The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004391	Pasteurella multocida subsp. multocida OH4807, complete genome	2079121	207609	215055	2079121	head	Haemophilus_phage(28.57%)	8	NA	NA
WP_080940347.1|207609_208092_-	enoyl-CoA hydratase	NA	F6MIM0	Haemophilus_phage	60.1	4.1e-50
WP_046338499.1|208084_208693_-	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	46.3	1.5e-44
WP_046340091.1|209847_211017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046338501.1|211089_212013_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	53.9	3.0e-86
WP_155392672.1|212012_212747_-	DUF2644 domain-containing protein	NA	A0A0C4UQU6	Shigella_phage	44.9	5.5e-30
WP_080940297.1|212845_213943_-	hypothetical protein	NA	M4M9R2	Vibrio_phage	44.4	1.2e-86
WP_046338502.1|213945_214167_-	transcriptional regulator	NA	A0A0M3LPY8	Mannheimia_phage	72.6	1.9e-23
WP_046338503.1|214377_215055_+	hypothetical protein	NA	A0A0M3LP76	Mannheimia_phage	40.4	1.5e-34
>prophage 2
NZ_CP004391	Pasteurella multocida subsp. multocida OH4807, complete genome	2079121	865784	910300	2079121	portal,terminase,protease,holin,integrase,tail,transposase	Salmonella_phage(15.62%)	60	870121:870166	914593:914638
WP_127885807.1|865784_866216_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_005612106.1|866087_866381_+	flavodoxin	NA	NA	NA	NA	NA
WP_010907406.1|866364_867117_+	DUF4405 domain-containing protein	NA	NA	NA	NA	NA
WP_005628486.1|867212_867425_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_046339031.1|868972_869824_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.1	2.2e-30
870121:870166	attL	CTTCTAAGCCGTAGGTCATTGGTTCGAATCCAATAGGGCGTGCCAT	NA	NA	NA	NA
WP_046339032.1|870197_871253_-|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	37.8	6.0e-62
WP_080940317.1|871156_871459_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046339033.1|871488_871701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046339035.1|871878_872277_-	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	40.0	1.6e-20
WP_046339036.1|872283_872493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046339037.1|872547_872778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155392679.1|872787_873249_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	48.8	2.6e-14
WP_046339038.1|873273_873546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046339039.1|873535_874447_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	45.2	2.4e-59
WP_046339040.1|874449_874833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046339041.1|874835_875261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046339042.1|875296_876595_-	DNA cytosine methyltransferase	NA	A0A2I7QRH3	Vibrio_phage	45.3	1.4e-92
WP_046339043.1|876674_876947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052719253.1|876943_877543_-	hypothetical protein	NA	A0A218KC93	Bacillus_phage	36.2	1.5e-17
WP_046339044.1|877693_877933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155392680.1|877969_878167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046339045.1|878250_878679_-	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	68.0	3.0e-36
WP_046339046.1|878679_878955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052719255.1|879495_879981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046339047.1|880178_880409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046339048.1|880645_881551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080940318.1|881619_882468_-	helix-turn-helix transcriptional regulator	NA	A0A0U1SXS9	Pseudomonas_phage	34.2	6.6e-27
WP_046339050.1|882523_882709_+	Cro/Cl family transcriptional regulator	NA	A0A2K8HL98	Pseudomonas_phage	56.7	2.3e-09
WP_046339051.1|882757_883207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046339052.1|883262_884024_+	hypothetical protein	NA	A0A2D0YGX8	Vibrio_phage	37.3	5.0e-34
WP_080940319.1|884503_885091_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	44.6	7.0e-12
WP_155392703.1|885099_885639_+	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	82.3	5.5e-88
WP_046339055.1|885662_886643_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	33.8	1.1e-44
WP_046339056.1|886642_887017_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	45.7	2.6e-20
WP_046339057.1|887003_887390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046339058.1|887542_887908_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_046339059.1|887879_888464_+	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	57.4	4.5e-59
WP_046339060.1|888466_888790_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_016533220.1|889014_889431_-	hypothetical protein	NA	A0A0R6PD76	Moraxella_phage	52.9	1.0e-33
WP_016533221.1|889478_889655_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	65.5	2.9e-14
WP_046339061.1|889922_890384_+	DUF1441 family protein	NA	NA	NA	NA	NA
WP_046339062.1|890364_892479_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	66.7	4.9e-273
WP_046339063.1|892469_892697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046339064.1|892693_894244_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	59.0	2.7e-159
WP_046339065.1|894176_896216_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	54.5	5.4e-192
WP_046339066.1|896285_896612_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	39.8	1.9e-14
WP_046339067.1|896604_896898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046339068.1|896897_897449_+|tail	tail protein	tail	K7PKQ5	Enterobacteria_phage	45.2	1.2e-26
WP_014391486.1|897445_897853_+|tail	tail protein	tail	NA	NA	NA	NA
WP_046339069.1|897849_898359_+|tail	tail fiber protein	tail	K7P6G8	Enterobacteria_phage	52.4	5.3e-40
WP_046339070.1|898361_898751_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_080940321.1|898813_899074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046339072.1|899060_901439_+	hypothetical protein	NA	H6WRV7	Salmonella_phage	31.0	1.8e-26
WP_046339073.1|901438_901786_+|tail	tail protein	tail	I6RSL7	Salmonella_phage	38.7	1.5e-14
WP_046339074.1|901823_902474_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	39.3	3.1e-37
WP_046339075.1|902475_903189_+	C40 family peptidase	NA	A0A1W6JP31	Morganella_phage	44.3	2.5e-51
WP_052719259.1|903121_903850_+|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	40.9	3.2e-30
WP_046339077.1|903851_907505_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	37.8	1.7e-143
WP_080940322.1|907518_909216_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	64.3	5.3e-137
WP_046339079.1|909838_910300_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	57.6	3.2e-44
914593:914638	attR	CTTCTAAGCCGTAGGTCATTGGTTCGAATCCAATAGGGCGTGCCAT	NA	NA	NA	NA
>prophage 3
NZ_CP004391	Pasteurella multocida subsp. multocida OH4807, complete genome	2079121	1200089	1209565	2079121		Bacillus_virus(33.33%)	9	NA	NA
WP_046339331.1|1200089_1201367_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	45.3	2.2e-90
WP_046340145.1|1201406_1202027_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_046339332.1|1202026_1202914_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_046339333.1|1202983_1203931_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.1	1.9e-43
WP_052719273.1|1204037_1205702_-	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	48.7	6.2e-21
WP_046339335.1|1205900_1206692_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.2	2.3e-13
WP_046339336.1|1206703_1207489_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_046339337.1|1207566_1208547_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.4	4.6e-16
WP_046339338.1|1208569_1209565_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	6.1e-16
>prophage 4
NZ_CP004391	Pasteurella multocida subsp. multocida OH4807, complete genome	2079121	1265621	1277442	2079121	tRNA	Bacillus_phage(14.29%)	11	NA	NA
WP_046339387.1|1265621_1267346_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	6.1e-64
WP_046339388.1|1267426_1268110_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_155392685.1|1268280_1269378_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	42.4	2.2e-06
WP_046339389.1|1269439_1270945_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	37.5	7.7e-87
WP_046339390.1|1270994_1271666_+	acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
WP_046339391.1|1271808_1272483_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	46.8	1.4e-51
WP_046339392.1|1272485_1272911_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	41.8	3.0e-20
WP_046339393.1|1272916_1273546_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A218M2Y8	Acidovorax_phage	34.4	4.9e-11
WP_046339394.1|1273781_1274537_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_046339395.1|1274613_1275396_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_046339396.1|1275462_1277442_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	26.4	8.7e-30
