The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007559	Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 chromosome, complete genome	4790388	1689790	1698961	4790388	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1689790_1690738_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1690721_1691453_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1691433_1691541_-	protein YohO	NA	NA	NA	NA	NA
WP_001240417.1|1691600_1692332_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1692554_1694240_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1694236_1694956_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1695002_1695470_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1695526_1696057_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1696228_1696687_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195330.1|1696927_1698961_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 2
NZ_CP007559	Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 chromosome, complete genome	4790388	1767052	1777559	4790388		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111847.1|1767052_1768456_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981471.1|1768633_1769527_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1769903_1770989_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023659.1|1770988_1771888_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857530.1|1771935_1772814_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_000973714.1|1772814_1773366_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000018224.1|1773371_1774346_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1774361_1775135_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565902.1|1775139_1776219_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000126351.1|1776245_1777559_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 3
NZ_CP007559	Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 chromosome, complete genome	4790388	1870692	1881309	4790388		Morganella_phage(25.0%)	12	NA	NA
WP_001219016.1|1870692_1871166_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	76.6	1.6e-38
WP_001669246.1|1871812_1872103_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	5.2e-08
WP_000598920.1|1872474_1873272_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001537372.1|1873752_1873914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1874040_1874460_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1874462_1875731_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1876186_1876399_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1876409_1876598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080675.1|1876857_1878069_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.0	1.3e-108
WP_000107435.1|1878718_1879030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377047.1|1879109_1879805_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	7.3e-08
WP_001157308.1|1879878_1881309_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 4
NZ_CP007559	Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 chromosome, complete genome	4790388	2609182	2683598	4790388	capsid,tRNA,holin,portal,head,tail,protease,plate,integrase,terminase	Salmonella_phage(68.0%)	97	2629821:2629837	2683117:2683133
WP_162264798.1|2609182_2609701_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|2609697_2609805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2610010_2610457_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2610436_2611231_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|2611331_2612516_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|2612634_2612982_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487129.1|2612967_2613279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|2613347_2613599_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2613794_2613893_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2614031_2614280_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001669273.1|2614593_2615235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2615464_2615647_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2615649_2616012_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2616184_2616823_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617979.1|2617019_2617565_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908466.1|2617647_2617803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|2617881_2618130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|2618384_2619233_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001562706.1|2619301_2619895_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175807.1|2620039_2620828_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_001537483.1|2620936_2621584_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|2621780_2622107_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_000456065.1|2622300_2623434_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947460.1|2623515_2624106_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950203.1|2624099_2624897_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000966649.1|2624890_2625703_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001669523.1|2625692_2626667_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946082.1|2626666_2628301_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2628981_2629296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929980.1|2629444_2629975_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
2629821:2629837	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
WP_000761747.1|2630057_2631101_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001218118.1|2631439_2631907_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927825.1|2632104_2632332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|2632531_2632657_-	lipoprotein	NA	NA	NA	NA	NA
WP_000977725.1|2633034_2633379_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|2634600_2635158_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_012664625.1|2635969_2636233_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2636364_2636577_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|2636990_2637512_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|2637702_2637942_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033398.1|2638431_2639220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917256.1|2640211_2641336_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_077918985.1|2641783_2641996_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
WP_046376790.1|2642249_2642921_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.6e-81
WP_046376791.1|2643308_2644439_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.1	1.0e-35
WP_046376792.1|2644492_2645023_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	79.0	9.0e-75
WP_001207832.1|2646367_2646955_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_046376793.1|2646957_2648037_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	5.0e-205
WP_000605051.1|2648029_2648443_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273652.1|2648447_2648981_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	98.3	5.5e-96
WP_046376794.1|2648980_2650039_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.4	1.5e-201
WP_023250594.1|2650035_2651376_-|tail	tail/DNA circulation protein	tail	A0A192Y5U9	Salmonella_phage	98.7	1.6e-248
WP_046376795.1|2651409_2653338_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.1	0.0e+00
WP_000588852.1|2653422_2653749_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_046376796.1|2653745_2654102_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	3.8e-61
WP_001007996.1|2654101_2655598_-|tail	tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_065305452.1|2655587_2655752_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	98.1	1.1e-23
WP_046376797.1|2655755_2656316_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	98.9	6.8e-105
WP_001135697.1|2656312_2656825_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702410.1|2656796_2657201_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_000927378.1|2657197_2657521_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2657523_2657724_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_023231285.1|2657774_2658980_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	99.8	1.2e-223
WP_001193639.1|2658994_2659645_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2659622_2660864_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2660863_2661046_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088185.1|2661057_2662791_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
WP_000929191.1|2662787_2663282_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_023227968.1|2663405_2663756_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	8.9e-63
WP_046376798.1|2663808_2664003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024148265.1|2664533_2664926_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	84.6	1.3e-51
WP_023219694.1|2664915_2665386_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	96.8	8.5e-85
WP_023219695.1|2665389_2665725_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	95.5	7.7e-56
WP_001037093.1|2666058_2666577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163088.1|2666582_2667467_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_023219696.1|2667488_2667836_-	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	90.0	1.2e-56
WP_024147466.1|2667853_2668843_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	96.0	5.1e-188
WP_046376800.1|2668850_2669711_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.0	7.8e-161
WP_023219699.1|2669727_2670117_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	85.3	2.4e-61
WP_046376801.1|2670113_2670767_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	88.5	2.7e-113
WP_023252186.1|2670766_2671249_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.1	4.6e-86
WP_046376802.1|2671250_2672225_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	82.1	2.8e-122
WP_000620702.1|2672221_2672446_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_046376803.1|2672442_2673585_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	88.2	8.7e-184
WP_000509731.1|2673581_2674136_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2674164_2674389_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|2674486_2675182_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000997190.1|2675994_2676366_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_046376804.1|2676423_2677251_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.2	1.6e-150
WP_000008351.1|2677387_2677927_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000089141.1|2678069_2678306_+	excisionase	NA	NA	NA	NA	NA
WP_046376805.1|2678295_2679438_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.0	3.1e-173
WP_000444509.1|2679551_2680802_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_046376806.1|2680973_2681639_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825956.1|2681635_2681965_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000476065.1|2681976_2682438_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|2682491_2683598_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2683117:2683133	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 5
NZ_CP007559	Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 chromosome, complete genome	4790388	2828403	2928774	4790388	capsid,lysis,transposase,tRNA,holin,portal,head,tail,protease,integrase,terminase	Enterobacteria_phage(32.08%)	98	2852494:2852513	2925847:2925866
WP_000938182.1|2828403_2829084_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	9.8e-82
WP_000374046.1|2829702_2830362_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2830448_2830778_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2830774_2831056_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2831104_2831884_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859429.1|2831909_2832458_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140482.1|2832672_2833884_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2833941_2834259_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2834303_2834717_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847732.1|2834890_2835553_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2835647_2836106_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420513.1|2836141_2838196_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.1e-19
WP_001261222.1|2838319_2838766_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2838784_2840938_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_046376809.1|2840924_2841530_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2841746_2842256_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|2842612_2843665_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2843735_2844188_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2844373_2846134_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2846202_2846721_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2846820_2846988_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2847243_2847807_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|2847803_2849444_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2849448_2850702_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2850716_2852624_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2852494:2852513	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2852636_2854745_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224072.1|2854843_2855953_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2855949_2856492_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2856657_2857668_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193772.1|2857875_2860488_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000497440.1|2860914_2861121_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
WP_001536069.1|2861596_2862397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010835411.1|2862964_2864455_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	98.6	1.6e-254
WP_000143168.1|2865284_2865866_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.3e-94
WP_024792694.1|2865865_2868067_-|tail	tail protein	tail	E5G6P0	Salmonella_phage	76.1	6.5e-159
WP_000178849.1|2868120_2868363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514902.1|2868401_2871764_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.5	0.0e+00
WP_001750110.1|2871825_2872473_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	1.6e-89
WP_000662738.1|2872370_2873108_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.2	9.8e-128
WP_001152686.1|2873114_2873813_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	1.6e-103
WP_000447370.1|2873822_2874152_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_000372075.1|2874154_2877250_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.7	4.8e-277
WP_010989052.1|2877221_2877560_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2877556_2877952_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2878002_2878749_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2878756_2879158_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000677089.1|2879154_2879733_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817265.1|2879841_2880972_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	98.1	4.0e-213
WP_000083292.1|2881004_2881388_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.2e-28
WP_000201486.1|2881398_2881758_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2881815_2882844_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2882898_2883246_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189495.1|2883258_2884755_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.9	3.3e-98
WP_046376810.1|2884744_2886325_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.6	1.1e-187
WP_000201416.1|2886321_2886525_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	70.8	2.1e-16
WP_000623086.1|2886508_2888440_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.4	2.0e-257
WP_001102153.1|2888411_2888957_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669693.1|2889242_2889644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2889879_2890332_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984587.1|2890349_2890802_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	5.1e-79
WP_001574216.1|2890785_2891115_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110788.1|2891390_2892077_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM2	Phage_Gifsy-1	98.7	5.1e-131
WP_000798706.1|2892437_2892887_+	lipoprotein	NA	NA	NA	NA	NA
WP_001534733.1|2893022_2893148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047630.1|2893546_2894344_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
WP_001617856.1|2894333_2894480_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_000784707.1|2894476_2894704_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	76.8	6.6e-19
WP_000940758.1|2894700_2895300_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	6.1e-96
WP_024135617.1|2895363_2895669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100148602.1|2895888_2896269_-	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	51.5	7.5e-23
WP_000089413.1|2896809_2897205_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	39.3	2.0e-18
WP_000788952.1|2897222_2897975_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	77.0	1.7e-103
WP_046376811.1|2897981_2898851_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	58.5	1.2e-31
WP_001669257.1|2898895_2899390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033909.1|2899376_2899631_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
WP_001224472.1|2899727_2900153_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
WP_024135615.1|2900596_2900776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046376812.1|2901206_2901491_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	3.0e-08
WP_023205995.1|2901512_2901863_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	96.6	3.2e-60
WP_023204245.1|2901989_2904917_+	gifsy-1 prophage RecE	NA	S4TNL0	Salmonella_phage	99.1	0.0e+00
WP_001539618.1|2904879_2906037_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2906079_2906319_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2906359_2906608_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2906652_2907945_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191406.1|2908139_2909342_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893197.1|2909422_2910856_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544853.1|2911101_2912316_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762343.1|2912632_2913094_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2913294_2914695_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977709.1|2915301_2916393_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000462653.1|2916577_2917768_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|2917829_2918477_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|2918504_2919053_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925875.1|2919312_2921160_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572746.1|2921504_2925971_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
2925847:2925866	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060024.1|2925970_2926675_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|2926655_2927978_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154027.1|2927970_2928774_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP007559	Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 chromosome, complete genome	4790388	2979306	2986619	4790388	protease	Ralstonia_phage(16.67%)	7	NA	NA
WP_001669319.1|2979306_2979684_+	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	41.0	2.6e-20
WP_001117983.1|2979845_2980043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2980255_2982532_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2982562_2982883_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2983206_2983428_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|2983557_2985504_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_001201751.1|2985500_2986619_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 7
NZ_CP007559	Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 chromosome, complete genome	4790388	4073732	4082680	4790388	integrase	Enterobacteria_phage(83.33%)	11	4070957:4070973	4082850:4082866
4070957:4070973	attL	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
WP_000783715.1|4073732_4076066_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	85.3	0.0e+00
WP_000743145.1|4076080_4076401_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216597.1|4076397_4076625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979749.1|4076621_4077173_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.5	1.2e-29
WP_000556587.1|4077169_4077436_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_162295697.1|4077540_4077669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082772.1|4077910_4078720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000468231.1|4078723_4078963_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	2.4e-19
WP_000214429.1|4078978_4079545_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	7.9e-61
WP_000775190.1|4079983_4080925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772664.1|4081411_4082680_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	5.7e-75
4082850:4082866	attR	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
>prophage 8
NZ_CP007559	Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 chromosome, complete genome	4790388	4337040	4368467	4790388	capsid,lysis,tRNA,tail,integrase,terminase	Edwardsiella_phage(25.0%)	36	4332775:4332790	4361664:4361679
4332775:4332790	attL	GGTGGATGCGCATATT	NA	NA	NA	NA
WP_046376831.1|4337040_4338078_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_046376832.1|4338168_4339251_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	70.8	2.2e-152
WP_046376833.1|4339375_4340932_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_046376834.1|4341002_4341857_-	protein YibB	NA	NA	NA	NA	NA
WP_046376835.1|4342007_4342583_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.4	9.7e-91
WP_046376836.1|4342582_4344034_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	70.7	1.5e-42
WP_001181748.1|4344023_4344626_-	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	4.3e-33
WP_001293657.1|4344627_4345869_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_046376837.1|4345865_4346222_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	9.5e-20
WP_046376838.1|4346234_4346912_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	34.1	5.6e-29
WP_046376839.1|4346892_4347762_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	33.1	2.4e-32
WP_046376840.1|4347758_4348061_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.0	4.1e-24
WP_046376842.1|4348833_4351056_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	59.2	1.0e-50
WP_046376843.1|4351039_4351222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046376844.1|4351263_4351668_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	45.7	2.4e-19
WP_046376845.1|4351667_4352114_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	3.7e-21
WP_046376846.1|4352114_4353599_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.8	1.5e-95
WP_046376847.1|4353579_4354125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046376848.1|4354109_4354475_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	2.3e-21
WP_046376849.1|4354471_4355056_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	9.4e-17
WP_046376850.1|4355049_4355505_-	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	46.0	7.3e-17
WP_046376851.1|4355511_4355859_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
WP_046376852.1|4355862_4356891_-	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.4	3.3e-81
WP_046376853.1|4356890_4357373_-	hypothetical protein	NA	A0A2R3UAX9	Myoviridae_environmental_samples	47.2	5.4e-26
WP_046376854.1|4357374_4358721_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.9	2.9e-69
WP_046376855.1|4358717_4359407_-|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	49.1	1.3e-57
WP_046376856.1|4359447_4360968_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.7	5.3e-104
WP_046376891.1|4360967_4362587_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	78.8	8.4e-257
4361664:4361679	attR	AATATGCGCATCCACC	NA	NA	NA	NA
WP_046376857.1|4362592_4363165_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	62.5	5.0e-55
WP_046376858.1|4363187_4363685_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.4	1.3e-46
WP_046376859.1|4363785_4364325_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	75.1	4.2e-80
WP_046376860.1|4364302_4364608_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_112041632.1|4364871_4364931_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_046376861.1|4364991_4365177_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_046376892.1|4365473_4365899_-	antitermination protein Q	NA	B6SCY2	Bacteriophage	41.5	7.3e-19
WP_102017351.1|4366433_4368467_-	replication protein	NA	B6SCY1	Bacteriophage	62.5	2.1e-148
>prophage 9
NZ_CP007559	Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 chromosome, complete genome	4790388	4373278	4383920	4790388		Bacteriophage(40.0%)	14	NA	NA
WP_046376868.1|4373278_4374562_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	48.8	3.3e-107
WP_046376869.1|4374585_4375134_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	68.1	9.3e-67
WP_046376870.1|4375183_4375819_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	89.3	1.5e-97
WP_046376871.1|4375808_4376030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046376873.1|4376748_4377420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052742818.1|4377759_4378587_+	hypothetical protein	NA	A0A0P0J0J7	Acinetobacter_phage	55.0	6.6e-24
WP_077918992.1|4378739_4380713_+	DNA polymerase	NA	B6SCX5	Bacteriophage	65.4	1.9e-21
WP_157934875.1|4380736_4380877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046376875.1|4380946_4381165_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046376876.1|4381161_4381431_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	65.2	1.3e-26
WP_046376877.1|4381427_4381658_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	40.0	2.7e-07
WP_046376878.1|4381654_4382272_+	HNH endonuclease	NA	A0A1S5SAI9	Streptococcus_phage	29.4	2.9e-08
WP_046376879.1|4382274_4383672_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.2	1.6e-211
WP_046376880.1|4383668_4383920_+	pyocin activator protein PrtN, phage related protein	NA	K7PGU0	Enterobacteria_phage	56.4	3.3e-19
>prophage 10
NZ_CP007559	Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 chromosome, complete genome	4790388	4409690	4428004	4790388	plate,tail	Burkholderia_phage(45.0%)	23	NA	NA
WP_000615248.1|4409690_4410038_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4410614_4410902_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|4410904_4411510_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|4411522_4411837_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4411996_4412452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4412448_4412646_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4412635_4414063_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4414062_4414587_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4414638_4414956_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4414915_4415044_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_046376881.1|4415140_4417495_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.4	2.2e-64
WP_000271423.1|4417494_4418448_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4418447_4418657_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4418644_4419688_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679393.1|4419697_4420420_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4420747_4421110_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4421106_4422036_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632051.1|4422035_4423583_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	8.5e-49
WP_001093501.1|4423746_4424106_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951725.1|4424096_4425212_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	6.9e-101
WP_000359503.1|4425204_4425837_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000368192.1|4425839_4427300_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	38.8	1.2e-76
WP_000493812.1|4427302_4428004_+	DUF4376 domain-containing protein	NA	X2KPE1	Enterobacteria_phage	38.6	2.1e-23
>prophage 11
NZ_CP007559	Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 chromosome, complete genome	4790388	4546634	4612415	4790388	capsid,lysis,portal,head,tail,protease,plate,integrase,terminase	Salmonella_phage(40.91%)	78	4576490:4576536	4607469:4607515
WP_000208240.1|4546634_4547165_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|4547174_4548506_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139637.1|4548572_4549502_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|4549594_4550080_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|4550301_4550541_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|4550939_4551785_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|4551805_4553314_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250617.1|4553425_4554436_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796293.1|4554532_4555279_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155229.1|4555384_4555813_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802242.1|4555913_4556510_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|4556622_4557390_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001088053.1|4557481_4558246_-	epimerase	NA	NA	NA	NA	NA
WP_001543603.1|4558255_4558546_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774146.1|4558628_4559504_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|4559532_4560555_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|4560583_4561585_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911133.1|4561581_4562625_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167248.1|4562618_4564154_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|4564409_4565369_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|4565455_4567048_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173080.1|4567061_4567412_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000621104.1|4567501_4567633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519915.1|4567910_4568633_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557881.1|4568695_4569736_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_000646510.1|4569745_4570705_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777320.1|4570715_4572050_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750762.1|4572312_4573068_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|4573168_4574158_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|4574361_4575324_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|4575508_4576411_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4576490:4576536	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000933379.1|4576697_4577114_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	52.3	1.8e-33
WP_000468311.1|4577148_4577367_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_000627818.1|4577444_4578614_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	95.6	1.4e-205
WP_000978869.1|4578610_4579096_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	94.4	5.9e-81
WP_000069524.1|4579107_4581549_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	93.1	0.0e+00
WP_085984508.1|4581541_4581697_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029727.1|4581693_4582029_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_001207676.1|4582091_4582610_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
WP_001279030.1|4582625_4583813_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
WP_000874698.1|4583947_4584517_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.8	3.0e-92
WP_000104695.1|4584516_4586259_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	97.1	1.5e-267
WP_001000070.1|4586269_4586800_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	100.0	1.9e-104
WP_000246674.1|4586792_4587701_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	98.7	1.7e-158
WP_000127150.1|4587707_4588055_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
WP_001093789.1|4588051_4588693_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	85.0	2.4e-98
WP_046376897.1|4588769_4590113_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_000997680.1|4590150_4590618_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.8	9.8e-49
WP_000277800.1|4590610_4591078_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.0	2.2e-56
WP_000849743.1|4591185_4591599_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.9	8.4e-36
WP_000534554.1|4591595_4592105_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
WP_000524754.1|4592088_4592310_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_001100637.1|4592300_4592504_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000177982.1|4592503_4593004_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_000224816.1|4593101_4593860_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	67.1	2.7e-80
WP_001224307.1|4593863_4595024_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.5	2.8e-129
WP_001074705.1|4595055_4595919_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	64.8	4.5e-100
WP_000214048.1|4596083_4597853_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.0	3.2e-286
WP_000039235.1|4597852_4598890_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.7	7.7e-163
WP_000551923.1|4599410_4599602_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	100.0	1.1e-27
WP_000042036.1|4599600_4600032_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	100.0	1.1e-75
WP_000680929.1|4600165_4601206_+	Fic family protein	NA	S4TP71	Salmonella_phage	100.0	6.3e-197
WP_000037667.1|4601202_4601400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257582.1|4601578_4603855_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	88.0	0.0e+00
WP_000027647.1|4603844_4604120_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	72.5	7.0e-31
WP_001113578.1|4604116_4604341_-	hypothetical protein	NA	A0A0F7LDG9	Escherichia_phage	75.7	2.0e-23
WP_000557712.1|4604642_4604867_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	78.4	3.4e-23
WP_001670778.1|4604930_4605431_-	hypothetical protein	NA	M1SV55	Escherichia_phage	91.0	1.8e-85
WP_001583792.1|4605600_4605873_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	87.8	1.0e-42
WP_001099751.1|4606009_4606303_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	75.3	1.6e-36
WP_000985251.1|4606372_4607353_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	96.0	1.5e-179
WP_001233463.1|4607537_4608038_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4607469:4607515	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|4608188_4608887_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|4608883_4610257_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000338672.1|4610304_4610508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133442.1|4610628_4611024_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011233226.1|4611035_4611788_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|4611794_4612415_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
