874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190606.1|2218879_2219269_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004530790.1|2219311_2220028_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004525550.1|2220030_2221101_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004547074.1|2221100_2223317_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004190563.1|2223320_2225609_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_014696850.1|2225774_2228063_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004525547.1|2228053_2230924_-	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	2.4e-60
WP_004190851.1|2230926_2231916_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004196180.1|2231912_2233775_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 4
NZ_CP004380	Burkholderia pseudomallei 1026b chromosome 2, complete sequence	3145454	2390362	2418348	3145454	integrase,transposase	Leptospira_phage(33.33%)	23	2367114:2367129	2424610:2424625
2367114:2367129	attL	GGTAACGGGCGGCGAC	NA	NA	NA	NA
WP_122802116.1|2390362_2391052_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_004553178.1|2391495_2392428_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_004530738.1|2392584_2393847_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_004538070.1|2394005_2395466_-	ser/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_004525420.1|2398734_2399019_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	50.0	1.4e-10
WP_009923450.1|2399002_2399272_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_038802333.1|2400020_2401141_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004553173.1|2401653_2403357_-|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	33.5	2.0e-19
WP_038742112.1|2403659_2404847_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	57.3	2.1e-124
WP_080014899.1|2405189_2405507_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004553171.1|2405507_2406617_+	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_038802950.1|2406661_2407782_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004553168.1|2407862_2408669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004553167.1|2408764_2409340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004553166.1|2409574_2409826_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004553165.1|2409876_2410383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004553164.1|2410526_2410820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129195150.1|2411548_2411758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080014896.1|2412297_2413446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076888374.1|2413395_2414334_-	site-specific DNA-methyltransferase	NA	A0A1D8KJ61	Synechococcus_phage	48.9	2.4e-14
WP_004553163.1|2414330_2416514_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_076888373.1|2416458_2416665_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_085952178.1|2417236_2418348_-|transposase	IS3-like element ISBp1 family transposase	transposase	NA	NA	NA	NA
2424610:2424625	attR	GGTAACGGGCGGCGAC	NA	NA	NA	NA
