The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009323	Burkholderia gladioli strain ATCC 10248 chromosome 1, complete sequence	4668573	185719	243989	4668573	tail,capsid,portal,transposase,terminase,tRNA,protease,head,plate,integrase	uncultured_Caudovirales_phage(37.04%)	63	187855:187878	232099:232122
WP_088555423.1|185719_186536_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	3.9e-08
WP_080742219.1|186702_187251_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080959724.1|187353_187680_-	hypothetical protein	NA	NA	NA	NA	NA
187855:187878	attL	CCACACGCCCATGATGCAGCAGTA	NA	NA	NA	NA
WP_036050144.1|188137_189586_-	RES domain-containing protein	NA	NA	NA	NA	NA
WP_080742221.1|189669_190788_-	DUF3578 domain-containing protein	NA	NA	NA	NA	NA
WP_080742222.1|191387_192764_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_157693215.1|192772_193654_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_042286165.1|194302_195289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144417675.1|195297_195723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144417676.1|195773_196898_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_120513474.1|196897_197314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036050136.1|197959_198247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036050134.1|198285_199071_-	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	82.9	1.5e-129
WP_052409262.1|199231_199861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036050130.1|199857_200424_-	N-acetylmuramidase	NA	A0A0E3JI96	Rhodoferax_phage	53.7	1.8e-49
WP_017918170.1|200420_200870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036050129.1|200942_201992_-	phage late control D protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.8	7.2e-84
WP_013698666.1|202001_202208_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	55.2	8.4e-13
WP_036050127.1|202182_203061_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.5	5.2e-35
WP_036050125.1|203070_205500_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	35.9	1.6e-54
WP_036050123.1|205581_205884_-|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	39.0	1.3e-06
WP_013697850.1|205961_206465_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	51.2	5.6e-42
WP_036050120.1|206474_207644_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	73.4	4.8e-161
WP_036050119.1|207715_208435_-|tail	tail fiber assembly protein	tail	E5E3Q6	Burkholderia_phage	58.6	1.5e-59
WP_036050116.1|208448_210413_-|tail	tail fiber protein	tail	E5E3V2	Burkholderia_phage	59.3	4.0e-128
WP_036050113.1|210400_210979_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.4	6.4e-34
WP_036050112.1|210968_211865_-|plate	baseplate J/gp47 family protein	plate	A0A1J0I2M3	Salmonella_phage	38.4	8.7e-46
WP_036050111.1|211861_212194_-	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	49.1	3.6e-21
WP_036050109.1|212196_212388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144417677.1|212489_212930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036050108.1|212957_213638_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	28.5	1.9e-16
WP_036050107.1|213634_214165_-	hypothetical protein	NA	A0A1B2LRU9	Wolbachia_phage	43.4	8.5e-25
WP_036050106.1|214154_214685_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	30.5	4.0e-14
WP_025099034.1|214689_214980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036050105.1|214981_215977_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	63.3	1.3e-119
WP_013698682.1|216059_216404_-|head	head decoration protein	head	NA	NA	NA	NA
WP_036050104.1|216433_217525_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	37.2	1.2e-49
WP_036050102.1|217521_219012_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	52.0	2.1e-137
WP_036050101.1|219008_219215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080742226.1|219225_221229_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	52.4	2.8e-177
WP_080742227.1|221191_221761_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036050092.1|221873_222068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080742228.1|222287_223061_-	zinc finger-like domain-containing protein	NA	NA	NA	NA	NA
WP_036050090.1|223281_225789_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	40.6	1.7e-94
WP_036050087.1|226049_226433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036035932.1|226419_226962_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	47.6	5.8e-29
WP_155296535.1|227122_227848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025099044.1|228208_228427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036050083.1|228478_228841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042286168.1|228840_229878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036050080.1|229979_230372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013698698.1|230380_230617_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_036050065.1|230573_231875_-|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	57.2	5.7e-139
WP_080742231.1|232033_234742_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.9	5.7e-24
232099:232122	attR	CCACACGCCCATGATGCAGCAGTA	NA	NA	NA	NA
WP_052409263.1|234725_236018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013698701.1|236075_236624_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_172535111.1|236656_237883_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_036050063.1|238503_239280_-	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	33.8	5.4e-28
WP_036050060.1|239284_240430_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_025099054.1|240539_241442_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_036053110.1|241486_242011_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013698707.1|242117_243320_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_036050057.1|243329_243989_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 2
NZ_CP009323	Burkholderia gladioli strain ATCC 10248 chromosome 1, complete sequence	4668573	514926	523742	4668573		Leptospira_phage(16.67%)	14	NA	NA
WP_080742194.1|514926_516228_-	DNA-packaging protein	NA	S5VY04	Leptospira_phage	39.0	2.2e-29
WP_042286051.1|516305_516920_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	49.5	1.2e-43
WP_036049752.1|516971_517157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042286049.1|517153_517930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127841027.1|517997_518309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127841026.1|518305_518560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045577484.1|518600_520346_-	toprim domain-containing protein	NA	A0A0F7L6A5	uncultured_marine_virus	36.9	2.3e-98
WP_052409243.1|520342_521203_-	hypothetical protein	NA	V5URT9	Shigella_phage	34.0	1.6e-09
WP_036049744.1|521195_521432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080742188.1|521428_521707_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036049742.1|521808_522471_+	hypothetical protein	NA	A0A0U4JEE2	Pseudomonas_phage	35.2	4.6e-20
WP_036049740.1|522560_522749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127841025.1|522901_523255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036049735.1|523247_523742_+	helix-turn-helix transcriptional regulator	NA	E5AGE6	Erwinia_phage	45.1	8.3e-06
>prophage 3
NZ_CP009323	Burkholderia gladioli strain ATCC 10248 chromosome 1, complete sequence	4668573	764802	775700	4668573	tRNA,protease	Klosneuvirus(14.29%)	9	NA	NA
WP_036049482.1|764802_767640_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.9	6.5e-79
WP_013699140.1|767642_768143_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_036049481.1|768247_769459_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.9	8.2e-39
WP_013699142.1|769539_769986_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	61.6	8.7e-47
WP_025098176.1|770106_772404_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	1.1e-169
WP_036049478.1|772400_772715_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	7.6e-13
WP_004196460.1|773246_773450_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_036049476.1|773587_775180_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_013699147.1|775334_775700_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	29.8	3.6e-06
>prophage 4
NZ_CP009323	Burkholderia gladioli strain ATCC 10248 chromosome 1, complete sequence	4668573	1594549	1677188	4668573	holin,tail,tRNA,plate,integrase	Burkholderia_phage(60.0%)	72	1649833:1649852	1689659:1689678
WP_036048694.1|1594549_1596520_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_036048693.1|1596516_1597206_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_013696165.1|1597262_1598033_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	31.4	1.7e-21
WP_013696166.1|1598071_1598959_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	37.3	3.8e-17
WP_036048692.1|1598966_1600100_+	anion permease	NA	NA	NA	NA	NA
WP_013696168.1|1600364_1600895_+	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_025097717.1|1601056_1601908_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_013696170.1|1601984_1602254_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_013696171.1|1602380_1602851_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017917925.1|1602853_1603393_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_036048690.1|1603437_1604979_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_013696174.1|1605051_1605930_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_017917924.1|1606002_1607397_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_013696176.1|1607556_1607982_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_036052913.1|1608235_1609933_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	27.1	3.0e-39
WP_036048688.1|1610607_1611468_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080742130.1|1611618_1612746_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_036048685.1|1613274_1615527_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_036048683.1|1616018_1619942_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013696183.1|1620028_1621168_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_036048681.1|1621445_1622600_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_036035265.1|1622631_1623441_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025097728.1|1623498_1624110_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017919796.1|1624206_1624638_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036048679.1|1624726_1627411_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	4.6e-135
WP_036048677.1|1627445_1627634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036048676.1|1627725_1628205_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_025097733.1|1628435_1629845_+	ethanolamine permease	NA	NA	NA	NA	NA
WP_036048674.1|1629882_1631280_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_013696192.1|1631276_1632071_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_036035280.1|1632160_1633681_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_036048672.1|1634018_1635161_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036048671.1|1635222_1636308_-	ADP-heptose--LPS heptosyltransferase	NA	NA	NA	NA	NA
WP_013696196.1|1636353_1638075_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_013696197.1|1638280_1639669_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_013696198.1|1639698_1640844_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_036048669.1|1640987_1643918_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.4	2.0e-256
WP_036048666.1|1643981_1644365_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017920319.1|1644408_1645527_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_013696202.1|1646410_1646815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036048664.1|1647018_1648071_-	oxidoreductase	NA	NA	NA	NA	NA
WP_036035288.1|1648552_1650637_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.4	4.4e-101
1649833:1649852	attL	CACGCTGGAGGCGCTCGGCT	NA	NA	NA	NA
WP_036048662.1|1650734_1651673_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_036048660.1|1652960_1654115_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_042285421.1|1654485_1655592_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	78.2	1.5e-159
WP_036048658.1|1656402_1659195_-	toprim domain-containing protein	NA	E5E3N5	Burkholderia_phage	85.8	0.0e+00
WP_017920741.1|1659197_1659401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036048656.1|1659416_1660004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025097752.1|1660000_1660249_-	ogr/Delta-like zinc finger family protein	NA	A4JWR6	Burkholderia_virus	86.6	3.6e-34
WP_013696212.1|1660358_1660562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036048654.1|1660653_1661127_+	transcriptional regulator	NA	E5E3U2	Burkholderia_phage	56.4	1.1e-36
WP_036048653.1|1661323_1661611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036048652.1|1661806_1662904_-	phage late control D family protein	NA	A4JWS1	Burkholderia_virus	61.2	1.5e-119
WP_036048649.1|1662903_1663401_-|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	71.8	1.4e-45
WP_036048648.1|1663415_1666058_-	hypothetical protein	NA	E5E3P9	Burkholderia_phage	26.4	2.5e-32
WP_036048646.1|1666054_1666174_-|tail	GpE family phage tail protein	tail	E5E3U7	Burkholderia_phage	83.8	1.6e-11
WP_036048644.1|1666182_1666518_-|tail	phage tail assembly protein	tail	E5E3U8	Burkholderia_phage	81.4	6.3e-34
WP_013696219.1|1666587_1667097_-|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	69.8	2.3e-67
WP_025097759.1|1667124_1668297_-|tail	phage tail sheath protein	tail	E5E3V0	Burkholderia_phage	80.5	1.4e-181
WP_036048642.1|1668346_1669207_-|tail	tail fiber assembly protein	tail	A4JWS8	Burkholderia_virus	70.9	9.2e-77
WP_036048640.1|1669225_1671814_-	phage Tail collar domain protein	NA	E5E3V2	Burkholderia_phage	54.8	5.9e-228
WP_036035313.1|1671816_1672374_-|tail	phage tail protein I	tail	E5E3V3	Burkholderia_phage	80.0	2.4e-78
WP_036048639.1|1672351_1673257_-|plate	baseplate J/gp47 family protein	plate	E5E3V4	Burkholderia_phage	79.1	6.8e-131
WP_025097764.1|1673253_1673616_-	GPW/gp25 family protein	NA	E5E3V5	Burkholderia_phage	75.0	1.7e-45
WP_036052908.1|1673612_1674308_-|plate	phage baseplate assembly protein V	plate	E5E3V6	Burkholderia_phage	74.5	5.8e-90
WP_036048637.1|1674541_1674958_-|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	47.4	6.9e-30
WP_036048635.1|1674950_1675115_-	hypothetical protein	NA	K4PAX1	Burkholderia_phage	75.7	4.2e-07
WP_036048634.1|1675092_1675542_-	protein lysB	NA	E5E3W1	Burkholderia_phage	64.4	3.6e-40
WP_013696230.1|1675538_1676351_-	N-acetylmuramidase family protein	NA	A4JWU0	Burkholderia_virus	75.6	1.4e-111
WP_013696231.1|1676347_1676620_-|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	76.7	1.3e-29
WP_013696232.1|1676621_1676966_-	membrane protein	NA	K4NZQ3	Burkholderia_phage	80.5	6.1e-40
WP_013696233.1|1676981_1677188_-|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	70.6	2.1e-19
1689659:1689678	attR	CACGCTGGAGGCGCTCGGCT	NA	NA	NA	NA
>prophage 5
NZ_CP009323	Burkholderia gladioli strain ATCC 10248 chromosome 1, complete sequence	4668573	1887432	1938961	4668573	plate,transposase,protease	Pithovirus(25.0%)	53	NA	NA
WP_013696412.1|1887432_1888158_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036033506.1|1888438_1893139_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
WP_036033510.1|1893235_1894702_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_036048478.1|1894804_1896562_-	ABC transporter ATP-binding protein/permease	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	31.1	1.7e-05
WP_036048477.1|1897294_1898452_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013696417.1|1898479_1898677_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_013696418.1|1898718_1899534_+	thiazole synthase	NA	NA	NA	NA	NA
WP_042284870.1|1899530_1900652_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_013696420.1|1900974_1901796_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.2	2.6e-20
WP_013696421.1|1901792_1902560_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_013696422.1|1902575_1903082_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_036048476.1|1903137_1904058_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_013696424.1|1904167_1904794_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025101319.1|1904790_1905060_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_013696426.1|1905267_1906194_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	32.9	2.0e-24
WP_013696427.1|1906190_1906946_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013696428.1|1906966_1907206_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_036048475.1|1907222_1908578_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_017918341.1|1908574_1909231_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_013696431.1|1909271_1910600_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_036048474.1|1910758_1911829_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	23.0	1.7e-19
WP_017918339.1|1911911_1912499_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_013696434.1|1912574_1913195_+	NAAT family transporter	NA	NA	NA	NA	NA
WP_013696435.1|1913191_1913833_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_013696436.1|1913995_1914751_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_013696437.1|1914837_1915611_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_036048472.1|1915610_1916036_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_017918336.1|1916032_1916398_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_042284878.1|1916461_1916854_+	membrane protein	NA	NA	NA	NA	NA
WP_013696441.1|1916879_1917245_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_013696442.1|1917360_1917600_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_013696443.1|1917626_1918181_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_013696444.1|1918228_1919008_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.9	8.4e-29
WP_013696445.1|1919166_1920375_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.2	2.0e-08
WP_036048471.1|1920396_1921143_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_013696447.1|1921363_1921984_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_013696448.1|1921983_1923366_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_036052886.1|1923388_1924147_+	cytochrome c1	NA	NA	NA	NA	NA
WP_012734444.1|1924242_1924854_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013696450.1|1924921_1925422_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	45.8	3.5e-20
WP_036048470.1|1925606_1925891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036048469.1|1926769_1927213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036048468.1|1927599_1928784_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.4	1.2e-18
WP_013696459.1|1928880_1929666_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_036048467.1|1929662_1931009_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_036048466.1|1931109_1931727_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_042284862.1|1932100_1932772_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013696463.1|1932808_1933327_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_013696464.1|1933342_1934833_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_013696465.1|1934909_1935413_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_013696466.1|1935501_1935984_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_036048462.1|1936061_1937900_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_017918328.1|1937863_1938961_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
NZ_CP009323	Burkholderia gladioli strain ATCC 10248 chromosome 1, complete sequence	4668573	2235190	2244157	4668573		Chrysochromulina_ericina_virus(16.67%)	7	NA	NA
WP_036029636.1|2235190_2237137_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.8	3.2e-146
WP_036029634.1|2237352_2238489_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	1.0e-22
WP_063769134.1|2238511_2240356_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	36.5	1.2e-54
WP_013696727.1|2240453_2241269_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	30.9	6.3e-35
WP_013696728.1|2241315_2241999_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	29.3	6.7e-06
WP_036048161.1|2241995_2242526_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_036048159.1|2242555_2244157_-	polynucleotide adenylyltransferase PcnB	NA	A0A1B0V011	Roseobacter_phage	28.8	3.1e-17
>prophage 7
NZ_CP009323	Burkholderia gladioli strain ATCC 10248 chromosome 1, complete sequence	4668573	2460791	2470170	4668573	tRNA	Bacillus_virus(33.33%)	7	NA	NA
WP_013696917.1|2460791_2461910_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.5	2.0e-23
WP_036052466.1|2462026_2462818_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	30.5	2.3e-10
WP_036037547.1|2462956_2463919_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	44.2	1.9e-62
WP_013696920.1|2464213_2466526_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	50.8	3.4e-86
WP_013696921.1|2466570_2467254_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_013696922.1|2467470_2468781_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.2	1.2e-80
WP_036052464.1|2468868_2470170_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	2.8e-93
>prophage 8
NZ_CP009323	Burkholderia gladioli strain ATCC 10248 chromosome 1, complete sequence	4668573	2549981	2558303	4668573		Bacillus_phage(16.67%)	8	NA	NA
WP_036037641.1|2549981_2551382_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.3	1.4e-77
WP_013697004.1|2551350_2552328_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.2	3.3e-14
WP_013697005.1|2552384_2553377_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.7	8.2e-29
WP_036052397.1|2553452_2553788_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036053687.1|2554023_2554926_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.8e-51
WP_036052395.1|2555026_2556253_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_013697009.1|2556433_2557357_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.6	2.2e-44
WP_036053684.1|2557463_2558303_-	alpha/beta hydrolase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	26.7	1.4e-13
>prophage 9
NZ_CP009323	Burkholderia gladioli strain ATCC 10248 chromosome 1, complete sequence	4668573	3349425	3360315	4668573	terminase	EBPR_podovirus(22.22%)	12	NA	NA
WP_036051794.1|3349425_3349782_+	phage family protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	68.0	3.2e-36
WP_124083800.1|3349897_3350314_+	hypothetical protein	NA	C7BGG3	Burkholderia_phage	43.2	4.1e-14
WP_036051792.1|3350419_3351199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283651.1|3351206_3351977_+|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	61.2	2.1e-72
WP_052409082.1|3351973_3353236_+|terminase	PBSX family phage terminase large subunit	terminase	L7TKU1	Rhizobium_phage	45.2	8.9e-105
WP_080741957.1|3353216_3355355_+	hypothetical protein	NA	F8TUN9	EBPR_podovirus	33.7	1.0e-84
WP_036051790.1|3355356_3355662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036051789.1|3355765_3356515_+	hypothetical protein	NA	A0A2I7RQ07	Vibrio_phage	37.1	1.5e-06
WP_036051788.1|3356523_3357732_+	hypothetical protein	NA	A0A1B1IR95	uncultured_Mediterranean_phage	36.1	3.0e-57
WP_144417709.1|3357731_3358181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036051786.1|3358177_3358891_+	hypothetical protein	NA	F8TUN4	EBPR_podovirus	30.0	4.7e-18
WP_036051785.1|3358890_3360315_+	hypothetical protein	NA	A0A0E3JSB2	Rhodoferax_phage	41.6	1.3e-96
>prophage 10
NZ_CP009323	Burkholderia gladioli strain ATCC 10248 chromosome 1, complete sequence	4668573	3459534	3499313	4668573	tail,capsid,terminase,portal,head,integrase	Burkholderia_virus(32.14%)	60	3449351:3449366	3467937:3467952
3449351:3449366	attL	TTCGAGGGCGCGGGCG	NA	NA	NA	NA
WP_045577496.1|3459534_3460503_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.6	7.2e-30
WP_013697841.1|3460545_3460761_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_013697842.1|3460915_3461113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697843.1|3461148_3461406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283625.1|3461644_3462766_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_042283623.1|3462762_3463002_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_042283620.1|3462998_3463679_-	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	47.4	1.8e-43
WP_042283618.1|3463675_3464674_-	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	56.5	6.6e-95
WP_042283616.1|3464670_3464907_-	hypothetical protein	NA	A9YWV8	Burkholderia_phage	76.9	1.1e-27
WP_042283614.1|3464903_3465278_-	DUF4031 domain-containing protein	NA	Q6V7P5	Burkholderia_virus	57.3	4.3e-31
WP_052409077.1|3465274_3465970_-	helix-turn-helix transcriptional regulator	NA	Q6V7U1	Burkholderia_virus	58.2	1.9e-16
WP_042283610.1|3465966_3466407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052409076.1|3466403_3468062_-	helix-turn-helix transcriptional regulator	NA	Q6V7U1	Burkholderia_virus	57.7	1.1e-14
3467937:3467952	attR	TTCGAGGGCGCGGGCG	NA	NA	NA	NA
WP_042283607.1|3468080_3469265_-	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	83.4	4.2e-189
WP_042283602.1|3469608_3470301_-	hypothetical protein	NA	Q6JII4	Burkholderia_virus	51.5	8.5e-57
WP_042283599.1|3470406_3470694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042283596.1|3470699_3471014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042283594.1|3471278_3471491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144417712.1|3471489_3471738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283700.1|3472065_3472263_-	hypothetical protein	NA	Q3HQX5	Burkholderia_phage	70.2	3.5e-16
WP_144417713.1|3473055_3473640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283587.1|3473679_3473880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144417714.1|3473924_3474206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111946523.1|3474198_3474447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042283583.1|3474780_3475155_-	helix-turn-helix transcriptional regulator	NA	A9YWX7	Burkholderia_phage	70.4	7.6e-36
WP_080741952.1|3475239_3475488_+	helix-turn-helix domain-containing protein	NA	A9YWX8	Burkholderia_phage	78.7	1.7e-28
WP_155296500.1|3475489_3475654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080741951.1|3475754_3475979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283582.1|3475975_3476194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283580.1|3476273_3478037_+	DNA cytosine methyltransferase	NA	A9YX21	Burkholderia_phage	70.9	1.1e-132
WP_042283578.1|3478033_3478903_+	hypothetical protein	NA	A9YWY3	Burkholderia_phage	69.9	3.4e-111
WP_042283576.1|3478899_3480036_+	site-specific DNA-methyltransferase	NA	Q8W6P4	Burkholderia_virus	63.9	7.0e-133
WP_042283574.1|3480032_3481007_+	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	76.8	2.2e-143
WP_080741950.1|3481029_3481890_+	ParB N-terminal domain-containing protein	NA	C7BGF1	Burkholderia_phage	53.8	2.5e-66
WP_042283573.1|3481889_3482153_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052409074.1|3482149_3483241_+	hypothetical protein	NA	C5IHL2	Burkholderia_virus	61.5	9.6e-31
WP_045577498.1|3483248_3483452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080741949.1|3483624_3483960_+	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	61.5	1.3e-31
WP_042283566.1|3483967_3484297_+	DUF4406 domain-containing protein	NA	H2BD42	Pseudomonas_phage	51.1	1.2e-21
WP_042283563.1|3484287_3484632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111946389.1|3484628_3484907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283558.1|3484903_3485269_+	DUF2591 family protein	NA	NA	NA	NA	NA
WP_042283555.1|3485265_3485562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283553.1|3485558_3485987_+	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	67.6	4.4e-48
WP_144417716.1|3485979_3486579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111946385.1|3486759_3487419_+	DNA-binding protein	NA	Q3HR05	Burkholderia_phage	39.0	1.1e-26
WP_144417717.1|3487670_3487853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088555447.1|3487840_3488530_+	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	25.6	1.6e-07
WP_144417718.1|3488791_3489379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283543.1|3489371_3491465_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	32.7	1.6e-87
WP_042283541.1|3491470_3491740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283538.1|3491739_3493392_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	33.5	2.3e-76
WP_042283536.1|3493388_3494273_+	S49 family peptidase	NA	A0A1I9KF73	Aeromonas_phage	38.7	7.3e-53
WP_157693196.1|3494299_3494935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283534.1|3494977_3495634_+|head	head decoration protein	head	NA	NA	NA	NA
WP_042283532.1|3495705_3496743_+|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	39.8	2.8e-64
WP_042283530.1|3496744_3497062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283527.1|3497058_3497622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283526.1|3497631_3497832_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_042283523.1|3497828_3499313_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	42.6	1.9e-90
>prophage 1
NZ_CP009321	Burkholderia gladioli strain ATCC 10248 plasmid 1, complete sequence	213090	81225	178882	213090	integrase,transposase	Leptospira_phage(26.32%)	90	79131:79147	184012:184026
79131:79147	attL	CCCGGAAAACGGGGTGA	NA	NA	NA	NA
WP_036047717.1|81225_82155_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
79131:79147	attL	CCCGGAAAACGGGGTGA	NA	NA	NA	NA
WP_036047714.1|82373_82766_-	DUF2471 family protein	NA	NA	NA	NA	NA
WP_036052807.1|82856_83156_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_036047712.1|83248_83515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047709.1|83539_86689_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	28.2	2.0e-89
WP_036047707.1|86695_88174_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_036047704.1|88091_88811_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_036047700.1|88996_89404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036047697.1|89468_90227_+	SOS response-associated peptidase family protein	NA	C7BGE4	Burkholderia_phage	35.0	4.6e-32
WP_036047694.1|90495_91488_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	85.5	1.8e-156
WP_036047694.1|91709_92702_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	85.5	1.8e-156
WP_144417600.1|93131_93452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036047689.1|93470_93788_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_036047687.1|94269_94461_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042284319.1|95490_96360_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013700210.1|96479_96809_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_036047680.1|96994_97417_-	hypothetical protein	NA	A0A1P8DJD6	Virus_Rctr71	40.9	7.8e-21
WP_155296512.1|97490_97658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047676.1|97702_97978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167547484.1|97986_98163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036052816.1|99660_100137_+|transposase	transposase	transposase	NA	NA	NA	NA
99031:99047	attR	CCCGGAAAACGGGGTGA	NA	NA	NA	NA
WP_111946435.1|100172_100463_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.0	1.7e-14
99031:99047	attR	CCCGGAAAACGGGGTGA	NA	NA	NA	NA
WP_036047871.1|100494_102060_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	1.5e-69
WP_144417601.1|102254_102554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144417602.1|102745_103312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080742007.1|103346_103646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047658.1|103883_104270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047655.1|104297_104699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111946429.1|104986_105346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144417603.1|105330_105567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047947.1|105577_105952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155308249.1|106434_106605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080742004.1|106686_107169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052409117.1|107681_107870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080742003.1|108141_108720_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_036047652.1|108716_110309_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	1.7e-68
WP_027810102.1|110340_110691_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.5e-17
WP_111946431.1|110666_111155_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052409116.1|111436_111670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080742002.1|111898_112468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042284310.1|112468_116707_-	AHH domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.7	2.5e-26
WP_042284307.1|116728_117199_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_042284304.1|117251_117686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036032541.1|117685_118555_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_042284301.1|118554_121545_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_045577426.1|122055_122931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047927.1|123754_124783_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_120513391.1|124779_126477_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_042284296.1|126985_127462_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036052801.1|127454_128489_+	AraC family transcriptional regulator ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080742000.1|128962_129286_+	Arc family DNA-binding protein	NA	A0A0H5AWD9	Pseudomonas_phage	55.8	8.3e-07
WP_036052800.1|129609_130497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080741999.1|130929_131988_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_036052799.1|131987_133727_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	24.6	1.7e-21
WP_155296510.1|134111_143390_-	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	28.7	7.2e-26
WP_036053757.1|143601_144153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036052794.1|144223_145201_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_036052791.1|145227_147219_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_036052788.1|147218_147848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155296509.1|148552_148840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036052779.1|150374_151181_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080741998.1|151190_152102_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036052775.1|153004_153985_+	VOC family protein	NA	NA	NA	NA	NA
WP_036052773.1|154040_155180_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036052771.1|155197_156124_+	3-keto-5-aminohexanoate cleavage protein	NA	A0A1V0SL81	Klosneuvirus	27.4	4.8e-23
WP_036052768.1|156195_157371_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_036052767.1|157367_158144_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036052765.1|158260_159169_+	transporter	NA	NA	NA	NA	NA
WP_036052762.1|159386_160634_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_036052759.1|161841_163422_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	26.8	1.3e-44
WP_111946417.1|163452_163785_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	9.1e-17
WP_036052755.1|163781_164306_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036052753.1|164430_165051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144417605.1|165145_165430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047908.1|165479_165740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047905.1|165831_166365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036052828.1|166786_167680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144417606.1|168169_168538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144417607.1|168543_169152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144417608.1|169420_169717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144417609.1|169752_170511_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_036047899.1|170779_171022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036047897.1|171077_171920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144417610.1|172259_172454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047895.1|172450_173242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088555623.1|173690_174448_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_036047889.1|174502_174724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042284287.1|174720_175710_+	DUF4238 domain-containing protein	NA	A0A0F7LBR6	Escherichia_phage	36.4	6.6e-55
WP_088555625.1|175736_178064_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	27.1	7.1e-07
WP_036047888.1|178222_178882_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	25.6	3.2e-05
184012:184026	attR	GTGTCCACGTGGACA	NA	NA	NA	NA
>prophage 1
NZ_CP009322	Burkholderia gladioli strain ATCC 10248 chromosome 2, complete sequence	3927513	1464134	1472668	3927513		Bacillus_phage(33.33%)	9	NA	NA
WP_036056149.1|1464134_1465463_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.5	2.6e-14
WP_017918264.1|1465459_1466206_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	4.4e-27
WP_017918263.1|1466205_1466370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036056147.1|1466366_1466738_-	GFA family protein	NA	NA	NA	NA	NA
WP_036056146.1|1467042_1467594_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_036056144.1|1467977_1469399_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	37.7	2.3e-80
WP_036056142.1|1469403_1470603_+	alginate O-acetyltransferase	NA	A0A125RNN9	Pseudomonas_phage	27.7	7.1e-19
WP_013690383.1|1470725_1472360_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	60.1	1.3e-169
WP_013690384.1|1472377_1472668_-	co-chaperone GroES	NA	A0A221S4A8	uncultured_virus	42.6	6.1e-17
>prophage 1
NZ_CP009319	Burkholderia gladioli strain ATCC 10248 plasmid 3, complete sequence	26710	0	12145	26710		Burkholderia_virus(42.86%)	17	NA	NA
WP_003465059.1|374_740_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000136268.1|755_2402_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
WP_000654684.1|2398_2644_-	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_000735441.1|2646_2922_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294667.1|2937_3288_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000429838.1|3359_3794_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_042286962.1|4025_4586_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	45.6	6.9e-33
WP_042286940.1|4657_4903_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_042286937.1|4937_5585_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	49.3	1.4e-50
WP_042286935.1|5750_6308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042286932.1|6383_7175_-	replication initiation protein	NA	E5FFJ0	Burkholderia_phage	39.7	3.0e-34
WP_052409306.1|8101_9052_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_111946519.1|9116_9368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120513444.1|9448_9730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042286929.1|9726_10872_-	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	70.1	1.3e-155
WP_042286926.1|10883_11615_-	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	64.7	1.2e-80
WP_042286924.1|11611_12145_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	65.3	1.2e-58
>prophage 2
NZ_CP009319	Burkholderia gladioli strain ATCC 10248 plasmid 3, complete sequence	26710	22319	23999	26710	integrase,transposase	Rhodobacter_phage(100.0%)	1	15747:15758	24664:24675
15747:15758	attL	GCTGCTGGCCAG	NA	NA	NA	NA
WP_013124600.1|22319_23999_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	25.3	2.2e-05
WP_013124600.1|22319_23999_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	25.3	2.2e-05
24664:24675	attR	GCTGCTGGCCAG	NA	NA	NA	NA
