The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009435	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome I, complete sequence	3659771	102535	216031	3659771	portal,transposase,terminase,head,protease,integrase,tail,tRNA,plate	uncultured_Caudovirales_phage(20.0%)	107	152408:152429	204287:204308
WP_015876599.1|102535_103450_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_015876600.1|103624_105067_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.3	1.4e-53
WP_015876601.1|105285_105672_-	MliC family protein	NA	NA	NA	NA	NA
WP_015876602.1|105765_105927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876603.1|106023_107238_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_015876604.1|107437_108013_+	META domain-containing protein	NA	NA	NA	NA	NA
WP_015876605.1|108156_112773_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.9	1.1e-83
WP_015876606.1|112991_114197_-	lactonase family protein	NA	NA	NA	NA	NA
WP_015876607.1|114420_116250_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_015876608.1|116509_118027_+	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_015876609.1|118182_118815_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015876610.1|119057_119897_+	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_015876611.1|119893_120538_+	endonuclease III	NA	NA	NA	NA	NA
WP_015876612.1|120866_121301_+	DUF1841 family protein	NA	NA	NA	NA	NA
WP_015876613.1|121430_121799_-	cytochrome c	NA	NA	NA	NA	NA
WP_015876614.1|121836_122196_-	cytochrome c	NA	NA	NA	NA	NA
WP_015876615.1|122466_123309_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_015876616.1|123451_124627_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_085962346.1|124714_125531_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015876618.1|125702_126914_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_015876619.1|127133_128087_+	transaldolase	NA	A0A0E3F5V4	Synechococcus_phage	30.4	6.7e-12
WP_015876620.1|128332_128770_+	VOC family protein	NA	NA	NA	NA	NA
WP_015876621.1|128915_129845_-	spermidine synthase	NA	NA	NA	NA	NA
WP_015876622.1|129934_130426_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_015876623.1|130422_131061_-	chorismate lyase	NA	NA	NA	NA	NA
WP_015876624.1|131057_132956_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	2.1e-118
WP_015876625.1|133157_134651_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_015876626.1|134987_135707_+	VOC family protein	NA	NA	NA	NA	NA
WP_015876627.1|135776_136688_+	DMT family transporter	NA	NA	NA	NA	NA
WP_035980910.1|136752_137934_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_015876629.1|137998_138457_+	RidA family protein	NA	NA	NA	NA	NA
WP_045678833.1|138453_139338_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_015876631.1|142534_143737_+	chromate transporter	NA	NA	NA	NA	NA
WP_015876632.1|143822_144281_-	CopD family protein	NA	NA	NA	NA	NA
WP_015876633.1|144542_146867_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.0	3.7e-80
WP_015876634.1|146940_148923_-	type IIA DNA topoisomerase subunit B	NA	G3M9Z3	Bacillus_virus	34.5	5.7e-90
WP_015876635.1|149124_151092_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	5.4e-48
WP_015876636.1|151297_151708_-	DUF4399 domain-containing protein	NA	NA	NA	NA	NA
152408:152429	attL	ACTATCCGCTCCCCGTAGTTCA	NA	NA	NA	NA
WP_015876637.1|153255_154179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045678834.1|154171_154645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042967743.1|154641_156699_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_127913929.1|156744_157089_-	DCL family protein	NA	NA	NA	NA	NA
WP_015876638.1|158443_158848_+	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	45.2	5.2e-14
WP_042967740.1|158852_159356_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	43.8	8.7e-19
WP_042967741.1|159703_160306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015876642.1|160308_161016_+	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	42.1	3.2e-35
WP_017432865.1|161466_161730_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	71.6	3.3e-30
WP_133164454.1|161825_162296_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012732735.1|162377_162833_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012732734.1|162832_163186_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.4	2.1e-19
WP_012732733.1|163285_164872_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	33.8	1.5e-56
WP_127913928.1|164907_165273_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.2e-16
WP_012732752.1|165304_166861_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.1e-67
WP_015877383.1|167123_168170_+|transposase	IS481-like element IS1419 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	74.2	8.4e-149
WP_017432367.1|168792_169422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876646.1|169418_169985_-	N-acetylmuramidase	NA	A0A0E3JI96	Rhodoferax_phage	53.7	3.1e-49
WP_017432368.1|169981_170431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876647.1|170503_171553_-	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	48.1	2.5e-84
WP_015876648.1|171562_171769_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	55.2	1.4e-12
WP_015876649.1|171743_172622_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	39.1	7.5e-34
WP_017432369.1|172631_175061_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.5	2.3e-56
WP_015876651.1|175142_175445_-|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	39.0	1.3e-06
WP_015876652.1|175526_176030_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.6	1.2e-41
WP_015876653.1|176039_177209_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.9	1.2e-159
WP_015876654.1|177280_178003_-|tail	tail assembly chaperone	tail	E5E3Q6	Burkholderia_phage	59.1	5.0e-60
WP_015876655.1|178016_180029_-|tail	tail fiber protein	tail	Q45YG3	Burkholderia_virus	57.0	5.0e-126
WP_015876656.1|180016_180595_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	48.0	1.4e-33
WP_015876657.1|180584_181481_-|plate	baseplate J/gp47 family protein	plate	A0A1J0I2M3	Salmonella_phage	39.1	1.3e-46
WP_015876658.1|181477_181810_-	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.0	9.4e-22
WP_015876659.1|181806_182004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876660.1|182071_182809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876661.1|182914_183595_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	28.5	9.3e-16
WP_015876662.1|183591_184122_-	hypothetical protein	NA	A0A1B2LRU9	Wolbachia_phage	43.5	3.8e-25
WP_015876663.1|184111_184642_-|tail	phage tail protein	tail	K7R9K2	Vibrio_phage	34.9	6.3e-20
WP_015876664.1|184645_184936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876665.1|186009_186354_-|head	head decoration protein	head	NA	NA	NA	NA
WP_015876666.1|186383_187484_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	36.0	1.8e-48
WP_015876667.1|187480_188971_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.8	1.8e-136
WP_013698685.1|188967_189174_-	hypothetical protein	NA	A0A219Y8X9	Aeromonas_phage	52.1	3.8e-05
WP_080569335.1|189184_191203_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	52.5	3.9e-179
WP_015876669.1|191165_191735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876670.1|192289_193063_-	zinc finger-like domain-containing protein	NA	NA	NA	NA	NA
WP_015876671.1|193281_195783_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	40.7	3.2e-98
WP_013698691.1|195941_196325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174484820.1|196311_196854_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	45.6	2.9e-28
WP_015876673.1|197279_197783_+	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	37.0	3.4e-07
WP_050811421.1|197736_198252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080569337.1|198356_198575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042967260.1|198624_198987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015876675.1|198986_200363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042967258.1|200464_200824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017432301.1|200816_201308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017432302.1|201304_201535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017432303.1|201707_201884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876678.1|202108_202969_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_015876679.1|202978_204079_-|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	31.7	1.8e-45
WP_015876680.1|205505_206345_+	hypothetical protein	NA	NA	NA	NA	NA
204287:204308	attR	ACTATCCGCTCCCCGTAGTTCA	NA	NA	NA	NA
WP_015876681.1|206348_206642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158335149.1|206751_206949_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_017433129.1|208621_210232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015876683.1|210659_212318_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035979006.1|212415_212766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017433131.1|213076_213457_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_015876684.1|213568_213838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015876685.1|213959_214169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045678837.1|214263_215454_+	serine hydrolase	NA	NA	NA	NA	NA
WP_015876687.1|215491_216031_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 2
NZ_CP009435	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome I, complete sequence	3659771	345043	355979	3659771	tRNA,protease	Klosneuvirus(14.29%)	9	NA	NA
WP_015876796.1|345043_347881_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.3	2.0e-80
WP_015876797.1|347883_348384_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_015876798.1|348467_349679_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.1	6.3e-39
WP_015876799.1|349762_350209_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	63.7	6.7e-47
WP_015876800.1|350485_352783_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.4e-169
WP_015876801.1|352779_353094_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	43.4	7.6e-13
WP_004196460.1|353623_353827_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_015876802.1|353938_355534_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_015876803.1|355613_355979_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	29.8	1.2e-06
>prophage 3
NZ_CP009435	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome I, complete sequence	3659771	1127176	1169223	3659771	portal,transposase,terminase,capsid,head,integrase,tail,holin,plate	Burkholderia_phage(91.11%)	53	1127078:1127124	1168005:1168051
1127078:1127124	attL	CTCCGAAGGCAGGGGTTGCTGGTTCGATCCCAGCCGGGCGCGCCAAG	NA	NA	NA	NA
WP_017432090.1|1127176_1128253_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	91.3	6.5e-181
WP_017432091.1|1129143_1131936_-	toprim domain-containing protein	NA	A0A1S5NPU9	Burkholderia_phage	96.9	0.0e+00
WP_017432092.1|1131938_1132187_-	hypothetical protein	NA	E5E3T3	Burkholderia_phage	95.1	2.7e-34
WP_045678860.1|1132183_1132546_-	hypothetical protein	NA	A0A1S5NQ52	Burkholderia_phage	90.8	7.3e-44
WP_017432093.1|1132549_1132744_-	hypothetical protein	NA	A0A1S5NTI1	Burkholderia_phage	93.8	6.5e-23
WP_017432094.1|1132787_1132982_-	hypothetical protein	NA	E5E3T6	Burkholderia_phage	95.3	9.3e-30
WP_012734468.1|1132986_1133181_-	hypothetical protein	NA	A0A1S5NR87	Burkholderia_phage	96.9	5.7e-27
WP_017432095.1|1133269_1133518_-	ogr/Delta-like zinc finger family protein	NA	A0A1S5NNI9	Burkholderia_phage	96.3	3.4e-40
WP_012734469.1|1133545_1133737_-	hypothetical protein	NA	E5E3T9	Burkholderia_phage	54.7	1.4e-09
WP_017432096.1|1133765_1133957_-	hypothetical protein	NA	E5E3U0	Burkholderia_phage	67.3	1.7e-12
WP_035978289.1|1133973_1134159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174484821.1|1134318_1134768_+	helix-turn-helix transcriptional regulator	NA	E5E3U2	Burkholderia_phage	41.9	6.3e-21
WP_042967159.1|1134758_1135139_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017432101.1|1135604_1136759_-	phage late control D family protein	NA	A0A1S5NV58	Burkholderia_phage	96.6	1.5e-191
WP_017432102.1|1136755_1137184_-|tail	phage tail protein	tail	A0A1S5NTH4	Burkholderia_phage	95.8	2.9e-71
WP_045678862.1|1137197_1140449_-	hypothetical protein	NA	A0A1S5NRM8	Burkholderia_phage	89.3	0.0e+00
WP_017432103.1|1140445_1140565_-|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	86.8	3.1e-12
WP_017432104.1|1140564_1140876_-|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	85.4	1.9e-40
WP_017432105.1|1140909_1141419_-|tail	phage major tail tube protein	tail	A0A1S5NNH7	Burkholderia_phage	96.4	1.6e-89
WP_017432106.1|1141448_1142621_-|tail	phage tail sheath protein	tail	A0A1S5NNH8	Burkholderia_phage	94.4	5.6e-218
WP_017432107.1|1142732_1143482_-	site-specific DNA-methyltransferase	NA	A0A1S5NPU0	Burkholderia_phage	97.6	5.4e-142
WP_080942760.1|1143459_1143642_-	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	98.3	2.2e-28
WP_017432108.1|1143791_1144130_-	hypothetical protein	NA	A0A1S5NQ35	Burkholderia_phage	57.1	8.4e-26
WP_017432109.1|1144187_1144619_-|tail	phage tail assembly chaperone	tail	R4JMH4	Burkholderia_phage	80.4	6.6e-60
WP_045678863.1|1144615_1147723_-	hypothetical protein	NA	A0A1S5NTG6	Burkholderia_phage	61.6	0.0e+00
WP_042967161.1|1147728_1148280_-|tail	phage tail protein I	tail	A0A1S5NRL9	Burkholderia_phage	97.3	1.2e-98
WP_017432111.1|1148272_1149178_-|plate	baseplate J/gp47 family protein	plate	A0A1S5NR72	Burkholderia_phage	96.7	2.6e-159
WP_017432112.1|1149174_1149540_-	GPW/gp25 family protein	NA	A0A1S5NNH3	Burkholderia_phage	92.6	1.3e-56
WP_017432113.1|1149536_1150244_-|plate	phage baseplate assembly protein V	plate	A0A1S5NNH1	Burkholderia_phage	82.9	1.0e-94
WP_042967162.1|1150329_1151091_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_017432116.1|1151144_1151594_-	phage virion morphogenesis protein	NA	A0A1S5NPT5	Burkholderia_phage	93.2	4.0e-68
WP_017432117.1|1151593_1152004_-|tail	phage tail protein	tail	A0A1S5NPS3	Burkholderia_phage	96.3	6.1e-71
WP_017432118.1|1152000_1152492_-	hypothetical protein	NA	A0A1S5NQ26	Burkholderia_phage	92.0	4.6e-73
WP_017432119.1|1152488_1153289_-	DUF3380 domain-containing protein	NA	A0A1S5NV50	Burkholderia_phage	96.6	3.2e-140
WP_017432120.1|1153281_1153602_-|holin	phage holin family protein	holin	A0A1S5NTF8	Burkholderia_phage	96.2	1.0e-49
WP_012327676.1|1153601_1153976_-|holin	phage holin family protein	holin	A0A1S5NRL1	Burkholderia_phage	100.0	7.8e-57
WP_017432121.1|1153978_1154191_-|tail	tail protein X	tail	A0A1S5NR68	Burkholderia_phage	94.3	1.3e-32
WP_034196661.1|1154190_1154427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017432123.1|1154426_1154909_-|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	93.8	1.3e-80
WP_017432124.1|1155013_1155700_-|terminase	terminase endonuclease subunit	terminase	A0A1S5NNA5	Burkholderia_phage	96.5	2.0e-119
WP_017432125.1|1155696_1156716_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S5NPT2	Burkholderia_phage	90.6	6.6e-175
WP_017432126.1|1156752_1157577_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S5NPS0	Burkholderia_phage	90.5	5.6e-132
WP_017432127.1|1157721_1159473_+|terminase	terminase ATPase subunit family protein	terminase	E5E3S6	Burkholderia_phage	88.9	0.0e+00
WP_017432128.1|1159472_1160525_+|portal	phage portal protein	portal	A0A1S5NV43	Burkholderia_phage	96.6	4.9e-197
WP_017432129.1|1160946_1161363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045678864.1|1161362_1161827_-	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	34.8	2.8e-16
WP_127913978.1|1162203_1163547_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_017432132.1|1163606_1164719_-	DUF3396 domain-containing protein	NA	E5E3X7	Burkholderia_phage	95.1	1.0e-205
WP_017432133.1|1164728_1165457_-	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	48.3	2.6e-48
WP_045678865.1|1165453_1165981_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	65.1	2.6e-58
WP_127913977.1|1166107_1166752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017432135.1|1167037_1167802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015877383.1|1168176_1169223_+|transposase	IS481-like element IS1419 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	74.2	8.4e-149
1168005:1168051	attR	CTCCGAAGGCAGGGGTTGCTGGTTCGATCCCAGCCGGGCGCGCCAAG	NA	NA	NA	NA
>prophage 4
NZ_CP009435	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome I, complete sequence	3659771	1398842	1427355	3659771	plate,transposase,protease,integrase	Pseudomonas_phage(25.0%)	28	1392260:1392277	1441870:1441887
1392260:1392277	attL	GTGATCGCGCTGCCGATC	NA	NA	NA	NA
WP_012734445.1|1398842_1399361_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	48.6	1.2e-20
WP_017432925.1|1399629_1400847_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	43.0	1.7e-89
WP_045678878.1|1401463_1404325_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.4	2.5e-70
WP_004556769.1|1404452_1404779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009962289.1|1404788_1405136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009962292.1|1405128_1405341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876770.1|1405333_1405636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017432173.1|1405628_1405805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017432172.1|1406132_1406657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013699107.1|1406653_1406845_-	AlpA family phage regulatory protein	NA	A0A2L0V109	Agrobacterium_phage	49.1	4.9e-07
WP_144415948.1|1407370_1410268_-	DEAD/DEAH box helicase	NA	A0A2H4UVG1	Bodo_saltans_virus	24.4	7.8e-11
WP_017432170.1|1410603_1411191_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	41.5	2.1e-24
WP_011883089.1|1411277_1411763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017432169.1|1411774_1412908_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_080569283.1|1413954_1414128_+	DUF3380 domain-containing protein	NA	NA	NA	NA	NA
WP_017432168.1|1414136_1414313_+	DUF3380 domain-containing protein	NA	NA	NA	NA	NA
WP_127913971.1|1414309_1414744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012733678.1|1414835_1415882_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	72.7	9.2e-148
WP_012734474.1|1416961_1418149_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	9.5e-16
WP_012734475.1|1418327_1419119_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_012734476.1|1419115_1420462_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_012734477.1|1420563_1421181_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012734478.1|1421550_1422195_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012734479.1|1422238_1422778_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_012734480.1|1422792_1424283_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_012734481.1|1424360_1424864_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_012734482.1|1424941_1425424_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012734483.1|1425516_1427355_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
1441870:1441887	attR	GTGATCGCGCTGCCGATC	NA	NA	NA	NA
>prophage 5
NZ_CP009435	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome I, complete sequence	3659771	1695333	1704231	3659771		Pandoravirus(33.33%)	7	NA	NA
WP_012734717.1|1695333_1697295_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.0	6.6e-147
WP_012734718.1|1697516_1698653_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.0	1.2e-23
WP_012734719.1|1698669_1700520_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	37.7	6.8e-53
WP_012734720.1|1700548_1701364_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	30.5	1.8e-34
WP_012734721.1|1701410_1702094_-	deoxynucleoside kinase	NA	NA	NA	NA	NA
WP_012734722.1|1702090_1702624_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	40.5	6.2e-15
WP_012734723.1|1702653_1704231_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	28.4	2.8e-23
>prophage 6
NZ_CP009435	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome I, complete sequence	3659771	1982650	1990981	3659771		Bacillus_phage(16.67%)	9	NA	NA
WP_012734955.1|1982650_1984051_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.1	1.8e-77
WP_155297042.1|1984064_1985000_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.4	1.8e-14
WP_012734957.1|1985054_1986047_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.8	2.8e-29
WP_012734958.1|1986121_1986445_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153477922.1|1986497_1986644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012734959.1|1986668_1987571_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.2	3.1e-51
WP_012734960.1|1987659_1988940_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_012734961.1|1989117_1990041_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.2	2.4e-43
WP_012734962.1|1990111_1990981_-	alpha/beta hydrolase	NA	P87627	Cowpox_virus	31.0	5.7e-26
>prophage 7
NZ_CP009435	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome I, complete sequence	3659771	2320759	2368365	3659771	lysis,transposase,integrase	Burkholderia_virus(29.41%)	46	2321895:2321910	2360012:2360027
WP_080569359.1|2320759_2320939_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085962370.1|2321216_2322021_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
2321895:2321910	attL	CGCATGCCTGGTTCGC	NA	NA	NA	NA
WP_045678893.1|2323086_2324325_+|integrase	site-specific integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	27.3	2.0e-08
WP_127913965.1|2324325_2324928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127913964.1|2324990_2325176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017432384.1|2325219_2325855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045678894.1|2325864_2327001_+	hypothetical protein	NA	A0A2H4J138	uncultured_Caudovirales_phage	34.7	1.3e-49
WP_017432381.1|2327087_2328311_+	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_017432380.1|2328337_2328940_-	recombinase family protein	NA	NA	NA	NA	NA
WP_042967290.1|2329569_2329962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042967288.1|2329964_2331047_+	XRE family transcriptional regulator	NA	B6SBZ6	Clostridium_virus	33.5	1.0e-32
WP_045678895.1|2331251_2334590_-	hypothetical protein	NA	A0A2R2ZGH5	Clostridioides_phage	23.6	9.9e-10
WP_045678896.1|2334607_2337991_-	helicase	NA	A0A2K5B2B9	Erysipelothrix_phage	27.1	2.7e-39
WP_080942766.1|2338809_2339064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085962364.1|2339142_2340346_+|transposase	IS3-like element ISBugl1 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.4	1.3e-97
WP_080942770.1|2340586_2341093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080942767.1|2341103_2341430_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045678897.1|2341616_2342195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127913963.1|2342287_2343022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145961913.1|2343071_2343593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127913961.1|2343674_2344880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015877383.1|2345368_2346415_+|transposase	IS481-like element IS1419 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	74.2	8.4e-149
WP_127913960.1|2346496_2347522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045678899.1|2347521_2347773_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_127913959.1|2347896_2349024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012735240.1|2349323_2349782_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012735241.1|2349933_2350752_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012735242.1|2350953_2351142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012735243.1|2351241_2352603_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_012735244.1|2352611_2352947_-	DUF2288 domain-containing protein	NA	NA	NA	NA	NA
WP_012735245.1|2353186_2354809_-	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	33.1	8.6e-60
WP_012735246.1|2355128_2355830_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_012735247.1|2356141_2357050_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_162486901.1|2357354_2357699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012735248.1|2357621_2358452_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_012735249.1|2358849_2359917_-|integrase	site-specific integrase	integrase	K7PHM9	Enterobacterial_phage	34.7	1.0e-56
WP_012735252.1|2361064_2361652_+	hypothetical protein	NA	NA	NA	NA	NA
2360012:2360027	attR	GCGAACCAGGCATGCG	NA	NA	NA	NA
WP_012735253.1|2361941_2362328_-	helix-turn-helix transcriptional regulator	NA	Q8W6N2	Burkholderia_virus	82.0	1.4e-48
WP_012735254.1|2362324_2362582_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q8W6N1	Burkholderia_virus	83.5	5.7e-35
WP_012735255.1|2363895_2364153_+	hypothetical protein	NA	Q6J1Q7	Burkholderia_virus	56.1	9.8e-19
WP_017423130.1|2364149_2364434_+	hypothetical protein	NA	Q6J1Q6	Burkholderia_virus	57.6	8.1e-22
WP_012735257.1|2364417_2364840_+	glycoside hydrolase family protein	NA	A0A1Q1PW74	Pseudoalteromonas_phage	50.4	2.5e-27
WP_012735258.1|2364845_2365394_+|lysis	lysis protein	lysis	Q8W6S5	Burkholderia_virus	50.8	2.3e-33
WP_012734051.1|2365974_2366451_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012732753.1|2366426_2366777_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_012732752.1|2366808_2368365_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.1e-67
>prophage 8
NZ_CP009435	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome I, complete sequence	3659771	3019655	3059555	3659771	tRNA,transposase	Burkholderia_virus(16.67%)	29	NA	NA
WP_015875901.1|3019655_3020666_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_088499465.1|3021189_3023031_-	transporter	NA	NA	NA	NA	NA
WP_017432901.1|3023861_3025334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085962428.1|3026439_3027677_-|transposase	IS3-like element IS1416 family transposase	transposase	Q8W6R2	Burkholderia_virus	94.7	1.9e-155
WP_085962362.1|3027947_3028764_+|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
WP_085962352.1|3028783_3029588_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_085962353.1|3029697_3030502_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015875907.1|3031139_3032756_-	amino acid adenylation domain-containing protein	NA	NA	NA	NA	NA
WP_015875908.1|3032752_3033706_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_015875909.1|3033771_3036045_-	N,N-dimethylformamidase large subunit	NA	NA	NA	NA	NA
WP_158335152.1|3036041_3037700_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.1	1.9e-22
WP_015875911.1|3037781_3038948_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_017433090.1|3038994_3039282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080763615.1|3039317_3040337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015875913.1|3040349_3041342_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	83.3	1.5e-152
WP_017432258.1|3041754_3042810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158335153.1|3042779_3043658_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_015875915.1|3044600_3045539_-	nucleoside-diphosphate kinase	NA	NA	NA	NA	NA
WP_035983864.1|3045560_3046733_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_015875917.1|3046849_3047824_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_015875918.1|3047849_3049088_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_015875919.1|3049084_3049789_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015875920.1|3049978_3051037_-	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_015875921.1|3051095_3051434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015875922.1|3051481_3052534_-	nucleoside-diphosphate kinase	NA	NA	NA	NA	NA
WP_015875923.1|3052530_3055761_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	22.9	7.0e-69
WP_015875924.1|3055800_3057231_-	MFS transporter	NA	NA	NA	NA	NA
WP_158335154.1|3057634_3058417_+	metallophosphoesterase	NA	A0A218MKA7	uncultured_virus	29.1	2.7e-19
WP_015877383.1|3058508_3059555_+|transposase	IS481-like element IS1419 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	74.2	8.4e-149
>prophage 9
NZ_CP009435	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome I, complete sequence	3659771	3144015	3196638	3659771	portal,transposase,capsid,tail,tRNA,plate	uncultured_virus(27.27%)	58	NA	NA
WP_015875993.1|3144015_3144972_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_015875994.1|3145008_3145377_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_017423930.1|3145490_3148457_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	1.1e-20
WP_015875996.1|3148550_3150026_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_015875997.1|3150022_3150484_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_039202366.1|3150788_3152504_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_015875999.1|3152565_3153648_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.1	1.3e-22
WP_015876000.1|3153934_3155134_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_015876001.1|3155245_3156148_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015876002.1|3156543_3156945_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080569365.1|3157164_3157419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015876004.1|3157583_3157901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017423839.1|3158089_3158806_+	YdcF family protein	NA	NA	NA	NA	NA
WP_015876006.1|3159059_3159320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015876007.1|3159476_3159734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015876008.1|3159790_3160081_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_127913946.1|3160247_3160433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876009.1|3160578_3161781_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_015876011.1|3163169_3163541_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_127913945.1|3164723_3165671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876012.1|3166165_3166633_+	hypothetical protein	NA	C7BGE3	Burkholderia_phage	37.7	2.0e-09
WP_015876013.1|3166662_3167454_-	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	73.4	1.5e-118
WP_015876014.1|3167596_3168400_-	patatin-like phospholipase family protein	NA	A0A1X7QFZ0	Faustovirus	28.8	3.9e-05
WP_015876015.1|3168396_3168876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045678918.1|3168949_3169273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017432426.1|3169334_3169790_-	glucosaminidase domain-containing protein	NA	Q9ZXE4	Bacillus_phage	36.4	1.7e-13
WP_015876017.1|3169792_3170200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876018.1|3170230_3172201_-	transporter	NA	NA	NA	NA	NA
WP_017432425.1|3172216_3172444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876020.1|3174147_3174894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876021.1|3174894_3176016_-|plate	baseplate J/gp47 family protein	plate	B3GAJ9	uncultured_virus	39.4	1.9e-45
WP_015876022.1|3176016_3176424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876023.1|3176423_3177143_-|plate	phage baseplate assembly protein V	plate	B3GAJ7	uncultured_virus	33.3	2.9e-15
WP_015876024.1|3177139_3178258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876025.1|3178261_3179227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876026.1|3179228_3181136_-	hypothetical protein	NA	A4JWS3	Burkholderia_virus	28.9	5.4e-29
WP_017433231.1|3181170_3181422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015876027.1|3181405_3181888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876028.1|3182054_3182465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876029.1|3182474_3182915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876030.1|3183009_3185010_-|tail	phage tail sheath protein	tail	B3GAJ6	uncultured_virus	31.5	3.4e-66
WP_043307268.1|3185071_3185287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876031.1|3185295_3186138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876032.1|3186138_3186492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876033.1|3186488_3187427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043307270.1|3187428_3187821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876034.1|3187817_3188102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876035.1|3188183_3189242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876036.1|3189291_3190755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017433413.1|3190763_3191018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017433414.1|3191068_3191278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876037.1|3191335_3191644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080942771.1|3191709_3193017_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_045678919.1|3193078_3194638_-	hypothetical protein	NA	Q775B9	Bordetella_phage	49.3	7.9e-127
WP_015876040.1|3194543_3195071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042967364.1|3195186_3195480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127913944.1|3195593_3195866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127913943.1|3196338_3196638_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
>prophage 10
NZ_CP009435	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome I, complete sequence	3659771	3211089	3225236	3659771	integrase	Pseudomonas_phage(25.0%)	19	3211688:3211703	3227077:3227092
WP_015876058.1|3211089_3211341_+	hypothetical protein	NA	V5YUQ9	Pseudomonas_phage	70.3	1.2e-08
WP_017432510.1|3211340_3211496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015876059.1|3211513_3212416_+	ERF family protein	NA	K7ZLF1	Xanthomonas_citri_phage	49.5	6.5e-41
3211688:3211703	attL	ATCGAGAAGCTGATGG	NA	NA	NA	NA
WP_015876060.1|3212408_3214043_+	YqaJ viral recombinase family protein	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	43.4	1.9e-86
WP_015876061.1|3214079_3214724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015876062.1|3214823_3215489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015876063.1|3215485_3215953_+	DUF3268 family zinc-finger domain-containing protein	NA	A9YX19	Burkholderia_phage	70.4	3.1e-55
WP_015876064.1|3215949_3216144_+	hypothetical protein	NA	A9YX20	Burkholderia_phage	71.4	2.6e-16
WP_043307279.1|3216146_3216557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015876065.1|3216572_3218483_+	DNA methyltransferase	NA	L7TH64	Pseudomonas_virus	55.7	6.4e-163
WP_015876066.1|3218496_3218976_+	hypothetical protein	NA	A0A0K2FHI1	Achromobacter_phage	45.8	5.3e-34
WP_042967310.1|3220684_3220942_+	hypothetical protein	NA	A0A2H4P7L2	Pseudomonas_phage	53.2	1.5e-19
WP_017432407.1|3220951_3221344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045678921.1|3221441_3221669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876068.1|3221704_3222649_+	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	57.1	2.5e-99
WP_015876069.1|3222645_3223221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876070.1|3223219_3223858_+	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	39.0	7.1e-26
WP_015876071.1|3223854_3224103_+	DUF4224 domain-containing protein	NA	Q8W6R6	Burkholderia_virus	46.7	6.2e-10
WP_015876072.1|3224099_3225236_+|integrase	tyrosine-type recombinase/integrase	integrase	Q6JIJ8	Burkholderia_virus	44.8	1.9e-82
3227077:3227092	attR	ATCGAGAAGCTGATGG	NA	NA	NA	NA
>prophage 11
NZ_CP009435	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome I, complete sequence	3659771	3458264	3469718	3659771	transposase	Mannheimia_phage(40.0%)	14	NA	NA
WP_015877383.1|3458264_3459311_+|transposase	IS481-like element IS1419 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	74.2	8.4e-149
WP_017425184.1|3459425_3459674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876292.1|3459686_3460418_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_127913936.1|3461359_3461620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085962361.1|3461632_3461842_-	hypothetical protein	NA	Q8W6R1	Burkholderia_virus	57.4	2.1e-11
WP_015876293.1|3462565_3463144_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015876294.1|3463152_3463956_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_085962362.1|3464388_3465205_+|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
WP_144415949.1|3465321_3465567_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_102952644.1|3465538_3465790_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012732735.1|3466001_3466457_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_015877383.1|3466512_3467559_-|transposase	IS481-like element IS1419 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	74.2	8.4e-149
WP_012732734.1|3467678_3468032_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.4	2.1e-19
WP_012732733.1|3468131_3469718_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	33.8	1.5e-56
>prophage 1
NZ_CP009434	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome II, complete sequence	2820414	129002	192908	2820414	transposase,plate	Mycobacterium_phage(10.0%)	51	NA	NA
WP_157384227.1|129002_129221_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_045678719.1|129751_131395_-	MCP four helix bundle domain-containing protein	NA	NA	NA	NA	NA
WP_012733079.1|132166_132847_+	YfdX family protein	NA	NA	NA	NA	NA
WP_012733078.1|133050_133470_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_017424503.1|133573_133981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733077.1|134150_134642_+	low affinity iron permease family protein	NA	Q19XG2	Mycobacterium_phage	42.3	1.5e-07
WP_012733076.1|135067_135658_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012733075.1|135703_136822_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_153478468.1|136978_137119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733074.1|137861_138044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012733073.1|138057_139455_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.5	2.8e-43
WP_017424497.1|139627_139765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733072.1|139984_141190_-	porin	NA	NA	NA	NA	NA
WP_085962358.1|141614_142819_-|transposase	IS3-like element IS1417 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.1	1.0e-97
WP_012733071.1|143100_144009_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012733070.1|144837_147210_+	DNA polymerase II	NA	L7TKF2	Halovirus	22.1	1.2e-28
WP_085962356.1|147559_148377_-|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
WP_012733069.1|148676_149888_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_012733068.1|150332_151142_+	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
WP_012733067.1|151456_151783_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_012733066.1|151797_152214_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_012733065.1|152266_153301_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012733064.1|153353_154562_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.5	1.6e-42
WP_012733063.1|154628_155360_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012733062.1|155505_156978_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.1	2.9e-46
WP_012733061.1|157098_158409_+	MFS transporter	NA	NA	NA	NA	NA
WP_127913870.1|158988_159168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733060.1|159361_161017_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_012733059.1|161013_161673_+	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_017432137.1|161682_164205_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.9	1.6e-89
WP_012733057.1|164336_165119_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012733056.1|165181_165982_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_080569371.1|166429_166651_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162486896.1|166584_166752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733055.1|166763_167411_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012733054.1|167800_168919_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_012733053.1|168915_169602_-	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	33.2	2.6e-18
WP_012733052.1|169729_171952_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012733051.1|173841_174993_-	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_012733050.1|175016_176162_-	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_012733049.1|176158_177478_-	YadA-like family protein	NA	NA	NA	NA	NA
WP_012733048.1|179550_180030_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_173941228.1|181281_181812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157384073.1|182070_182487_+	response regulator	NA	NA	NA	NA	NA
WP_012733047.1|182754_185076_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.9	2.4e-23
WP_017432145.1|185072_185336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733046.1|185390_188192_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	30.6	2.4e-73
WP_012733045.1|188506_189694_+	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_012733044.1|189677_190511_+	virulence protein SciE type	NA	NA	NA	NA	NA
WP_012733043.1|190507_191026_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012733042.1|191027_192908_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 2
NZ_CP009434	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome II, complete sequence	2820414	420925	499144	2820414	transposase,tail,protease,holin,plate	Burkholderia_phage(83.33%)	75	NA	NA
WP_015878214.1|420925_422302_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
WP_100555937.1|422343_422955_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015878212.1|422951_423533_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_045678723.1|423542_426659_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.1	5.2e-45
WP_015878210.1|426773_429416_+	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_017433441.1|429667_429817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015878209.1|430216_430492_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_013691668.1|430779_430857_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_015878208.1|430981_431893_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_015878207.1|431950_432709_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_015878206.1|432708_432984_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_035979037.1|433042_434170_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_015878204.1|434138_436007_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_015878203.1|436127_437297_-	porin	NA	NA	NA	NA	NA
WP_015878202.1|438062_438701_+	LysE family translocator	NA	NA	NA	NA	NA
WP_015878201.1|438777_439938_-	porin	NA	NA	NA	NA	NA
WP_015878200.1|440680_442759_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_015878199.1|442773_442980_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_127913875.1|443023_443299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015878198.1|443361_443643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015878197.1|443836_444373_-	chromate transporter	NA	NA	NA	NA	NA
WP_015878196.1|444384_444972_-	chromate transporter	NA	NA	NA	NA	NA
WP_015878195.1|445353_446514_-	adenosyl-hopene transferase HpnH	NA	NA	NA	NA	NA
WP_015878194.1|446526_447468_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_015878193.1|447823_449011_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015878192.1|449123_450467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015878191.1|450749_451760_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_015878190.1|451922_452219_+	acylphosphatase	NA	NA	NA	NA	NA
WP_015878189.1|452232_453129_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_015878188.1|453572_454691_+	OpgC domain-containing protein	NA	NA	NA	NA	NA
WP_015878187.1|454815_455022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015878186.1|455124_456648_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	27.2	6.7e-38
WP_015878185.1|457313_457895_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015878184.1|458179_459634_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_015878183.1|459677_460667_-	DedA family protein/thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_015878182.1|460841_461111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015878181.1|461292_462696_-	GntP family permease	NA	NA	NA	NA	NA
WP_026051701.1|464013_464193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015878179.1|464294_464585_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_015878178.1|465173_467564_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015878177.1|467963_468515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015878176.1|469380_469998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015878175.1|470188_473176_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_015878174.1|473750_474179_-|tail	tail fiber assembly protein	tail	A4JWL9	Burkholderia_virus	57.5	1.6e-26
WP_015878173.1|474183_475140_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	35.4	5.5e-22
WP_015878172.1|475152_475749_-	DUF2313 domain-containing protein	NA	B5TAB0	Burkholderia_phage	63.8	2.0e-62
WP_017432231.1|475748_476870_-|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	71.3	2.8e-150
WP_169511631.1|476866_477454_-	phage GP46 family protein	NA	B5TAA8	Burkholderia_phage	70.3	1.5e-78
WP_015878169.1|477538_478054_-|plate	phage baseplate assembly protein	plate	B5TAA7	Burkholderia_phage	62.0	1.0e-54
WP_015878168.1|478050_479220_-	hypothetical protein	NA	B5TAA6	Burkholderia_phage	76.9	1.3e-174
WP_015878167.1|479223_480594_-	DNA circularization N-terminal domain-containing protein	NA	B5TAA5	Burkholderia_phage	75.3	6.1e-192
WP_015878166.1|480597_482988_-|tail	phage tail tape measure protein	tail	B5TAA4	Burkholderia_phage	61.7	3.2e-180
WP_017432229.1|483036_483585_-|tail	phage tail assembly protein	tail	B5TAA3	Burkholderia_phage	67.9	4.1e-62
WP_017432228.1|483674_484046_-	hypothetical protein	NA	B5TAA2	Burkholderia_phage	68.3	2.8e-43
WP_015878165.1|484093_485572_-|tail	tail sheath protein	tail	B5TAA1	Burkholderia_phage	74.6	3.3e-215
WP_102952619.1|485622_485889_-	hypothetical protein	NA	B5TAA0	Burkholderia_phage	56.4	2.6e-14
WP_017432226.1|485857_486472_-	hypothetical protein	NA	B5TA99	Burkholderia_phage	49.0	7.5e-49
WP_015878164.1|486471_486906_-	phage virion morphogenesis protein	NA	B5TA98	Burkholderia_phage	64.3	1.8e-44
WP_015878163.1|487496_487895_-	hypothetical protein	NA	B5TA91	Burkholderia_phage	78.0	6.4e-49
WP_017432225.1|487891_488275_-	regulatory protein GemA	NA	B5TA90	Burkholderia_phage	89.8	1.8e-56
WP_085962362.1|488396_489213_+|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
WP_158335143.1|489138_489570_-	hypothetical protein	NA	B5TA89	Burkholderia_phage	87.2	1.4e-30
WP_167343584.1|489566_489734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127913876.1|489730_489946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015878161.1|489953_490946_-	AAA family ATPase	NA	B5TA81	Burkholderia_phage	92.1	1.0e-172
WP_017432569.1|490955_492581_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	B5TA80	Burkholderia_phage	94.3	2.0e-298
WP_017432570.1|492620_493670_-	hypothetical protein	NA	B5TA79	Burkholderia_phage	74.1	5.3e-135
WP_015878158.1|493666_493858_-	DNA-binding protein	NA	B5TA78	Burkholderia_phage	95.2	1.5e-27
WP_015878157.1|493939_494410_+	helix-turn-helix transcriptional regulator	NA	B5TA77	Burkholderia_phage	87.2	7.2e-68
WP_080569416.1|494464_494998_+	hypothetical protein	NA	B5TA76	Burkholderia_phage	91.5	9.6e-85
WP_015878156.1|495729_496104_+|holin	putative holin	holin	B5TA74	Burkholderia_phage	89.5	1.0e-56
WP_015878155.1|496100_496772_+	transglycosylase SLT domain-containing protein	NA	B5TA73	Burkholderia_phage	78.0	3.3e-98
WP_042967439.1|496768_497230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035978615.1|497558_497849_+	hypothetical protein	NA	B5TA70	Burkholderia_phage	85.3	2.2e-38
WP_012734099.1|498097_499144_-|transposase	IS481-like element IS1419 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	74.2	3.8e-149
>prophage 3
NZ_CP009434	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome II, complete sequence	2820414	613924	629234	2820414	holin,transposase	Leptospira_phage(66.67%)	13	NA	NA
WP_015878077.1|613924_615991_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_015878076.1|616283_617471_+	amidohydrolase	NA	NA	NA	NA	NA
WP_015878075.1|617640_618144_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035979370.1|618165_618975_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_015878073.1|618974_619199_-	ParD-like family protein	NA	NA	NA	NA	NA
WP_015878072.1|620155_621826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012732720.1|622011_622809_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.7	4.4e-33
WP_012732721.1|622801_624307_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_085962356.1|625130_625947_+|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
WP_012732752.1|625975_627532_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.1e-67
WP_012732753.1|627563_627914_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_085962370.1|628037_628843_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_133164453.1|628886_629234_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP009434	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome II, complete sequence	2820414	1165796	1204365	2820414	tRNA,transposase,integrase	Leptospira_phage(18.18%)	32	1171620:1171658	1206257:1206295
WP_015877383.1|1165796_1166843_-|transposase	IS481-like element IS1419 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	74.2	8.4e-149
WP_085962356.1|1167150_1167967_+|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
WP_015877638.1|1168060_1168912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015877637.1|1168908_1170051_-	site-specific DNA-methyltransferase	NA	H9YPF1	environmental_Halophage	34.3	2.5e-45
WP_085962428.1|1170386_1171623_+|transposase	IS3-like element IS1416 family transposase	transposase	Q8W6R2	Burkholderia_virus	94.7	1.9e-155
1171620:1171658	attL	CTTAAACCAACCGGCCTCCACGATTCCCGGTGCGGTTCA	NA	NA	NA	NA
WP_015877636.1|1171663_1172647_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.4	3.9e-23
WP_015877635.1|1172706_1172991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015877634.1|1172987_1173470_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_015877633.1|1174050_1174290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015877632.1|1174820_1176971_+	FUSC family protein	NA	NA	NA	NA	NA
WP_015877631.1|1177152_1177920_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	36.0	2.4e-20
WP_015877630.1|1177921_1180675_+	DNA polymerase I	NA	S5M8J1	Bacillus_phage	29.4	5.9e-69
WP_017423610.1|1180902_1182273_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015877628.1|1182501_1183377_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_017432263.1|1183392_1184262_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_015877626.1|1184365_1185472_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_015877625.1|1185741_1186035_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_015877624.1|1186031_1186916_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_015877623.1|1187001_1188906_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_015877622.1|1189075_1189882_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_015877621.1|1189956_1190997_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	52.6	1.1e-92
WP_015877620.1|1191226_1192444_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006479415.1|1192522_1192735_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015877618.1|1192919_1193366_+	GatB/YqeY domain-containing protein	NA	NA	NA	NA	NA
WP_015877617.1|1193418_1195305_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.4	4.2e-66
WP_015877616.1|1195434_1197852_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.3	2.2e-35
WP_015877615.1|1198276_1199575_-	TniQ family protein	NA	NA	NA	NA	NA
WP_017432261.1|1199571_1199865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012734051.1|1199984_1200461_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012732753.1|1200436_1200787_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_012732752.1|1200818_1202375_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.1e-67
WP_017432186.1|1203129_1204365_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1206257:1206295	attR	TGAACCGCACCGGGAATCGTGGAGGCCGGTTGGTTTAAG	NA	NA	NA	NA
>prophage 5
NZ_CP009434	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome II, complete sequence	2820414	1477467	1525561	2820414	holin,transposase	Streptococcus_phage(33.33%)	41	NA	NA
WP_015877399.1|1477467_1478235_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_015877398.1|1478282_1479281_-	HpnL family protein	NA	NA	NA	NA	NA
WP_015877397.1|1479277_1480087_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_015877396.1|1480083_1480764_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_039205372.1|1481625_1482765_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015877394.1|1482782_1483520_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	41.0	2.0e-48
WP_017432596.1|1483784_1484738_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015877392.1|1484870_1486769_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_015877391.1|1486825_1487872_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026051440.1|1487975_1489328_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_080569399.1|1489499_1489889_-	thermostable hemolysin	NA	NA	NA	NA	NA
WP_017432593.1|1490468_1490633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015877389.1|1490697_1491924_+	cyanate transporter	NA	NA	NA	NA	NA
WP_015877388.1|1492315_1493725_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015877387.1|1494586_1494784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017423687.1|1494855_1495152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085962362.1|1495300_1496118_-|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
WP_039202873.1|1496526_1497300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015877386.1|1497296_1498541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015877385.1|1498558_1499128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015877384.1|1499645_1501493_+	peptidase C11	NA	NA	NA	NA	NA
WP_015877383.1|1502476_1503523_+|transposase	IS481-like element IS1419 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	74.2	8.4e-149
WP_045678740.1|1503993_1508676_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.3	1.7e-52
WP_017432434.1|1508684_1509047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941242.1|1509129_1509507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015877381.1|1509503_1509785_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_015877380.1|1509781_1510279_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015877379.1|1510359_1510857_+	ProQ activator of osmoprotectant transporter prop	NA	NA	NA	NA	NA
WP_015877377.1|1512270_1512582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085962370.1|1512547_1513353_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015877376.1|1514343_1515693_-	allantoin permease	NA	NA	NA	NA	NA
WP_015877375.1|1515914_1516910_-	biotin-dependent carboxyltransferase	NA	NA	NA	NA	NA
WP_015877374.1|1516899_1517775_-	allophanate hydrolase subunit 1	NA	NA	NA	NA	NA
WP_015877373.1|1517771_1519229_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_015877372.1|1519233_1519476_-	biotin carboxyl carrier domain-containing protein	NA	NA	NA	NA	NA
WP_015877371.1|1519498_1520281_-	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_015877370.1|1520539_1521457_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017432591.1|1521496_1521766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015877368.1|1522351_1523506_+	flagellin	NA	NA	NA	NA	NA
WP_085962370.1|1523707_1524512_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_088499487.1|1524744_1525561_+|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP009434	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome II, complete sequence	2820414	1769626	1806918	2820414	transposase,plate	Cronobacter_phage(50.0%)	25	NA	NA
WP_085962370.1|1769626_1770432_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_102952634.1|1771691_1772525_-	putative DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012733896.1|1772571_1773591_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_012733895.1|1773602_1775726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127913901.1|1775878_1776364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733894.1|1776393_1777743_+	DUF2252 family protein	NA	NA	NA	NA	NA
WP_012733893.1|1777820_1778327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733892.1|1778570_1778999_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012733891.1|1779012_1781721_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	7.6e-85
WP_012733890.1|1781858_1782344_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_012733889.1|1782441_1784250_-	OmpA family protein	NA	NA	NA	NA	NA
WP_012733888.1|1784246_1784978_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_012733887.1|1784974_1786327_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_012733886.1|1786822_1787335_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_012733082.1|1787377_1788910_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_045678747.1|1789007_1791368_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017432307.1|1791375_1792329_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_012733882.1|1792380_1795230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012733880.1|1796023_1796275_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_085962364.1|1796561_1797765_+|transposase	IS3-like element ISBugl1 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.4	1.3e-97
WP_050811447.1|1797813_1798869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012733879.1|1798865_1802390_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_012733878.1|1802386_1803973_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_012733877.1|1803985_1805800_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012733876.1|1805796_1806918_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 7
NZ_CP009434	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome II, complete sequence	2820414	2293926	2369816	2820414	transposase,plate	Emiliania_huxleyi_virus(33.33%)	58	NA	NA
WP_012733559.1|2293926_2294304_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012733558.1|2294311_2296162_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_039201514.1|2296170_2297322_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012733556.1|2297318_2299961_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_012733555.1|2299967_2302604_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_012733554.1|2302600_2303671_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_012733553.1|2303670_2304225_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_012733552.1|2304263_2304662_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_012733551.1|2304665_2305136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017423034.1|2305224_2306625_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_012733549.1|2306617_2307397_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_012733548.1|2307422_2311442_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_012733547.1|2311438_2312584_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_017432327.1|2312614_2313733_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_153478680.1|2313773_2314094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017432330.1|2314404_2314740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017425017.1|2314855_2315272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127913860.1|2315330_2315705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017432332.1|2315832_2316111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017425208.1|2316139_2316376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733546.1|2316439_2317411_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_158335145.1|2317916_2318087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017432333.1|2318342_2318819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039201545.1|2319004_2319673_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_039201548.1|2319665_2322458_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_012733543.1|2322454_2324122_-	ATP-dependent DNA ligase	NA	G4YAC1	Emiliania_huxleyi_virus	24.2	1.8e-12
WP_012733542.1|2324118_2325174_-	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_012733541.1|2325498_2326980_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_012733540.1|2327337_2333250_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	37.4	1.6e-183
WP_012733539.1|2333401_2333788_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012733538.1|2333874_2334795_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012733537.1|2335287_2335686_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_012733536.1|2336173_2337976_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.3	7.4e-20
WP_045678824.1|2338661_2340623_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
WP_035982664.1|2341078_2343247_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_012733533.1|2344231_2345893_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_174484817.1|2345889_2347023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733531.1|2347101_2348040_-	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_012733530.1|2348084_2348375_-	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_012733529.1|2348402_2349566_-	muconate cycloisomerase	NA	NA	NA	NA	NA
WP_012733528.1|2349689_2350571_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017433005.1|2350586_2350925_-	DUF2795 domain-containing protein	NA	NA	NA	NA	NA
WP_012733526.1|2350946_2351654_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017423701.1|2351703_2351946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733524.1|2352224_2352722_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_017423699.1|2354223_2354424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045678765.1|2354640_2355837_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_012733522.1|2356409_2357798_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_012733521.1|2358023_2359196_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012733520.1|2359421_2360057_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_035980332.1|2360271_2361186_+	delta(1)-pyrroline-2-carboxylate reductase family protein	NA	NA	NA	NA	NA
WP_012733518.1|2361383_2361566_-	CsbD family protein	NA	NA	NA	NA	NA
WP_017432641.1|2361725_2363303_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012733516.1|2363616_2364621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012733515.1|2364680_2364929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017432642.1|2365699_2365888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088499487.1|2368050_2368868_-|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
WP_085962421.1|2369011_2369816_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP009434	Burkholderia glumae LMG 2196 = ATCC 33617 chromosome II, complete sequence	2820414	2391534	2462491	2820414	holin,transposase	Staphylococcus_phage(20.0%)	57	NA	NA
WP_042967437.1|2391534_2391861_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_127913864.1|2391974_2392844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080763640.1|2392924_2394655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733489.1|2394651_2397330_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	26.2	3.2e-51
WP_085962428.1|2398677_2399915_-|transposase	IS3-like element IS1416 family transposase	transposase	Q8W6R2	Burkholderia_virus	94.7	1.9e-155
WP_035981535.1|2401852_2402098_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_012733486.1|2402813_2403581_+	coniferyl-alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012733485.1|2403618_2405091_+	benzaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012733484.1|2405162_2405996_+	p-hydroxycinnamoyl CoA hydratase/lyase	NA	NA	NA	NA	NA
WP_012733483.1|2406014_2408174_+	acetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_012733482.1|2408227_2408701_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045678769.1|2409055_2410342_+	MFS transporter	NA	NA	NA	NA	NA
WP_012733480.1|2410451_2411531_+	porin	NA	NA	NA	NA	NA
WP_012733479.1|2411954_2412386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733478.1|2412523_2413969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085962356.1|2414043_2414860_+|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
WP_012733477.1|2415243_2416389_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085962364.1|2416950_2418154_+|transposase	IS3-like element ISBugl1 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.4	1.3e-97
WP_017432860.1|2418751_2418889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039200734.1|2419007_2420093_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.6	2.1e-41
WP_012733474.1|2420161_2421142_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.7	8.1e-13
WP_012733473.1|2421249_2422941_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_042967738.1|2422937_2423576_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	42.1	1.1e-34
WP_012733471.1|2423697_2424435_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	33.6	1.3e-10
WP_017432861.1|2425020_2425929_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012733469.1|2426024_2426600_+	DMT family transporter	NA	NA	NA	NA	NA
WP_012733468.1|2426639_2427779_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_045678770.1|2427775_2430868_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	5.9e-49
WP_127913911.1|2430927_2432460_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_035981433.1|2432872_2433097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733464.1|2433265_2434096_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012733462.1|2435245_2436439_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_012733461.1|2436435_2437230_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_012733460.1|2437226_2438129_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_012733459.1|2438151_2439681_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012733458.1|2439764_2441459_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	32.8	2.7e-56
WP_012733457.1|2441544_2442684_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012733456.1|2442808_2443903_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012733455.1|2444074_2444371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127913865.1|2444816_2445245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733454.1|2445243_2446545_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.1	1.3e-63
WP_012733453.1|2446640_2447252_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_012733452.1|2447265_2447553_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_012733451.1|2447991_2449977_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_012733450.1|2450044_2450356_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_012733449.1|2450464_2451736_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_012733448.1|2452090_2452381_+	DUF3331 domain-containing protein	NA	NA	NA	NA	NA
WP_012733447.1|2452828_2453134_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_039200730.1|2453855_2454368_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_035984700.1|2454370_2455336_-	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_012733444.1|2455414_2456344_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_012733443.1|2456422_2457367_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_012733442.1|2457717_2458008_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_039204057.1|2458097_2459042_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_012733440.1|2459130_2460276_-	porin	NA	NA	NA	NA	NA
WP_173941260.1|2460345_2460819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085962362.1|2461673_2462491_-|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP009433	Burkholderia glumae LMG 2196 = ATCC 33617 plasmid pBIN_1, complete sequence	196020	19231	65460	196020	integrase,transposase	Acidithiobacillus_phage(20.0%)	36	34400:34415	67453:67468
WP_012732738.1|19231_20251_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_017924734.1|20540_20678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017433187.1|20726_22277_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.0	3.3e-157
WP_012732736.1|22292_23042_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	61.2	1.8e-81
WP_012732735.1|24326_24782_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012732734.1|24781_25135_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012732733.1|25234_26821_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.1	9.6e-64
WP_158335141.1|27438_27615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012732732.1|27623_32066_-	ATPase AAA	NA	A0A2H4PQV1	Staphylococcus_phage	27.5	8.8e-22
WP_017432396.1|32415_32883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012732731.1|33000_33960_-	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_017432398.1|34117_34345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162486894.1|34344_34542_-	hypothetical protein	NA	NA	NA	NA	NA
34400:34415	attL	CGATCGAGCGCCGGCG	NA	NA	NA	NA
WP_011694493.1|34679_34946_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_127913915.1|35073_36378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017432401.1|36380_37238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017432402.1|37829_38165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012732730.1|38461_39481_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_085962346.1|39605_40423_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.6	4.5e-25
WP_174484815.1|40454_42068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012732728.1|42052_42556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017432285.1|42552_43599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012732726.1|43793_45224_-|transposase	ISKra4-like element ISBugl3 family transposase	transposase	NA	NA	NA	NA
WP_012732724.1|47142_48726_-	CHASE3 domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.6	1.5e-11
WP_017432531.1|49208_49553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012732723.1|49592_51290_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.0	5.4e-12
WP_012732721.1|53310_54816_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.9	1.4e-16
WP_012732720.1|54808_55606_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.7	4.4e-33
WP_012732719.1|56274_56685_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_012732718.1|57055_58408_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_012732717.1|58777_59506_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	32.4	2.3e-20
WP_012732716.1|59551_60001_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_102952636.1|60146_60632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012732713.1|62197_62623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085962419.1|62797_63614_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012732711.1|63624_65460_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
67453:67468	attR	CGATCGAGCGCCGGCG	NA	NA	NA	NA
>prophage 1
NZ_CP009432	Burkholderia glumae LMG 2196 = ATCC 33617 plasmid pBIN_2, complete sequence	144522	0	9309	144522	transposase	Bacillus_phage(100.0%)	3	NA	NA
WP_012734100.1|2698_3334_+	FMN reductase	NA	NA	NA	NA	NA
WP_085962362.1|3529_4346_+|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
WP_012734102.1|7536_9309_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.7	5.4e-07
>prophage 2
NZ_CP009432	Burkholderia glumae LMG 2196 = ATCC 33617 plasmid pBIN_2, complete sequence	144522	25791	98535	144522	transposase,integrase	Leptospira_phage(23.53%)	72	52182:52198	76885:76901
WP_012732705.1|25791_27030_-	AAA family ATPase	NA	A0A240F4U1	Ochrobactrum_phage	29.3	1.4e-30
WP_035977131.1|28319_31301_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.5	8.1e-80
WP_012732800.1|31590_31881_+	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_102952662.1|31939_32743_-	DUF547 domain-containing protein	NA	NA	NA	NA	NA
WP_102952661.1|32739_34137_-	radical SAM protein	NA	NA	NA	NA	NA
WP_012732797.1|34315_35143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012732796.1|35238_36258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012732795.1|36269_37253_-	arsenosugar biosynthesis radical SAM protein ArsS	NA	NA	NA	NA	NA
WP_012732794.1|37469_38426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012732793.1|38579_38966_+	thioredoxin family protein	NA	A0A2R3ZRK1	Marseillevirus	35.0	4.9e-06
WP_045678673.1|38947_39694_+	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_012732791.1|39739_40366_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012732790.1|40359_40569_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_012732789.1|40633_42007_+	MFS transporter	NA	NA	NA	NA	NA
WP_012732788.1|42121_42391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012732787.1|42491_43214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012732786.1|43210_44092_+	S-methyl-5'-thioadenosine phosphorylase	NA	NA	NA	NA	NA
WP_017432756.1|44199_44901_+	TIGR04283 family arsenosugar biosynthesis glycosyltransferase	NA	NA	NA	NA	NA
WP_012732784.1|44909_45566_+	TIGR04282 family arsenosugar biosynthesis glycosyltransferase	NA	NA	NA	NA	NA
WP_012732783.1|45562_46654_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017432758.1|46654_47014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158335138.1|47089_47290_-	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_012732781.1|47364_49575_-	bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	3.7e-37
WP_012732780.1|49576_50044_-	DoxX family protein	NA	NA	NA	NA	NA
WP_012732779.1|50070_50847_-	putative DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012732778.1|50830_51733_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_012732777.1|51740_51992_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
52182:52198	attL	GCCCACCATCACCGCCA	NA	NA	NA	NA
WP_012732776.1|52259_52952_+	haloacid dehalogenase type II	NA	NA	NA	NA	NA
WP_012732775.1|53053_53626_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012732774.1|53717_54299_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_102952665.1|54372_54966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012732772.1|55129_55894_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_012732771.1|55943_56399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012732770.1|56776_57346_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012732769.1|57348_58005_+	DUF1109 family protein	NA	NA	NA	NA	NA
WP_012732768.1|58116_58437_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_012732767.1|58452_59346_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_012732766.1|59329_60115_+	putative DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012732765.1|60140_60611_+	DoxX family protein	NA	NA	NA	NA	NA
WP_012732764.1|60718_61159_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_012732763.1|61443_61854_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_012732762.1|62011_62434_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_012732760.1|64215_65907_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_088499482.1|66014_67484_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.9	6.6e-67
WP_012732753.1|67515_67866_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_012734051.1|67841_68318_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_045678674.1|68650_69019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043308431.1|69149_69929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158335139.1|70192_70798_-	hypothetical protein	NA	E5E3S8	Burkholderia_phage	34.7	4.2e-20
WP_012734095.1|71144_71450_-	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	46.5	1.1e-16
WP_042968082.1|72330_72540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127913983.1|73176_73488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012734094.1|73614_75456_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012734093.1|75452_75833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017433735.1|75867_76185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039203971.1|76247_76658_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_012734091.1|76648_76903_-	antitoxin	NA	NA	NA	NA	NA
76885:76901	attR	TGGCGGTGATGGTGGGC	NA	NA	NA	NA
WP_085962428.1|77953_79190_+|transposase	IS3-like element IS1416 family transposase	transposase	Q8W6R2	Burkholderia_virus	94.7	1.9e-155
WP_012734082.1|79300_81148_-	peptidase C11	NA	NA	NA	NA	NA
WP_124837819.1|81243_82731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085962370.1|83429_84234_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.1	1.1e-28
WP_017423070.1|85290_86028_+	response regulator	NA	NA	NA	NA	NA
WP_012734079.1|86247_87027_+	response regulator	NA	W8CYM9	Bacillus_phage	33.1	4.8e-16
WP_158335140.1|87176_89711_+	response regulator	NA	Q6XLV6	Feldmannia_irregularis_virus	25.4	4.9e-17
WP_012732752.1|90101_91658_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.1e-67
WP_012732753.1|91689_92040_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_012734051.1|92015_92492_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_017433349.1|92555_93494_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	32.3	9.2e-22
WP_012734052.1|94363_94762_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_012734053.1|94843_95785_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012732871.1|96415_97282_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	44.1	2.8e-49
WP_017432522.1|97278_98535_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	33.0	7.7e-48
>prophage 3
NZ_CP009432	Burkholderia glumae LMG 2196 = ATCC 33617 plasmid pBIN_2, complete sequence	144522	103113	139039	144522	transposase,integrase	Mycobacterium_phage(22.22%)	30	103020:103079	130719:132018
103020:103079	attL	TGGAGCAGCCCCCTGAAACACCGGACACAGTCACCCACTTACAATAACGGGTAGGCATAA	NA	NA	NA	NA
WP_085962358.1|103113_104317_+|transposase	IS3-like element IS1417 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.1	1.0e-97
WP_088499481.1|104426_105663_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.6	5.3e-102
WP_012734061.1|106062_107109_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	73.9	1.7e-149
WP_124837731.1|107821_108016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127913981.1|108085_108388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012734062.1|108451_108694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017433216.1|108706_108970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012734063.1|108981_109302_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_012734064.1|109295_109544_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012734065.1|109655_110327_-|integrase	site-specific integrase	integrase	A0A1W6DWU1	Sphingobium_phage	30.0	1.1e-11
WP_017425259.1|110451_110742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102952664.1|110781_112335_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	34.4	3.6e-07
WP_012734068.1|113331_114015_+	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	32.3	3.3e-05
WP_035976812.1|114087_114903_+	sulfotransferase	NA	NA	NA	NA	NA
WP_012734070.1|115434_116730_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	30.4	6.5e-18
WP_045678676.1|117088_118108_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_085962447.1|118310_119127_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.6	1.3e-24
WP_012734073.1|119472_120024_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_012732724.1|121541_123125_-	CHASE3 domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.6	1.5e-11
WP_017432531.1|123607_123952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012732723.1|123991_125689_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.0	5.4e-12
WP_012734074.1|125865_127590_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.9	5.1e-10
WP_080569430.1|127808_128297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085962370.1|128667_129472_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.1	1.1e-28
WP_085962358.1|129479_130684_-|transposase	IS3-like element IS1417 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.1	1.0e-97
WP_085962346.1|131343_132160_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.6	4.5e-25
130719:132018	attR	TTATGCCTACCCGTTATTGTAAGTGGGTGACTGTGTCCGGTGTTTCAGGGGGCTGCTCCACGAAGCAAGTCGCGCTGCTGGCGTTGGCGAGTCGGTTGCAACCCGTACAGTTACAAATGGACCTGGATCTCGCGAACGCTCATGCCGCGTGCACACACGCTGATCACGTGGTCGTCGAAGGCCGGCAACTGACGGTGGTAGTTGCCGACCGACTGCGGATATAAGGCCGGTGGGCGGCGAGATCGTCTTGTGGCGCGTACCATTGCGGTGGTTCGGCCCTGTCTTGCTCGGTCTCGGCTTCCAGATAGTGCTTCAACTCGGTCGTGAGCATGTGCTCAGCCAGCGGCTTCTTTACCTGGTCGACCAGCCCGATTCACACAGGATCGACTCGGTATCCTTGCTCGAAACCTGGGCAATCAACTGATCGGCGATTTCATCGTGGAACAGTCTCTGCGCCTTCGGACGGTTGCTCTTGGTCACTGTTGCAACGGTCATCGGACATCAGTTCATTCATCATCTCATGACCCCAGTACGCTAAGAGGCCAGTTCAAAAACTCCCGAGAGGGGCTGTTTACTTCCTCGGCAAGCTGTTAACCTTGGGCATCAGAACAACGGAAGTCCAAGGATGGAAGCGCCAATCATTGACGACGAACTGTGGATACTGATCGAACCATTGCTGCCACCTGCGAAGCTTCGAGCGAAGAGCGATCCTGGTCGCCCGCGCGTGTCCGACCGTGCGGCTCTCAACGGCATCCTGTTCGTGTTCAAAACGGGAATTCGTTGGAACCACTTGCCGACTCGTCTGGGCTTTGGCTCGGGCGCCACATGCTGGCGGCGATTGAGCGACTGGCAAAAGGCTGGTGTATGGGACCAACTGCACGAGTTGCTTCTCGACAAGTTGCGTGCGGCCGGCCAAATCGATCTGTCATACGCTGCGGTCGATTCGTCGTCCGTGCGCGCCGTTGGGGCGGGCGAAAAACTGGCCCGAACCCCACCGATCGCGCGCGACCCGGTTCCAAGCACCACGTCCTCGTAGACGCCAACGGCGTTCCTCTCGTTGCGATCCTGACTGGCGCGAACACCAACGACGTCACGCAGTTGCTGCCGCTCGTTGATGCGATTCCACCCATTCGCGGCGTTCGTGGCCGACCGCTTCAGAAGCCCGGCGTCGTCTACGCCGATCGTGGCTACGATTCCACCCGACATCGTCGCGCGTTGCGCGAACGCGGTATCAAGCCCGTGATCGCCAAGCGCCGGACCGAGCATGGCAGTGGTCTGGGCAAGTATCGTTGGGTAGTCG	NA	NA	NA	NA
WP_012734076.1|132978_134538_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.6	5.1e-41
WP_045678678.1|135765_136812_-|transposase	IS481-like element IS1419 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	74.2	3.8e-149
WP_012732753.1|137100_137451_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_012732752.1|137482_139039_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.1e-67
>prophage 4
NZ_CP009432	Burkholderia glumae LMG 2196 = ATCC 33617 plasmid pBIN_2, complete sequence	144522	142895	143942	144522	transposase	Mannheimia_phage(100.0%)	1	NA	NA
WP_012734099.1|142895_143942_+|transposase	IS481-like element IS1419 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	74.2	3.8e-149
