The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008740	Haemophilus influenzae 2019, complete genome	1969659	71401	179066	1969659	tRNA,transposase,terminase,plate,tail	Burkholderia_virus(16.28%)	99	NA	NA
WP_005693857.1|71401_71878_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_046067527.1|71885_73184_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A142F1B8	Bacillus_phage	38.6	1.4e-07
WP_005689911.1|73184_75074_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.0	3.6e-65
WP_005689913.1|75081_76017_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_046067528.1|76022_78968_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_005657724.1|79051_80728_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_005657722.1|80839_81730_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_136427515.1|81829_82426_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_005657719.1|82530_82827_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_005657717.1|82985_83261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005657715.1|83590_84091_-	hypothetical protein	NA	A0A0M3LP76	Mannheimia_phage	53.6	1.9e-10
WP_005660793.1|84301_84529_+	DNA-binding protein	NA	A0A0M3LPY8	Mannheimia_phage	69.0	2.1e-20
WP_005657712.1|84539_86549_+|transposase	transposase	transposase	M4M9R2	Vibrio_phage	35.7	1.8e-99
WP_046067529.1|86575_87493_+	AAA family ATPase	NA	A0A2I7S9C3	Vibrio_phage	39.9	1.5e-56
WP_005657708.1|87492_87696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005660799.1|87717_88236_+	host-nuclease inhibitor protein Gam	NA	F6MIJ0	Haemophilus_phage	55.2	1.0e-43
WP_005660802.1|88340_88538_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005658932.1|88708_88909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005658930.1|88990_89959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005658929.1|90067_90556_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	31.7	4.8e-14
WP_005658927.1|90559_90934_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	46.2	1.9e-23
WP_005658925.1|91007_91427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525661.1|91513_92050_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	68.0	7.2e-72
WP_005658916.1|92289_92520_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	70.7	3.3e-18
WP_005658913.1|92516_92774_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_005658911.1|92897_93206_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	39.4	6.3e-12
WP_005658909.1|93202_93505_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	52.0	3.1e-24
WP_005658907.1|93514_94063_+	DUF3486 family protein	NA	Q6QIC2	Burkholderia_phage	40.3	5.9e-29
WP_046067530.1|94046_95369_+|terminase	terminase	terminase	A0A2P9JZI8	Alteromonadaceae_phage	64.0	8.9e-148
WP_005661597.1|95370_96786_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	45.4	5.9e-113
WP_005658901.1|96786_98064_+	hypothetical protein	NA	J9STS2	Pseudomonas_phage	48.1	3.3e-54
WP_005658899.1|98250_98439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005661604.1|98641_99142_+	phage virion morphogenesis protein	NA	G8GWE3	Rhodobacter_phage	31.5	3.8e-14
WP_046067531.1|99384_100488_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	39.2	2.1e-65
WP_005661610.1|100506_101433_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	47.9	1.3e-73
WP_005658889.1|101498_101816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005658887.1|101815_102250_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	36.4	4.4e-19
WP_005658884.1|102261_102759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005661612.1|102768_104154_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	44.3	5.2e-98
WP_005661614.1|104164_104683_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	45.0	1.5e-37
WP_005658875.1|104776_105052_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_005658873.1|105072_105213_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_005658872.1|105228_105462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005658870.1|105498_107847_+|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	40.3	3.7e-72
WP_005658868.1|107846_108779_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_005658865.1|108759_108990_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	46.3	3.6e-12
WP_005658863.1|108982_110047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005658861.1|110033_110642_+|plate	phage baseplate assembly protein V	plate	A0A291LA20	Bordetella_phage	42.1	2.2e-08
WP_005658860.1|110696_111062_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_005658857.1|111061_112168_+|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	36.4	7.9e-57
WP_005658855.1|112160_112730_+|tail	tail fiber protein	tail	A4JWL7	Burkholderia_virus	45.3	4.5e-40
WP_046067532.1|112761_114471_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	67.2	2.5e-158
WP_005661624.1|114482_115085_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	91.0	2.6e-94
WP_046067533.1|115149_115581_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	65.5	1.4e-49
WP_005641687.1|115756_115876_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_046067534.1|115932_116778_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	72.2	5.0e-120
WP_046067535.1|116819_117083_-	hypothetical protein	NA	F6MIM3	Haemophilus_phage	77.9	7.2e-33
WP_005661142.1|118303_119665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005658399.1|119665_120718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005658398.1|120730_120991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005658396.1|121058_121271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005658393.1|122094_124218_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	62.8	1.6e-260
WP_005658391.1|124335_125196_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_005689968.1|125204_126071_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_005689969.1|126146_127526_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	29.5	2.5e-52
WP_005652519.1|127628_128138_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005658385.1|128192_128981_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_046067872.1|129310_129586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005689970.1|129635_129959_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	42.4	9.8e-16
WP_005672300.1|130078_131074_-	2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	39.9	3.8e-66
WP_074032767.1|131086_132232_-	methionine biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
WP_005689971.1|133045_134323_-	threonine synthase	NA	NA	NA	NA	NA
WP_005658373.1|134365_135310_-	homoserine kinase	NA	NA	NA	NA	NA
WP_005658371.1|135322_137770_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_046067536.1|138093_138795_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_105872224.1|139083_140562_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005689975.1|140713_141712_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046067873.1|141829_143350_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_080343075.1|143351_144407_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-26
WP_046067539.1|144441_145122_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_046067540.1|145123_146257_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_046067541.1|146284_146629_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_046067542.1|146937_147294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046067543.1|147324_149205_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.6	9.8e-116
WP_005658338.1|149513_150269_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_005658336.1|150444_152826_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	28.1	1.8e-21
WP_005658333.1|152818_153823_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	42.5	3.2e-65
WP_005658331.1|153874_155131_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_005658329.1|155226_158247_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.2	1.9e-20
WP_005661173.1|158471_159860_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005654254.1|160140_161403_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_005658325.1|161530_162274_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_032822028.1|162227_162458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005658323.1|162813_164103_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.5	4.7e-93
WP_005658321.1|164437_165067_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_005661182.1|165427_167659_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_005658063.1|174656_176792_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_005658064.1|177186_178296_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_005690258.1|178280_179066_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP008740	Haemophilus influenzae 2019, complete genome	1969659	480075	514425	1969659	terminase,tail	Pseudomonas_phage(15.62%)	46	NA	NA
WP_005688923.1|480075_480339_+	hypothetical protein	NA	F6MIM3	Haemophilus_phage	79.1	7.2e-33
WP_005641687.1|481283_481403_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006995417.1|481578_482067_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	56.2	1.9e-47
WP_005688914.1|482059_482686_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	45.2	2.7e-30
WP_046067587.1|482688_484932_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	56.6	1.3e-178
WP_011272525.1|484941_485556_-	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	37.4	1.3e-21
WP_005688909.1|485564_487001_-	hypothetical protein	NA	A0A0N9SH53	Pseudomonas_phage	28.4	1.1e-45
WP_005688907.1|486993_487359_-	hypothetical protein	NA	A0A1J0MEY0	Pectobacterium_phage	34.5	8.2e-11
WP_005688905.1|487355_488027_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	34.6	2.5e-21
WP_044332552.1|488029_488986_-	hypothetical protein	NA	M4SNA5	Psychrobacter_phage	29.5	3.6e-21
WP_005643334.1|488982_489297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005688900.1|489293_489875_-	hypothetical protein	NA	I3PGV3	Xanthomonas_phage	27.7	5.7e-06
WP_044332557.1|489965_492296_-	tape measure protein	NA	K7RVL7	Vibrio_phage	28.8	6.2e-35
WP_005643342.1|492480_492963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005643344.1|492962_493388_-	DUF3277 family protein	NA	A0A0A1IUI2	Pseudomonas_phage	36.9	2.6e-16
WP_005651167.1|493433_494507_-	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	41.3	2.8e-59
WP_005651165.1|494493_495003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011272515.1|495004_495364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046067588.1|495363_495822_-	hypothetical protein	NA	A0A2I7R754	Vibrio_phage	34.5	1.8e-15
WP_005688889.1|495814_496165_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_005688887.1|496168_496357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995054.1|496359_497361_-	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	36.6	2.9e-50
WP_005643361.1|497368_497788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046067589.1|497801_498875_-	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	40.4	3.2e-55
WP_046067591.1|499622_500939_-	DUF1073 domain-containing protein	NA	A0A2K9V3H1	Faecalibacterium_phage	31.8	2.6e-46
WP_005688877.1|500940_502299_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	52.6	1.9e-121
WP_046067592.1|502279_502798_-|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	39.2	3.6e-20
WP_046067593.1|502875_503106_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	52.4	5.9e-15
WP_005688871.1|503089_503437_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	56.1	1.2e-22
WP_005688869.1|503438_503720_-	hypothetical protein	NA	Q776X1	Haemophilus_phage	70.0	1.5e-28
WP_005688866.1|503631_503967_-	DUF2570 domain-containing protein	NA	Q7Y5U9	Haemophilus_phage	66.7	1.5e-27
WP_005688864.1|503939_504482_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	52.0	2.4e-46
WP_005688862.1|504462_504714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005688858.1|505173_505686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005688856.1|506094_506916_-	NYN domain-containing protein	NA	A0A0R6PGY5	Moraxella_phage	40.9	3.1e-34
WP_005688854.1|507150_507669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046067594.1|507707_508073_-	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_005688849.1|508074_508662_-	recombinase NinG	NA	A0A2I7RAC0	Vibrio_phage	48.5	1.8e-36
WP_005688843.1|509175_510099_-	N-6 DNA methylase	NA	A0A0M3LQ47	Mannheimia_phage	58.2	2.3e-97
WP_005688841.1|510095_510320_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_005688839.1|510316_511690_-	AAA family ATPase	NA	A0A0M3LQC0	Mannheimia_phage	51.7	5.5e-124
WP_005688837.1|511689_512619_-	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	57.3	7.8e-82
WP_005688835.1|512596_512779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046067595.1|512823_513264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046067596.1|513312_513546_-	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	50.0	1.5e-10
WP_046067597.1|513672_514425_+	LexA family transcriptional regulator	NA	Q76H56	Enterobacteria_phage	35.0	8.4e-18
>prophage 3
NZ_CP008740	Haemophilus influenzae 2019, complete genome	1969659	517573	526753	1969659	integrase,bacteriocin	Aggregatibacter_phage(33.33%)	15	512819:512833	529828:529842
512819:512833	attL	TTTTTTTATTTCTTG	NA	NA	NA	NA
WP_046067602.1|517573_518605_+	endonuclease	NA	D0UIK6	Aggregatibacter_phage	82.8	2.0e-41
WP_005651093.1|518695_519433_+	site-specific DNA-methyltransferase	NA	A0A0E3U2R2	Fusobacterium_phage	77.5	5.2e-113
WP_042593372.1|519446_519791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042593270.1|519787_520081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046067603.1|520093_521014_+	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	71.2	4.1e-115
WP_046067604.1|520988_521639_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	71.1	3.4e-84
WP_005662053.1|521638_522073_+	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	36.8	7.5e-19
WP_005688799.1|522174_522744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046067605.1|522740_522977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046067606.1|522973_523333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046067607.1|523475_523916_+	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	77.4	3.0e-60
WP_046067608.1|523902_524247_+	hypothetical protein	NA	D0UIM4	Aggregatibacter_phage	71.1	1.8e-39
WP_046067609.1|524649_525276_+|bacteriocin	bacteriocin	bacteriocin	A0A0P0ZCS0	Stx2-converting_phage	51.0	7.7e-17
WP_005651299.1|525515_525830_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005641600.1|525727_526753_+|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	35.4	7.4e-57
529828:529842	attR	TTTTTTTATTTCTTG	NA	NA	NA	NA
>prophage 4
NZ_CP008740	Haemophilus influenzae 2019, complete genome	1969659	805265	866126	1969659	tRNA,protease,transposase	Macacine_betaherpesvirus(30.77%)	60	NA	NA
WP_046067660.1|805265_805700_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_021034585.1|806201_806678_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_046067661.1|806674_807352_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_046067662.1|807351_807630_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_005650775.1|807753_808221_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_046067663.1|808331_809786_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_005655582.1|809885_810239_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080317184.1|810223_811045_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	61.2	7.9e-62
WP_005661219.1|811112_811904_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_005655034.1|812069_812510_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005689983.1|812503_813391_+	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	31.5	2.6e-10
WP_080317184.1|813431_814253_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	61.2	7.9e-62
WP_005655582.1|814237_814591_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005630808.1|814702_815092_-	RidA family protein	NA	NA	NA	NA	NA
WP_005658614.1|815148_815901_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_005648601.1|816051_816609_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	26.1	2.6e-08
WP_005658616.1|816610_817027_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_005661954.1|817170_818406_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.7	3.8e-124
WP_005648605.1|818415_818997_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.8	5.8e-59
WP_006995277.1|819119_820418_-	trigger factor	NA	NA	NA	NA	NA
WP_046067664.1|820717_823987_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_005661261.1|824043_824352_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_005661259.1|824351_824648_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_005654327.1|824767_824893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046067665.1|824876_826736_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	9.1e-13
WP_005661254.1|826732_828118_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_046067666.1|828323_830909_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.0	1.7e-33
WP_005658449.1|831043_832279_-	stationary phase survival protein SurE	NA	NA	NA	NA	NA
WP_005689997.1|832362_833781_-	tryptophanase	NA	NA	NA	NA	NA
WP_074031114.1|833868_833949_-	tryptophanase leader peptide	NA	NA	NA	NA	NA
WP_005658447.1|834148_835366_-	murein hydrolase activator NlpD	NA	NA	NA	NA	NA
WP_005658446.1|835389_835575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005658445.1|835583_836162_-	DedA family protein	NA	NA	NA	NA	NA
WP_005661245.1|836170_836920_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.6	6.8e-68
WP_005658443.1|836929_837949_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_005661243.1|838057_838477_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_005661241.1|838555_839116_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_005689994.1|839263_841000_+	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_046067667.1|841009_844897_+	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_005661235.1|844904_845882_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_075913461.1|846000_846723_-	rRNA large subunit pseudouridine synthase E	NA	NA	NA	NA	NA
WP_005661232.1|846862_847687_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_075913459.1|847811_847949_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_005650775.1|847970_848438_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_080317184.1|848491_849313_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	61.2	7.9e-62
WP_005655582.1|849297_849651_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005655029.1|849759_851271_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_005689987.1|851291_852086_-	aquaporin	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	31.9	5.8e-17
WP_005661229.1|852315_853410_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	36.6	1.4e-08
WP_005650782.1|853513_854956_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_005658425.1|855248_856940_+	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_005658424.1|856929_858228_+	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_005658423.1|858239_859520_+	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_005658422.1|859630_861109_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005655042.1|861761_862640_+	HTH-type transcriptional activator IlvY	NA	NA	NA	NA	NA
WP_005658419.1|862671_863550_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_005658417.1|863550_863868_+	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_005689940.1|863971_864325_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080317184.1|864309_865131_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	61.2	7.9e-62
WP_005661956.1|865274_866126_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 5
NZ_CP008740	Haemophilus influenzae 2019, complete genome	1969659	1267100	1343415	1969659	head,transposase,integrase,plate,protease,tail	Burkholderia_phage(20.0%)	89	1260457:1260477	1316010:1316030
1260457:1260477	attL	GAATTTTTACCGCACTTTTAT	NA	NA	NA	NA
WP_032827592.1|1267100_1267478_-	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	47.8	1.1e-23
WP_005661830.1|1267477_1267864_-	regulatory protein GemA	NA	NA	NA	NA	NA
WP_005661833.1|1267860_1268235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046067725.1|1268210_1268690_-	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	48.1	8.8e-29
WP_046067726.1|1268735_1269143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046067727.1|1269294_1269516_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046067728.1|1269515_1270037_-	host-nuclease inhibitor protein Gam	NA	F6MIJ0	Haemophilus_phage	47.1	2.8e-36
WP_005640647.1|1270029_1270233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046067729.1|1270241_1271414_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	52.5	9.2e-104
WP_046067730.1|1271475_1273296_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9SGQ3	Pseudomonas_phage	42.2	5.2e-122
WP_046067731.1|1273305_1274286_-	hypothetical protein	NA	J9SW46	Pseudomonas_phage	28.9	2.1e-24
WP_005661855.1|1274295_1274595_-	hypothetical protein	NA	A0A0S4L7B4	Pseudomonas_phage	38.3	3.0e-11
WP_032827590.1|1274828_1275062_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_005661862.1|1275126_1275411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046067732.1|1275604_1275970_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046067733.1|1275999_1276863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046067734.1|1276873_1277095_+	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	62.5	1.6e-09
WP_005661870.1|1277116_1278169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046067735.1|1278253_1278802_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	72.5	9.0e-78
WP_005661702.1|1278947_1279304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005661700.1|1279287_1279515_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	79.5	1.8e-24
WP_005661698.1|1279511_1279769_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_005661694.1|1279885_1280194_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	44.4	3.9e-14
WP_005661693.1|1280190_1280493_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	54.1	3.7e-25
WP_005661691.1|1280502_1281045_+	DUF3486 family protein	NA	Q6QIC2	Burkholderia_phage	53.9	6.9e-46
WP_005661689.1|1281044_1282541_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	63.7	1.7e-166
WP_046067736.1|1282638_1284096_+	DUF935 family protein	NA	A4JWJ5	Burkholderia_virus	45.4	3.5e-113
WP_046067737.1|1284109_1285378_+|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	48.8	4.1e-57
WP_005661675.1|1285761_1286223_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	28.0	3.7e-08
WP_005661672.1|1286459_1287572_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	40.3	6.3e-70
WP_046067738.1|1287583_1288510_+	inorganic pyrophosphatase	NA	A4JWK0	Burkholderia_virus	49.7	4.7e-79
WP_005661667.1|1288584_1288845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046067739.1|1288844_1289279_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	39.8	1.4e-17
WP_005661666.1|1289289_1289757_+	hypothetical protein	NA	A4JWK3	Burkholderia_virus	34.6	7.8e-22
WP_005661664.1|1289767_1291153_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	44.8	1.1e-100
WP_046067740.1|1291165_1291684_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	47.3	2.3e-38
WP_046067741.1|1291773_1292058_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_080343082.1|1292035_1292188_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_005661656.1|1292172_1292484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005661654.1|1292530_1295272_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	26.9	1.0e-36
WP_005661652.1|1295284_1296220_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	40.8	1.2e-18
WP_005661650.1|1296200_1296431_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	47.8	2.1e-12
WP_046067742.1|1296423_1297485_+	regulatory protein	NA	Q6QIA2	Burkholderia_phage	42.3	4.3e-68
WP_005661646.1|1297471_1298086_+|plate	phage baseplate assembly protein V	plate	A0A291LA20	Bordetella_phage	44.9	1.6e-11
WP_046067743.1|1298140_1298506_+|plate	phage baseplate protein	plate	E5G6N7	Salmonella_phage	36.8	7.2e-07
WP_005661643.1|1298502_1299609_+|plate	baseplate J/gp47 family protein	plate	NA	NA	NA	NA
WP_005661641.1|1299601_1300168_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	47.2	2.6e-43
WP_046067744.1|1300193_1301864_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	56.0	3.5e-96
WP_046067883.1|1301867_1302419_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	54.0	2.8e-47
WP_046067745.1|1302411_1302900_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	55.0	1.8e-45
WP_005641687.1|1303075_1303195_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_046067746.1|1303251_1304097_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	72.1	1.6e-118
WP_005640694.1|1304136_1304400_-	hypothetical protein	NA	F6MIM3	Haemophilus_phage	79.1	1.4e-33
WP_046067748.1|1305132_1305804_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_005647634.1|1305837_1307367_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011272391.1|1307481_1308099_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_080279485.1|1308191_1309070_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_005657282.1|1309109_1310108_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	1.8e-23
WP_046067749.1|1310104_1311076_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.4	5.2e-12
WP_046067750.1|1311085_1312021_-	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_046067751.1|1312030_1312951_-	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_005651801.1|1313031_1314657_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046067752.1|1314952_1315906_+	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	35.2	4.8e-10
WP_032821946.1|1316435_1316666_-	membrane protein	NA	NA	NA	NA	NA
1316010:1316030	attR	ATAAAAGTGCGGTAAAAATTC	NA	NA	NA	NA
WP_046067753.1|1316863_1318450_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_005661293.1|1318651_1319107_+	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_005661295.1|1319137_1320100_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_005647600.1|1320102_1320426_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_005689365.1|1320437_1322270_+	peptidoglycan synthase	NA	NA	NA	NA	NA
WP_046067754.1|1322279_1323746_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_005689361.1|1323759_1325133_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_005651824.1|1325126_1326209_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_005657254.1|1326320_1327634_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_005689358.1|1327655_1328840_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_005657251.1|1328851_1329907_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_005657250.1|1330043_1331471_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_046067755.1|1331542_1332463_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_046067756.1|1332462_1333170_+	cell division protein FtsQ/DivIB	NA	NA	NA	NA	NA
WP_005689353.1|1333244_1334522_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_005647572.1|1334605_1335871_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_005657242.1|1335909_1336827_+	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_005657241.1|1336952_1338110_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_005657239.1|1338154_1339012_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	27.1	5.8e-07
WP_005657238.1|1339029_1339524_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_005657236.1|1339526_1340252_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	7.1e-22
WP_005657234.1|1340255_1340774_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_005689344.1|1340754_1341369_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_046067757.1|1341419_1341971_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_005689340.1|1342059_1343415_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 6
NZ_CP008740	Haemophilus influenzae 2019, complete genome	1969659	1372170	1380684	1969659		Bacillus_virus(33.33%)	8	NA	NA
WP_005657163.1|1372170_1373154_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.3	4.2e-17
WP_005660423.1|1373156_1374149_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.5e-14
WP_005657156.1|1374158_1375046_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014550902.1|1375060_1376032_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_080343084.1|1376151_1378335_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.6	3.9e-116
WP_005686506.1|1378946_1379582_-	7-carboxy-7-deazaguanine synthase	NA	A0A218M2Y8	Acidovorax_phage	35.2	2.9e-11
WP_005647466.1|1379582_1380008_-	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	42.7	7.8e-21
WP_005660434.1|1380000_1380684_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	51.6	4.6e-55
>prophage 7
NZ_CP008740	Haemophilus influenzae 2019, complete genome	1969659	1491758	1497643	1969659		Haemophilus_phage(50.0%)	7	NA	NA
WP_014550842.1|1491758_1493273_-	replicative DNA helicase	NA	O80281	Escherichia_phage	68.5	2.8e-169
WP_005653307.1|1493306_1494743_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_005656902.1|1495263_1495593_+	hypothetical protein	NA	A0A0M3LRG1	Mannheimia_phage	58.6	1.1e-22
WP_005690083.1|1495687_1496218_-	hypothetical protein	NA	Q94N00	Haemophilus_virus	39.0	4.9e-20
WP_079996278.1|1496216_1496378_+	DUF935 family protein	NA	B7SDN1	Haemophilus_phage	68.6	1.7e-13
WP_005656898.1|1496389_1497091_+	hypothetical protein	NA	B7SDN5	Haemophilus_phage	61.6	1.1e-75
WP_005656896.1|1497226_1497643_+	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	65.9	3.6e-47
>prophage 8
NZ_CP008740	Haemophilus influenzae 2019, complete genome	1969659	1618865	1631859	1969659	terminase,holin	Haemophilus_phage(42.86%)	19	NA	NA
WP_005659462.1|1618865_1619504_-	hypothetical protein	NA	Q94MY0	Haemophilus_virus	53.4	1.7e-35
WP_005656677.1|1621137_1621707_-|terminase	terminase small subunit	terminase	Q7Y5U8	Haemophilus_phage	39.5	6.2e-21
WP_005650541.1|1621745_1622027_-	hypothetical protein	NA	Q776X1	Haemophilus_phage	74.4	4.2e-31
WP_005656675.1|1621926_1622262_-	DUF2570 domain-containing protein	NA	Q7Y5U9	Haemophilus_phage	60.7	3.9e-23
WP_005650535.1|1622825_1623182_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_005656669.1|1623363_1623699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005656667.1|1623799_1624168_-	hypothetical protein	NA	Q7Y5V5	Haemophilus_phage	62.6	3.0e-37
WP_005656665.1|1624169_1624718_-	hypothetical protein	NA	D0UIK8	Aggregatibacter_phage	72.1	8.2e-63
WP_005656663.1|1624806_1625226_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	76.1	5.1e-57
WP_005650520.1|1625262_1625487_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_005688443.1|1625483_1626125_-	replication P	NA	NA	NA	NA	NA
WP_005688442.1|1626109_1626826_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	60.5	1.7e-60
WP_005661986.1|1626822_1627488_-	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	52.6	3.8e-54
WP_005656655.1|1627536_1627833_-	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	70.4	2.0e-31
WP_005656651.1|1628190_1628847_+	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	58.4	2.1e-65
WP_005656649.1|1628880_1629654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688440.1|1629650_1630466_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_005656646.1|1630955_1631129_-	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	65.0	2.4e-08
WP_005656642.1|1631649_1631859_+	hypothetical protein	NA	D0UIM2	Aggregatibacter_phage	67.2	7.5e-17
>prophage 9
NZ_CP008740	Haemophilus influenzae 2019, complete genome	1969659	1705057	1808950	1969659	lysis,tRNA,head,capsid,terminase,integrase,plate,protease,portal,tail	Mannheimia_phage(31.82%)	106	1774544:1774568	1782440:1782464
WP_005689634.1|1705057_1707445_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005689632.1|1707478_1708468_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	5.5e-33
WP_079997638.1|1708616_1709378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005657431.1|1709402_1709651_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	49.4	1.0e-12
WP_005660315.1|1709645_1710458_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_079996260.1|1710474_1711107_-	LysE family transporter	NA	NA	NA	NA	NA
WP_005660311.1|1711103_1711595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005660309.1|1711591_1712578_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_005660308.1|1712644_1713079_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_005628657.1|1713082_1713556_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.4	5.1e-29
WP_005660305.1|1713782_1715186_+|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	39.0	9.7e-84
WP_005631770.1|1715261_1715951_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_005689630.1|1715977_1717921_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	29.8	2.7e-52
WP_005689628.1|1718014_1719400_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_005657449.1|1719492_1720188_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_005689626.1|1720206_1720629_-	membrane protein	NA	NA	NA	NA	NA
WP_005657455.1|1720764_1721226_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_005659562.1|1721227_1722427_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	33.2	5.8e-61
WP_005657461.1|1722423_1722804_+	SufE family protein	NA	NA	NA	NA	NA
WP_046067834.1|1722794_1723580_+	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_005657465.1|1723705_1724545_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	39.6	7.1e-42
WP_079996234.1|1724577_1725711_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_005657468.1|1725791_1726712_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_005628626.1|1726711_1727098_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_046067835.1|1727302_1728949_+	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	24.9	3.5e-08
WP_005657472.1|1728941_1730237_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_005657474.1|1730238_1730763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005657478.1|1731229_1731460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005689619.1|1731666_1734834_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.5	1.6e-78
WP_005659577.1|1734912_1737432_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	26.4	1.8e-27
WP_005652909.1|1737443_1738931_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_005657488.1|1738947_1739403_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_046067836.1|1740650_1741982_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1V0E8G8	Vibrio_phage	29.1	7.9e-43
WP_005652916.1|1741962_1742130_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005689613.1|1742129_1742639_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	42.6	4.8e-25
WP_080343095.1|1742694_1744878_-	replication endonuclease	NA	Q94N00	Haemophilus_virus	42.8	1.9e-166
WP_005689771.1|1746185_1746488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005668404.1|1746613_1746856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005689773.1|1746859_1747240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005689775.1|1747257_1747521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005633751.1|1747612_1747903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105892235.1|1747965_1748205_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	46.7	2.1e-07
WP_005689779.1|1748320_1749010_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005689781.1|1749019_1750189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005689783.1|1750200_1750440_+	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005689785.1|1750465_1751659_-	phage late control D family protein	NA	R9QBT3	Mannheimia_phage	51.5	2.3e-102
WP_005689787.1|1751658_1752096_-|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	58.2	7.0e-41
WP_005689789.1|1752099_1752435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005633772.1|1752610_1752757_-|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	65.0	2.2e-07
WP_005689790.1|1752756_1753056_-|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	40.7	4.4e-10
WP_005655097.1|1753121_1753628_-|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	59.5	5.4e-53
WP_005672590.1|1753631_1754816_-|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	48.7	3.5e-103
WP_005689792.1|1754973_1755453_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	55.6	1.2e-46
WP_005689793.1|1755445_1756054_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	77.5	1.9e-76
WP_005689795.1|1756065_1758588_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	65.2	6.3e-243
WP_005689797.1|1758596_1759133_-|tail	phage tail protein I	tail	M1T2R2	Escherichia_phage	53.1	7.0e-51
WP_005689799.1|1759122_1760037_-|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	58.9	4.4e-93
WP_005689801.1|1760033_1760372_-	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	56.6	4.5e-19
WP_005668437.1|1760373_1760973_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	66.0	7.1e-44
WP_005653088.1|1761076_1761505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005689803.1|1761513_1762071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005689805.1|1762171_1764907_-|tail	phage tail tape measure protein	tail	K7RVY9	Vibrio_phage	35.9	6.7e-73
WP_005668444.1|1764975_1765248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005689807.1|1765225_1765684_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	51.8	2.1e-27
WP_005689809.1|1765683_1766154_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	48.1	2.5e-28
WP_005689810.1|1766150_1766366_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	47.9	1.8e-10
WP_005689812.1|1766540_1766891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046067837.1|1766875_1767394_-	lysozyme	NA	I6PBN2	Cronobacter_phage	50.0	2.1e-36
WP_005689816.1|1767386_1767608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005689818.1|1767609_1767819_-|tail	tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	43.1	2.7e-06
WP_005689821.1|1767818_1768325_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	50.7	3.1e-32
WP_046067838.1|1768448_1769099_-|terminase	terminase	terminase	Q19US0	Mannheimia_phage	45.6	1.6e-44
WP_046067839.1|1769110_1770160_-|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	51.6	3.4e-89
WP_046067840.1|1770181_1770997_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LNM2	Mannheimia_phage	61.9	2.0e-65
WP_046067841.1|1771161_1772943_+|terminase	terminase	terminase	A0A0M3LRV4	Mannheimia_phage	65.4	2.9e-218
WP_005689831.1|1772952_1773963_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	61.9	6.0e-120
1774544:1774568	attL	ATTTTAGTTATACGTTTAGTTATAC	NA	NA	NA	NA
WP_005657489.1|1774721_1775966_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	40.8	7.8e-85
WP_005659583.1|1776054_1776981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005659586.1|1777168_1777378_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_005657496.1|1777388_1777661_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_079997643.1|1777695_1777989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005689834.1|1777985_1778201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005657505.1|1778210_1778585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005657508.1|1778670_1779354_+	hypothetical protein	NA	A0A2K5B268	Erysipelothrix_phage	34.4	9.3e-24
WP_005657512.1|1779433_1779859_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005657515.1|1780192_1780690_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_005657520.1|1781042_1781246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046067842.1|1781232_1781664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005657526.1|1781668_1781848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075913139.1|1783320_1784004_-	acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
1782440:1782464	attR	ATTTTAGTTATACGTTTAGTTATAC	NA	NA	NA	NA
WP_005657535.1|1784108_1784771_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005659602.1|1784817_1785930_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_005689844.1|1786080_1788129_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	24.9	5.5e-27
WP_005689846.1|1788239_1789100_+	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_005689848.1|1789150_1789852_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005689850.1|1789903_1790710_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032824949.1|1791681_1792068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005659621.1|1792204_1793968_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_046067843.1|1794546_1797186_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	30.9	3.9e-102
WP_046067844.1|1797240_1798317_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_046067845.1|1798474_1799155_+	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_080343096.1|1799433_1800747_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_005657567.1|1800739_1801630_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_005657569.1|1801823_1803215_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	31.2	7.2e-23
WP_005659631.1|1803267_1806708_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_046067847.1|1806979_1808950_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
