The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_HF572917	Escherichia coli strain HUSEC2011	5277676	195811	258137	5277676	protease,tRNA,plate,transposase	Emiliania_huxleyi_virus(12.5%)	51	NA	NA
WP_001346129.1|195811_197164_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|197193_199626_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|199747_200233_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|200236_201262_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|201366_201822_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|201825_202614_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|202613_203762_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|203758_204355_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|204391_207874_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|207886_208846_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|208944_211086_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|211142_211532_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|211596_212895_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|212943_213204_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|213190_213391_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|213556_214102_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|214098_214521_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239154.1|214534_215245_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|215494_216475_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260716.1|217554_219273_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|219384_220092_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|220088_220493_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|220610_221426_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|221465_222119_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|222111_223143_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140174.1|223330_223903_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997043.1|229800_230604_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_000648601.1|230600_231515_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|231755_232556_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211710.1|232633_233404_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|233451_234810_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052751.1|234881_235637_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001298887.1|235670_236393_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917888.1|236389_236857_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|236921_237653_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|238188_238974_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|239110_239590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|239599_240514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284200.1|240557_241040_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|241063_242416_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_122987046.1|242426_245861_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240544.1|245969_247385_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088873.1|247389_248133_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614396.1|248129_250889_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	9.4e-83
WP_000343303.1|250897_251659_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246421.1|251663_252995_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|252997_253522_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|253518_254799_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|254823_255906_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393853.1|255869_257720_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611748.1|257723_258137_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_HF572917	Escherichia coli strain HUSEC2011	5277676	826212	868646	5277676	capsid,integrase,portal,lysis,tail,head	Enterobacteria_phage(58.82%)	55	824490:824505	847641:847656
824490:824505	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000533642.1|826212_827283_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|827260_827479_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|827518_827686_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000120064.1|827928_828531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763367.1|828741_828963_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000188870.1|829061_829277_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548541.1|829353_829545_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	4.7e-26
WP_000682318.1|829517_829700_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186833.1|829696_830377_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|830373_831159_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995433.1|831164_831461_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|831536_831743_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|832340_833030_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|833135_833366_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|833435_833975_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_000147903.1|833971_834991_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	9.7e-110
WP_000788812.1|834987_835689_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145901.1|835685_835988_+	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
WP_000338663.1|837139_837379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001391403.1|837955_838207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072147432.1|838303_838405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053034.1|838401_838857_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_000224912.1|838856_839027_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_000774504.1|839019_839310_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000971074.1|839664_839805_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|839890_840274_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737263.1|840462_841545_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_000839596.1|842133_842349_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135297.1|842348_842846_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
WP_000092234.1|842842_843280_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
WP_001028465.1|843484_844006_+	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000079508.1|844355_844766_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|844822_845056_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453580.1|845444_845990_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_000198149.1|847885_848092_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
847641:847656	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_001316944.1|848088_849690_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000123216.1|849670_850990_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.4e-230
WP_001299443.1|850999_851332_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063238.1|851387_852413_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_000158875.1|852454_852850_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|852861_853215_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|853226_853805_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|853801_854197_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001390429.1|854204_854945_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
WP_000479200.1|854960_855383_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	1.4e-59
WP_000459457.1|855364_855799_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840297.1|855791_858353_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.8	0.0e+00
WP_000847379.1|858349_858679_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152576.1|858678_859377_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
WP_000140717.1|859382_860126_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.1e-146
WP_000090917.1|860062_860695_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515639.1|860755_864253_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
WP_001233090.1|864323_864923_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_001387657.1|864987_868062_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_000885623.1|868061_868646_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	9.2e-105
>prophage 3
NZ_HF572917	Escherichia coli strain HUSEC2011	5277676	1133564	1196942	5277676	capsid,portal,bacteriocin,lysis,tail,terminase,holin	Escherichia_phage(93.06%)	73	NA	NA
WP_000013658.1|1133564_1134875_-	DUF3596 domain-containing protein	NA	A0A0P0ZGA8	Escherichia_phage	100.0	9.2e-254
WP_001208773.1|1134927_1135212_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000497815.1|1135257_1135509_-	DUF4222 domain-containing protein	NA	G9L6F5	Escherichia_phage	100.0	8.4e-39
WP_000994790.1|1135873_1136227_-	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	100.0	3.5e-59
WP_001291842.1|1136262_1136475_-	DUF1382 family protein	NA	A0A0P0ZG72	Escherichia_phage	100.0	2.7e-30
WP_000163446.1|1136434_1137061_-	adenine methylase	NA	A0A0P0ZG10	Escherichia_phage	100.0	8.0e-123
WP_000809302.1|1137057_1137489_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000203831.1|1137544_1138183_-	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	100.0	4.2e-119
WP_000206786.1|1138538_1139435_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	100.0	5.4e-173
WP_001014298.1|1139437_1139629_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000034212.1|1139630_1140038_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_000206047.1|1140034_1140760_-	ead/Ea22-like family protein	NA	A0A0P0ZFU9	Escherichia_phage	100.0	3.3e-128
WP_001159715.1|1140910_1141306_-	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
WP_000080417.1|1141382_1142204_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001071603.1|1142267_1142615_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000344637.1|1142689_1143277_-	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_000187063.1|1143276_1143966_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000459721.1|1143962_1144913_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000995345.1|1144929_1145211_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000934197.1|1145231_1145513_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000917252.1|1145524_1145737_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_001369605.1|1145807_1146482_-	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
WP_016051777.1|1146737_1147523_-	Rha family phage regulatory protein	NA	A0A0P0ZG86	Escherichia_phage	100.0	9.4e-145
WP_001064714.1|1148139_1149093_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|1149089_1150559_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|1150653_1151367_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|1151462_1151666_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001369601.1|1151836_1152031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|1152197_1152575_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913116.1|1152568_1154089_+	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001260358.1|1154078_1155050_+	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000402092.1|1155049_1155499_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_000813671.1|1155506_1156070_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000144767.1|1156066_1156261_+	phage NinH family protein	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001204859.1|1156253_1156688_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_001356551.1|1156936_1157089_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|1157471_1158431_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|1158442_1158712_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874432.1|1159197_1161135_+	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	100.0	0.0e+00
WP_000143458.1|1161271_1161451_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1161491_1161737_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|1161814_1162030_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087737.1|1162034_1162568_+	lysozyme	NA	A0A0P0ZGA2	Escherichia_phage	100.0	5.1e-102
WP_001056879.1|1162841_1163411_+	hypothetical protein	NA	A0A0N7KZV8	Escherichia_phage	100.0	1.8e-105
WP_000455397.1|1163410_1163560_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	100.0	4.8e-18
WP_024017835.1|1163562_1164000_+|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	100.0	1.4e-70
WP_001109019.1|1164202_1164754_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_001086073.1|1165046_1165853_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143988.1|1165833_1167540_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787034.1|1167539_1169684_+|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|1169841_1170849_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1170872_1172087_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1172142_1172532_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001367376.1|1172581_1173043_+	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_000829200.1|1173026_1173590_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207927.1|1173589_1174240_+	hypothetical protein	NA	A0A0P0ZGL1	Escherichia_phage	100.0	4.6e-121
WP_000117967.1|1174236_1176429_+|tail	tail fiber protein	tail	A0A0H4IU95	Shigella_phage	98.0	1.9e-86
WP_000513231.1|1176515_1177028_+	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
WP_001391593.1|1177261_1178887_+	hypothetical protein	NA	A0A0P0ZG21	Escherichia_phage	100.0	0.0e+00
WP_000197192.1|1178883_1180152_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|1180166_1180445_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|1180450_1181068_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|1181158_1181893_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|1182125_1182266_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1182322_1182724_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509489.1|1182817_1183474_+	hypothetical protein	NA	A0A0P0ZGB7	Escherichia_phage	100.0	2.4e-109
WP_000455649.1|1183476_1183923_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540391.1|1183932_1184184_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012452.1|1184194_1185460_+	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	100.0	2.4e-206
WP_000331685.1|1185529_1193911_+	hypothetical protein	NA	A0A0P0ZFK4	Escherichia_phage	100.0	0.0e+00
WP_001273658.1|1194842_1195016_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001326838.1|1195098_1196427_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001028096.1|1196447_1196942_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 4
NZ_HF572917	Escherichia coli strain HUSEC2011	5277676	1510570	1572040	5277676	capsid,integrase,portal,protease,tail,terminase,head,holin	Enterobacteria_phage(42.31%)	74	1506386:1506400	1527325:1527339
1506386:1506400	attL	AAACAAGAACACGGT	NA	NA	NA	NA
WP_000113686.1|1510570_1511701_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	4.4e-103
WP_000113189.1|1511678_1511927_-	excisionase	NA	NA	NA	NA	NA
WP_000048530.1|1511991_1514463_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.2	1.8e-56
WP_001090200.1|1514555_1514747_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1514743_1514932_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_012601410.1|1515426_1515693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394541.1|1515681_1516020_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_000379548.1|1516031_1516184_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000233320.1|1516480_1516900_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|1516979_1517234_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693888.1|1517230_1517656_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|1517678_1518641_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_001151211.1|1518681_1519107_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_000150294.1|1519281_1519947_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|1520127_1520340_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|1520507_1520780_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265083.1|1520781_1521828_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.9e-110
WP_000904106.1|1521840_1522215_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.8e-36
WP_000762880.1|1522211_1523033_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917746.1|1523259_1523457_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	96.9	1.4e-28
WP_000935536.1|1523607_1524657_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_001438304.1|1525455_1525587_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_000871291.1|1525867_1526203_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874307.1|1526463_1528317_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
1527325:1527339	attR	AAACAAGAACACGGT	NA	NA	NA	NA
WP_000284510.1|1528467_1528683_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731197.1|1528687_1529494_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	94.8	3.3e-145
WP_001092853.1|1529536_1530070_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	8.7e-102
WP_032159578.1|1530624_1530711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001228710.1|1530932_1531139_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	95.6	2.9e-29
WP_001390467.1|1531167_1531320_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	2.8e-21
WP_000343118.1|1531398_1531686_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	58.9	4.0e-29
WP_000240372.1|1532139_1532544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867569.1|1532944_1533493_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001390573.1|1533464_1535393_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	1.6e-262
WP_000259002.1|1535376_1535583_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001387697.1|1535579_1537172_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_001253926.1|1537161_1538667_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.8	3.0e-99
WP_000256823.1|1538703_1539051_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522596.1|1539108_1540137_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
WP_000201506.1|1540188_1540557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204198.1|1540549_1540903_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
WP_000974999.1|1540917_1541493_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	9.2e-49
WP_000683079.1|1541489_1541885_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235040.1|1541892_1542645_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	6.7e-132
WP_000479095.1|1542658_1543090_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|1543116_1543530_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082359.1|1543510_1546084_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
WP_000847379.1|1546080_1546410_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152522.1|1546409_1547108_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140761.1|1547112_1547856_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	1.8e-145
WP_000090879.1|1547792_1548395_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|1548468_1548807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515776.1|1548873_1552353_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001228314.1|1552420_1553020_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_000216502.1|1553171_1556006_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	59.1	5.7e-83
WP_000885576.1|1556005_1556590_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.7e-103
WP_000240999.1|1556644_1557313_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000926528.1|1557369_1557639_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_000251936.1|1557753_1557924_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079509.1|1558412_1558919_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1558964_1559465_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1559550_1559730_-	general stress protein	NA	NA	NA	NA	NA
WP_000443069.1|1560110_1560917_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1560916_1562110_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983912.1|1562121_1563483_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|1563483_1565079_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194599.1|1565078_1566641_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001386774.1|1566732_1566777_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1566914_1567796_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1567792_1568413_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1568513_1569386_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|1569425_1570016_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559283.1|1570012_1570771_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_000422045.1|1570990_1572040_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NZ_HF572917	Escherichia coli strain HUSEC2011	5277676	1859888	1926860	5277676	capsid,portal,integrase,lysis,tail,terminase,holin	Shigella_phage(43.48%)	77	1902351:1902368	1930401:1930418
WP_000041536.1|1859888_1862315_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.3e-213
WP_001342404.1|1862375_1864799_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000184488.1|1865330_1865966_+	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	81.0	2.8e-91
WP_000763355.1|1866013_1866235_+	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	98.6	2.9e-35
WP_000020909.1|1866231_1866516_+	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	98.9	6.1e-46
WP_001290012.1|1866502_1867339_+	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	87.7	6.1e-126
WP_000628768.1|1867852_1868356_+	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	98.2	2.6e-95
WP_000481378.1|1868357_1868633_-	hypothetical protein	NA	A0A088CD78	Shigella_phage	89.3	4.0e-18
WP_000331660.1|1868756_1877108_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.8	0.0e+00
WP_000012439.1|1877176_1878442_-	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	95.0	1.5e-192
WP_000540395.1|1878452_1878704_-	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	97.5	7.9e-13
WP_000455643.1|1878713_1879160_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	100.0	4.0e-76
WP_000509022.1|1879162_1879819_-	hypothetical protein	NA	A0A0H4IPM7	Shigella_phage	99.1	7.4e-103
WP_001387532.1|1879910_1880312_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	98.5	5.0e-70
WP_000078908.1|1880368_1880509_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	97.8	2.0e-18
WP_000836186.1|1880743_1881481_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	80.8	1.2e-109
WP_001390575.1|1881560_1882178_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	6.3e-120
WP_000455633.1|1882183_1882462_-	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_000038927.1|1882476_1883745_-	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	94.3	1.6e-218
WP_001146337.1|1883741_1885367_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	96.7	0.0e+00
WP_000276176.1|1885707_1885935_-	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	98.7	2.6e-39
WP_000537686.1|1885947_1886493_-	hypothetical protein	NA	A0A088CD67	Shigella_phage	99.4	2.0e-93
WP_000117962.1|1886575_1888483_-|tail	tail fiber protein	tail	V5USF3	Shigella_phage	66.0	4.2e-82
WP_000207910.1|1888479_1889130_-	hypothetical protein	NA	A0A2L1IV63	Escherichia_phage	99.1	1.5e-119
WP_000829400.1|1889129_1889693_-	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	99.5	8.3e-103
WP_001290749.1|1889676_1890138_-	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	99.3	6.9e-71
WP_001140435.1|1890188_1890578_-	hypothetical protein	NA	V5UT93	Shigella_phage	97.7	1.9e-61
WP_000214480.1|1890632_1891847_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2L1IV46	Escherichia_phage	99.0	1.8e-232
WP_000344999.1|1891869_1892877_-	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	93.4	1.2e-168
WP_000787512.1|1893034_1895179_-|portal	portal protein	portal	A0A088CE71	Shigella_phage	99.6	0.0e+00
WP_001387707.1|1895178_1896885_-|terminase	terminase	terminase	A0A2L1IV76	Escherichia_phage	99.1	0.0e+00
WP_001086085.1|1896865_1897681_-|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	99.6	6.6e-125
WP_000934362.1|1898283_1898865_+	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	100.0	6.7e-47
WP_001082713.1|1898945_1899404_-|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	99.3	6.4e-77
WP_000675931.1|1899405_1899519_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_000087450.1|1899739_1900273_-	lysozyme	NA	A0A088CC28	Shigella_phage	91.5	5.6e-93
WP_000284506.1|1900277_1900493_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290236.1|1900569_1900815_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000142783.1|1900840_1901023_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	91.7	1.6e-23
WP_000874468.1|1901161_1903072_-	SASA family carbohydrate esterase	NA	A0A0N7CGH9	Escherichia_phage	74.8	6.4e-280
1902351:1902368	attL	AACAGCACATTTTTCGGG	NA	NA	NA	NA
WP_001204886.1|1903837_1904272_-	antitermination protein	NA	G9L695	Escherichia_phage	98.6	2.4e-81
WP_000992060.1|1904264_1904459_-	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001008115.1|1904458_1904821_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	98.3	9.2e-63
WP_000002252.1|1904817_1905108_-	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	96.9	9.3e-50
WP_001254268.1|1905131_1905323_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	87.7	8.9e-25
WP_001076834.1|1905319_1905730_-	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	98.5	3.9e-70
WP_000211990.1|1905784_1906456_-	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	82.6	9.0e-96
WP_000042397.1|1907162_1907480_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000818160.1|1907530_1908016_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119356.1|1908034_1908214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887482.1|1908423_1908636_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	62.9	8.4e-16
WP_001278450.1|1908824_1908929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206792.1|1909044_1909629_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001118163.1|1909685_1910081_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	52.9	2.0e-31
WP_000450864.1|1910096_1910867_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	82.4	8.1e-109
WP_000790392.1|1910892_1911633_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	87.4	2.3e-121
WP_001390256.1|1911639_1912722_-	hypothetical protein	NA	V5URT9	Shigella_phage	96.4	2.8e-200
WP_000438870.1|1912742_1912961_-	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_000438525.1|1912975_1913272_-	hypothetical protein	NA	A0A088CBI6	Shigella_phage	98.0	3.4e-47
WP_000437871.1|1913410_1913611_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
WP_001274758.1|1913711_1914425_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.6	4.1e-131
WP_001074607.1|1914471_1915014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528776.1|1915001_1915778_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000198438.1|1916272_1916656_+	antitermination protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
WP_000211196.1|1916659_1917373_+	hypothetical protein	NA	A0A088CC14	Shigella_phage	98.7	1.8e-126
WP_001005963.1|1917404_1917764_+	hypothetical protein	NA	A0A088CBI5	Shigella_phage	72.6	2.3e-37
WP_000189936.1|1917732_1917942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560214.1|1918398_1918620_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	94.4	1.1e-34
WP_000660961.1|1918703_1919090_+	hypothetical protein	NA	V5USC5	Shigella_phage	78.9	9.5e-50
WP_001271588.1|1919197_1921270_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	87.4	0.0e+00
WP_000995032.1|1921266_1921563_+	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
WP_000100829.1|1921568_1922354_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
WP_000186868.1|1922350_1923031_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	98.2	1.5e-130
WP_000497813.1|1923078_1923330_+	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
WP_001387389.1|1923591_1924755_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
WP_000526492.1|1925348_1926203_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1926245_1926860_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
1930401:1930418	attR	AACAGCACATTTTTCGGG	NA	NA	NA	NA
>prophage 6
NZ_HF572917	Escherichia coli strain HUSEC2011	5277676	2054265	2112845	5277676	capsid,portal,integrase,plate,tail,transposase,tRNA,terminase,head,holin	Enterobacteria_phage(77.55%)	71	2050258:2050274	2102465:2102481
2050258:2050274	attL	GAGCTGGCGCGCAAATT	NA	NA	NA	NA
WP_000029466.1|2054265_2055015_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154183.1|2055014_2055566_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956518.1|2055628_2056609_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_000416308.1|2056798_2057194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247218.1|2057204_2058140_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.5	4.8e-79
WP_000094527.1|2058228_2058540_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_000163908.1|2058631_2058910_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000917807.1|2058924_2059263_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	2.2e-50
WP_000159452.1|2059273_2059561_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.9	2.7e-33
WP_000514277.1|2059572_2059815_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021658.1|2059811_2059925_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.4e-09
WP_001038613.1|2060013_2060334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985715.1|2060323_2060527_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	94.0	3.4e-30
WP_000153687.1|2060523_2060769_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	87.7	8.4e-36
WP_000104300.1|2060765_2061065_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	6.2e-41
WP_157847544.1|2061076_2061694_+	ash family protein	NA	S5MQL6	Escherichia_phage	49.4	1.5e-09
WP_000564228.1|2061690_2062080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272076.1|2062076_2064917_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.4	0.0e+00
WP_000686540.1|2064993_2065953_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.3e-180
WP_000211292.1|2065957_2066272_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_000201251.1|2066291_2066723_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	43.3	4.7e-21
WP_000224219.1|2066724_2066988_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	1.1e-30
WP_000087812.1|2067499_2068546_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613796.1|2068545_2070297_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_001262665.1|2070451_2071288_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.8e-149
WP_001055094.1|2071311_2072364_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_000632318.1|2072409_2073210_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063103.1|2073311_2073806_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864897.1|2073805_2074006_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|2074008_2074332_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072317.1|2074328_2074721_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	6.4e-70
WP_000780558.1|2074717_2075125_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.2e-63
WP_000202135.1|2075263_2077144_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	3.8e-301
WP_000921128.1|2077167_2077635_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.1	2.1e-83
WP_000356370.1|2077627_2078263_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	5.3e-114
WP_001342219.1|2078274_2078841_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.3	2.5e-99
WP_001067548.1|2078858_2079188_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111965.1|2079191_2080088_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
WP_000071739.1|2080080_2080611_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108557.1|2080613_2082746_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	1.2e-130
WP_000144016.1|2082745_2083324_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_000954195.1|2083367_2083940_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979946.1|2084096_2084585_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_001390260.1|2084597_2087405_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_000333498.1|2087391_2087547_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.3e-22
WP_000665305.1|2087555_2087921_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
WP_000290443.1|2087975_2088488_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_000005414.1|2088487_2089672_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	3.8e-222
WP_000132828.1|2089829_2090939_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	3.7e-195
WP_000965749.1|2091030_2092113_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000019440.1|2092457_2093438_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_000488099.1|2093631_2093892_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2094082_2094223_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|2094524_2094824_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|2094828_2097216_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|2097230_2098214_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2098496_2098541_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2098663_2099020_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2099072_2099270_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2099366_2099909_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144190.1|2099912_2101841_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
WP_001142445.1|2104438_2104546_+	hypothetical protein	NA	NA	NA	NA	NA
2102465:2102481	attR	AATTTGCGCGCCAGCTC	NA	NA	NA	NA
WP_000771396.1|2104598_2105357_-	YdiY family protein	NA	NA	NA	NA	NA
WP_000251735.1|2105643_2106573_+	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000146159.1|2106673_2106964_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000267645.1|2107069_2107930_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000222172.1|2107970_2108507_-	YniB family protein	NA	NA	NA	NA	NA
WP_000106834.1|2108653_2109322_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_001295408.1|2109484_2110075_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001010722.1|2110207_2111599_+	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_000019440.1|2111864_2112845_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
>prophage 7
NZ_HF572917	Escherichia coli strain HUSEC2011	5277676	2213944	2304827	5277676	capsid,portal,protease,tail,tRNA,terminase,head,holin	Enterobacteria_phage(34.78%)	108	NA	NA
WP_000984517.1|2213944_2214826_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|2215017_2217066_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|2217085_2217784_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2217880_2218378_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207283.1|2218507_2219791_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001297532.1|2219759_2222393_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057022.1|2222472_2223912_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2224029_2224266_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|2224370_2224562_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812712.1|2224562_2225219_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_000976472.1|2225614_2225956_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|2225968_2226841_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|2226844_2227219_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2227357_2227588_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|2227689_2228346_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2228369_2229032_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936951.1|2229028_2231089_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|2231297_2231957_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|2232283_2232640_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|2232706_2232997_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173474.1|2233130_2234309_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|2234364_2235006_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|2235042_2236854_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301720.1|2237088_2238564_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001056706.1|2238901_2239771_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091176.1|2239898_2241341_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|2241471_2242443_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2242562_2243885_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|2243900_2244833_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2244911_2245667_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|2245663_2246449_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2246595_2247606_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2247614_2248226_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|2248364_2248430_-	stress response small protein YobI	NA	NA	NA	NA	NA
WP_001024930.1|2248500_2249103_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2249104_2249626_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|2249660_2250401_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077221229.1|2250429_2250882_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|2250874_2252647_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891610.1|2252956_2253523_+	hydrolase	NA	NA	NA	NA	NA
WP_001217553.1|2253877_2254126_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_071827722.1|2254261_2254522_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000227779.1|2254664_2255273_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	44.7	2.2e-37
WP_050033886.1|2255281_2256685_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	92.2	8.0e-54
WP_001228314.1|2256836_2257436_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_000515718.1|2257503_2260899_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_000090891.1|2260959_2261592_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000140762.1|2261528_2262272_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_001152522.1|2262276_2262975_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847391.1|2262974_2263304_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	90.8	8.7e-52
WP_000081812.1|2263300_2265913_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.1	0.0e+00
WP_000533444.1|2265893_2266307_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.2	2.1e-42
WP_000479035.1|2266333_2266756_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.1	1.1e-70
WP_000235108.1|2266769_2267522_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.5e-133
WP_000683079.1|2267529_2267925_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000975010.1|2267921_2268497_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
WP_001204556.1|2268511_2268865_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000201501.1|2268857_2269241_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522601.1|2269292_2270321_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.1e-113
WP_000256823.1|2270378_2270726_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253973.1|2270762_2272268_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.3e-99
WP_000831738.1|2272257_2273850_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	4.2e-184
WP_000259002.1|2273846_2274053_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001390579.1|2274036_2275965_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
WP_000867568.1|2275936_2276485_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001329960.1|2276879_2277065_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347013.1|2277197_2277338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071587457.1|2277750_2277936_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	9.9e-21
WP_001280932.1|2278158_2278290_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_001151822.1|2278304_2278487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092910.1|2278643_2279177_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.6	1.1e-101
WP_000551290.1|2279305_2279620_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	100.0	4.7e-55
WP_000731196.1|2279629_2280436_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	99.6	4.8e-152
WP_000284510.1|2280440_2280656_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000874354.1|2280806_2282660_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	90.6	0.0e+00
WP_000935520.1|2283451_2284501_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	91.4	3.1e-188
WP_000917724.1|2284652_2284856_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000868396.1|2285120_2286047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131905.1|2286033_2286582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|2286594_2286936_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001390267.1|2286953_2287943_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.4e-193
WP_001072672.1|2287950_2288766_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.6	2.2e-149
WP_000767110.1|2288928_2289324_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210143.1|2289320_2289647_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000066917.1|2289643_2290297_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001387484.1|2290296_2290791_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
WP_000061508.1|2290787_2291606_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
WP_000620687.1|2291602_2291827_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
WP_001087340.1|2291823_2292969_-	Rha family phage regulatory protein	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
WP_000526669.1|2292965_2293523_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.1	5.3e-94
WP_001191669.1|2293515_2293776_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001387485.1|2293873_2294566_+	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.1	6.4e-121
WP_000179185.1|2295268_2295631_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	7.5e-57
WP_000081306.1|2295696_2296521_+	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	1.1e-148
WP_000008178.1|2296648_2297185_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_001242713.1|2297175_2297538_+	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_000111289.1|2297534_2297738_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_000476208.1|2297730_2297970_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	94.9	1.6e-34
WP_000065512.1|2297966_2298515_+	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	97.5	1.4e-59
WP_000628772.1|2299028_2299787_+	phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	82.0	2.7e-109
WP_000457723.1|2299871_2300114_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_001030156.1|2300117_2300264_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000528718.1|2300272_2300509_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_000362003.1|2300564_2301875_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	95.4	3.0e-244
WP_044713004.1|2301856_2302627_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252979.1|2302679_2303075_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|2303115_2303859_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564745.1|2303855_2304827_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
>prophage 8
NZ_HF572917	Escherichia coli strain HUSEC2011	5277676	2602789	2612231	5277676		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292767.1|2602789_2603926_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
WP_001351453.1|2603922_2605923_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|2606047_2606509_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2606549_2607020_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2607066_2607786_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2607782_2609468_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2609689_2610421_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2610480_2610588_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2610568_2611300_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569326.1|2611304_2612231_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 9
NZ_HF572917	Escherichia coli strain HUSEC2011	5277676	2812959	2877991	5277676	integrase,portal,protease,transposase,tRNA,terminase,head	Enterobacteria_phage(45.95%)	68	2842764:2842780	2880444:2880460
WP_001283590.1|2812959_2813772_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289162.1|2813771_2814785_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699126.1|2814850_2815987_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.6e-23
WP_000615821.1|2816085_2817081_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127781.1|2817077_2818256_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2818539_2819760_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683791.1|2819918_2821925_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2822045_2822324_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|2822357_2822906_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|2822905_2823715_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001043820.1|2823714_2824539_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2824542_2825628_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|2825662_2826595_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730807.1|2826760_2827312_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_000399648.1|2827505_2828486_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001387754.1|2828712_2829585_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730291.1|2829571_2830096_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|2830092_2830563_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000842082.1|2830559_2831108_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281615.1|2831082_2831835_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112829.1|2831854_2834497_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2834578_2835142_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2835816_2836302_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426166.1|2836504_2838649_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531990.1|2838648_2839959_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|2840138_2840423_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2840794_2842135_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937848.1|2842500_2843559_+	hypothetical protein	NA	NA	NA	NA	NA
2842764:2842780	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000776768.1|2843740_2844496_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2844789_2845722_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958672.1|2846033_2847191_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.3e-221
WP_000178979.1|2847419_2849330_+	acyltransferase	NA	C6ZR20	Salmonella_phage	32.6	4.7e-57
WP_000129924.1|2849400_2851380_-|head	phage head-binding domain-containing protein	head	A5VW57	Enterobacteria_phage	93.5	6.2e-60
WP_000835342.1|2851480_2852359_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.1	5.8e-95
WP_000865490.1|2852591_2852732_-	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	56.8	7.5e-05
WP_001283829.1|2852837_2853089_+	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	93.9	1.5e-35
WP_000820795.1|2853085_2853400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749286.1|2853425_2853911_+	lipoprotein	NA	NA	NA	NA	NA
WP_001387755.1|2853925_2855770_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	73.8	4.0e-247
WP_000246924.1|2855769_2857236_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	62.0	8.4e-139
WP_000964882.1|2857245_2857938_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000614045.1|2857940_2858396_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	5.7e-86
WP_000785547.1|2858395_2859244_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.5	3.4e-100
WP_001122379.1|2859243_2860662_-	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.9	3.9e-274
WP_000246749.1|2860670_2861153_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	99.4	8.4e-88
WP_000375637.1|2861127_2861313_-	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
WP_001133485.1|2861355_2862627_-|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	1.2e-239
WP_000426730.1|2862638_2863523_-	hypothetical protein	NA	Q716H1	Shigella_phage	99.0	2.0e-143
WP_000852341.1|2863536_2865663_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.0	0.0e+00
WP_000200769.1|2865665_2867078_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	9.8e-278
WP_000113732.1|2867074_2867515_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000807788.1|2867517_2867760_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000638547.1|2868806_2868938_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|2868922_2869075_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000050554.1|2869150_2869321_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_000031367.1|2869331_2869937_+	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_000951329.1|2869936_2870320_+	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	97.6	1.2e-65
WP_001111299.1|2870343_2870640_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	99.0	3.9e-51
WP_032159494.1|2870659_2870941_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	9.7e-44
WP_001214454.1|2870937_2871105_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
WP_000034245.1|2871101_2871773_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	73.2	3.0e-83
WP_000951713.1|2872135_2872345_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000208008.1|2872341_2872971_+	DUF550 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	58.6	1.1e-55
WP_001277767.1|2873067_2873247_+	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_001163428.1|2873378_2873579_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001197025.1|2874108_2875356_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274887.1|2875427_2876342_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|2876557_2877991_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
2880444:2880460	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 10
NZ_HF572917	Escherichia coli strain HUSEC2011	5277676	3239391	3246531	5277676		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3239391_3241953_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141316.1|3242058_3242715_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	1.5e-50
WP_001297141.1|3242765_3243533_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3243728_3244637_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3244633_3245896_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3245892_3246531_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 11
NZ_HF572917	Escherichia coli strain HUSEC2011	5277676	3478237	3534767	5277676	protease,tRNA,integrase,transposase	Staphylococcus_phage(28.57%)	44	3479222:3479239	3524160:3524177
WP_000701841.1|3478237_3478996_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105559.1|3479201_3480122_-	agmatinase	NA	NA	NA	NA	NA
3479222:3479239	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758915.1|3480257_3480989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3481134_3483111_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3483119_3483251_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3483386_3483602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3483905_3485060_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3485495_3486890_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|3486966_3487464_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3487558_3488266_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|3488345_3489077_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3489089_3490040_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3490148_3490712_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|3490711_3491128_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001349546.1|3491303_3492284_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3492301_3493006_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3493023_3493590_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3493586_3493877_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|3493884_3494478_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239939.1|3494470_3495607_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745217.1|3495761_3496769_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|3496885_3497932_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3498107_3498827_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3499010_3499337_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3499336_3500056_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001297399.1|3500216_3501269_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3501296_3501572_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|3501636_3502716_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3502917_3504174_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839766.1|3504223_3506359_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|3506756_3507464_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218809.1|3507842_3509105_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
WP_001387038.1|3510355_3510619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000286652.1|3512088_3514938_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.2e-183
WP_001273465.1|3514963_3515944_+	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
WP_000126413.1|3515953_3518341_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000105162.1|3518350_3519979_+	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	42.6	4.6e-85
WP_000081335.1|3519981_3522852_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001091149.1|3522940_3523234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254936.1|3523573_3524725_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
3524160:3524177	attR	AGATGCTGTATATTCAGG	NA	NA	NA	NA
WP_000587872.1|3529717_3530284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359994.1|3530762_3531917_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000555380.1|3533231_3534365_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077577697.1|3534404_3534767_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.5	6.4e-40
>prophage 12
NZ_HF572917	Escherichia coli strain HUSEC2011	5277676	4347639	4377725	5277676	tRNA,integrase,transposase	Escherichia_phage(27.27%)	24	4361903:4361932	4383777:4383806
WP_001070193.1|4347639_4348329_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_000678443.1|4348334_4350416_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_000468836.1|4350581_4351787_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001295238.1|4352066_4353458_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
WP_001307467.1|4353578_4355288_+	AsmA family protein	NA	NA	NA	NA	NA
WP_000702903.1|4355340_4357659_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_000834439.1|4357668_4359051_-	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
WP_001218908.1|4359737_4360922_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
WP_000656307.1|4361771_4361861_-	acetyltransferase	NA	NA	NA	NA	NA
4361903:4361932	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_001138064.1|4361927_4364894_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|4364896_4365457_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|4365582_4365933_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|4366135_4367149_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000703418.1|4367306_4367780_+	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
WP_000679427.1|4368009_4368357_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259029.1|4368350_4369130_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_001067855.1|4369163_4369868_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|4370367_4371228_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|4371825_4372530_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|4373285_4374137_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|4374444_4375260_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|4375320_4376124_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|4376123_4376960_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|4377020_4377725_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
4383777:4383806	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
>prophage 13
NZ_HF572917	Escherichia coli strain HUSEC2011	5277676	4933643	4992024	5277676	protease,tRNA,integrase,transposase	Enterobacteria_phage(33.33%)	30	4935810:4935824	4993306:4993320
WP_001295074.1|4933643_4935161_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856837.1|4935397_4936855_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	5.2e-48
4935810:4935824	attL	AAGCCAAAGGCAAAC	NA	NA	NA	NA
WP_001295383.1|4936913_4939061_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000092909.1|4939140_4940475_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187182.1|4940840_4942379_-	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_001290187.1|4943127_4943970_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000772029.1|4944054_4944252_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761715.1|4944271_4944760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094430.1|4944756_4945134_-	toxin	NA	NA	NA	NA	NA
WP_001285620.1|4945180_4945558_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692350.1|4945637_4945859_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001387238.1|4945945_4946422_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855057.1|4946437_4946911_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.1e-12
WP_001189118.1|4948846_4950355_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001387241.1|4951319_4953515_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750143.1|4953520_4954858_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015710.1|4954854_4956597_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287497.1|4956596_4957544_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001387605.1|4957544_4959269_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074478.1|4959404_4960598_+	MFS transporter	NA	NA	NA	NA	NA
WP_001387604.1|4960547_4961474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000555385.1|4962213_4963356_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_162886171.1|4963395_4964609_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	6.0e-167
WP_001390760.1|4965186_4966311_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.3e-199
WP_001045650.1|4967472_4971591_-|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
WP_001189118.1|4972318_4973827_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000422750.1|4975512_4975938_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	4.4e-48
WP_000291751.1|4979836_4980418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034110.1|4980464_4984322_-|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
WP_001218804.1|4990761_4992024_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
4993306:4993320	attR	GTTTGCCTTTGGCTT	NA	NA	NA	NA
>prophage 14
NZ_HF572917	Escherichia coli strain HUSEC2011	5277676	5031703	5090247	5277676	protease,transposase	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312490.1|5031703_5032963_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5032965_5033970_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|5034051_5034249_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|5034352_5035651_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|5035855_5036281_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|5036319_5038761_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|5038940_5039672_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|5039798_5040200_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|5040218_5040917_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012553.1|5040967_5041627_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000101644.1|5042052_5042691_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943976.1|5042693_5043857_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.3e-81
WP_001339483.1|5043940_5045566_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5045682_5045958_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|5046106_5046436_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569708.1|5046617_5047367_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5047363_5048119_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|5048226_5049291_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|5049645_5051043_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|5051058_5051364_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|5051373_5051838_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5051851_5052502_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949539.1|5052511_5053366_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|5053365_5054052_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000996728.1|5054148_5054700_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000492914.1|5054774_5055050_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5055376_5055772_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5055778_5056093_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5056097_5056325_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5056366_5056816_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001351393.1|5056886_5057681_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604912.1|5058303_5058735_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_000826425.1|5058742_5059951_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_001119478.1|5060085_5060724_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5060942_5061563_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|5061871_5063284_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331456.1|5063328_5063991_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001296686.1|5064098_5065064_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560563.1|5065171_5066032_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|5066120_5066501_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589423.1|5066629_5068573_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|5068762_5069503_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|5069492_5070050_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5070374_5070581_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|5070642_5071986_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|5072308_5072947_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5073152_5074886_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060946.1|5074882_5078662_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5078664_5079006_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223208.1|5079217_5079469_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|5079462_5079813_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055072.1|5079892_5080423_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|5080732_5081689_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205794.1|5081998_5083501_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_001387274.1|5083514_5084537_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595979.1|5084523_5085519_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|5085551_5086550_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219816.1|5086725_5088099_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|5088249_5088801_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5088894_5090247_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 15
NZ_HF572917	Escherichia coli strain HUSEC2011	5277676	5112924	5184393	5277676	tRNA,integrase,transposase,holin	Enterobacteria_phage(20.0%)	57	5110280:5110295	5176924:5176939
5110280:5110295	attL	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_000416381.1|5112924_5115780_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
WP_000786399.1|5115779_5116223_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|5116356_5117868_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|5118134_5119235_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|5119234_5120317_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294559.1|5120435_5121938_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	3.0e-83
WP_001349989.1|5122015_5123014_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128335.1|5123080_5124400_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|5124464_5125229_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197416.1|5125252_5126284_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896735.1|5126500_5127064_+	gluconokinase	NA	NA	NA	NA	NA
WP_000061766.1|5127067_5128087_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.4e-44
WP_000142493.1|5128516_5129443_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001223819.1|5129432_5131052_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_001143292.1|5132352_5132646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202281.1|5133013_5133886_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001178761.1|5134130_5134511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099275.1|5136181_5136478_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001104341.1|5136967_5138044_+	Fic family protein	NA	NA	NA	NA	NA
WP_000729465.1|5138094_5138724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114712.1|5139634_5140459_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351184.1|5140624_5142181_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000859648.1|5142180_5142870_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_001215044.1|5142981_5143146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000416151.1|5145115_5146147_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_000916805.1|5146417_5146861_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705930.1|5146876_5147164_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|5147176_5148433_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001327567.1|5148679_5148934_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
WP_000107474.1|5149355_5150369_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998350.1|5150380_5151697_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|5151724_5152645_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|5152950_5153733_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000080200.1|5154916_5156530_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_000624722.1|5156560_5156911_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|5156907_5157333_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001422798.1|5157471_5157600_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000145474.1|5157780_5158437_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625669.1|5158682_5159960_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|5160022_5162020_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000088357.1|5162173_5163312_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
WP_001390363.1|5163492_5164437_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001387303.1|5164501_5165452_-	virulence factor VirK	NA	NA	NA	NA	NA
WP_001388979.1|5165456_5166545_-	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_160371899.1|5166547_5167390_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001189118.1|5168965_5170474_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000177057.1|5171124_5171382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|5171939_5172707_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|5172707_5173664_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125175.1|5173660_5174659_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879153.1|5174655_5175558_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188245.1|5175602_5177927_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
5176924:5176939	attR	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_001068910.1|5178013_5178967_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|5178963_5179485_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|5180402_5180660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823241.1|5181410_5182769_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998014.1|5183007_5184393_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.4e-257
>prophage 1
NC_022742	Escherichia coli plasmid pHUSEC2011-1, complete sequence	88546	8786	19084	88546	transposase	Salmonella_phage(22.22%)	12	NA	NA
WP_000239590.1|8786_9662_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|9917_11180_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|11743_12301_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|12483_13344_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001245884.1|13612_13915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587689.1|13911_14538_-	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_000457515.1|14741_16013_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.4	2.2e-143
WP_000109071.1|16012_16450_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|16446_16695_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_023383827.1|17113_18016_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_001310011.1|18012_18324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086153.1|18400_19084_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	5.1e-30
>prophage 1
NC_022743	Escherichia coli plasmid pHUSEC2011-2, complete sequence	75569	6279	13233	75569	transposase	Stx2-converting_phage(57.14%)	8	NA	NA
WP_000019440.1|6279_7260_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_001339397.1|7987_8665_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|8664_9012_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381397.1|9031_10603_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
WP_000624689.1|10915_11212_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	64.4	3.4e-31
WP_001387845.1|11208_11643_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	3.4e-19
WP_000139330.1|11871_12432_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205736.1|12486_13233_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
