The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010440	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4621164	1011391	1060074	4621164	integrase,transposase	Streptococcus_phage(20.0%)	48	1025877:1025936	1060184:1060243
WP_000006255.1|1011391_1011889_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|1012112_1013852_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|1013796_1014582_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|1014652_1015708_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|1015759_1016053_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|1016055_1016454_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|1016463_1016916_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|1017221_1017488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|1017420_1017957_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|1018013_1019471_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1019731_1020190_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|1020281_1021526_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|1021583_1021985_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|1022023_1023079_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|1023366_1024470_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|1024481_1025735_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
1025877:1025936	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|1026306_1026648_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|1026668_1026986_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|1027004_1027226_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|1027234_1027711_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|1027726_1028185_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|1028282_1028522_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|1028598_1029066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|1029088_1029532_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|1029531_1029759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|1030162_1030984_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|1031075_1031939_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|1032267_1033161_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|1033581_1034733_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|1037079_1038096_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|1038303_1039707_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|1039693_1040626_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|1040734_1041781_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|1043002_1043341_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|1043363_1043714_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|1043807_1044962_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|1045256_1046165_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|1046179_1048147_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000406871.1|1049766_1051377_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|1051381_1052140_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|1052278_1053283_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|1054477_1055209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|1055299_1055926_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|1056197_1056896_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|1056922_1057777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|1057895_1058120_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|1058116_1058557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|1058673_1060074_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
1060184:1060243	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP010440	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4621164	1279671	1340008	4621164	protease,integrase,terminase,tRNA,transposase	Enterobacteria_phage(43.48%)	61	1325287:1325333	1343968:1344014
WP_001295836.1|1279671_1280295_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1280265_1280952_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|1280948_1283363_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|1283793_1288074_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|1288113_1288482_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|1289172_1289433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|1290664_1291759_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1291827_1292754_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|1292983_1293466_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1293543_1294359_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|1294448_1296230_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|1296242_1297019_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1297118_1297997_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|1298165_1299620_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|1299679_1301041_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|1301097_1302399_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|1302420_1303566_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_038432500.1|1303775_1304579_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|1304589_1305825_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|1305846_1306896_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|1307211_1308879_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|1308888_1310148_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|1310158_1310974_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|1310970_1311864_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|1312058_1313126_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1313122_1313632_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|1313749_1314472_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|1314474_1314969_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|1315142_1316528_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|1316563_1317085_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1317192_1317405_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1317406_1318273_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1318743_1319286_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1319505_1320198_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|1320228_1322832_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|1322810_1323851_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|1323861_1324377_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1324379_1325012_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1325287:1325333	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|1325346_1326510_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|1326629_1326893_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|1327215_1327311_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|1327373_1327673_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|1327669_1328536_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|1328846_1329179_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|1329226_1329376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1329433_1330960_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|1331424_1331976_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1331985_1332783_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1332899_1333001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|1332997_1333453_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|1333452_1333623_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|1333615_1333906_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|1333902_1334265_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1334261_1334402_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|1334487_1334871_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|1335268_1336285_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000079503.1|1336317_1336728_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|1337013_1337220_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1337384_1337579_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_071842869.1|1338888_1339290_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	97.7	7.8e-63
WP_001027248.1|1339264_1340008_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
1343968:1344014	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP010440	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4621164	1951527	1972917	4621164	integrase,plate,tail,portal,tRNA	Shigella_phage(26.32%)	29	1943522:1943536	1979620:1979634
1943522:1943536	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|1951527_1952634_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1952687_1953149_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1953158_1953812_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1953983_1955234_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1955727_1956393_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001257372.1|1957554_1958448_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|1958538_1959666_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_148935650.1|1959927_1960239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1960355_1960697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1960634_1960943_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1961117_1961792_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1961882_1962083_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1962126_1962684_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1962859_1963039_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1963028_1964396_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1964407_1964590_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1964589_1965063_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1964989_1965781_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1965771_1966356_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_024184299.1|1966652_1967147_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000548498.1|1967146_1967749_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_010723096.1|1967720_1968134_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000905001.1|1968542_1969097_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1969203_1970037_+	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000943927.1|1970270_1970435_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1970537_1970861_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1971397_1971508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1971560_1971965_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1972185_1972917_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1979620:1979634	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP010440	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4621164	2163683	2227629	4621164	integrase,tail,tRNA,lysis,transposase	Escherichia_phage(40.62%)	60	2154343:2154361	2184717:2184735
2154343:2154361	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000628058.1|2163683_2164916_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2165170_2166154_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2166631_2168005_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|2168133_2169069_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|2169120_2170356_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2170357_2170573_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2170651_2170861_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2170853_2171048_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2171104_2171914_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|2171906_2174507_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|2174608_2174884_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2174958_2175129_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|2175128_2175350_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|2175791_2176280_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2176276_2176432_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|2176885_2177362_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|2177485_2177782_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|2177804_2178227_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|2178239_2179097_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|2179103_2179850_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|2179872_2180433_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|2180520_2180706_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2180902_2182360_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|2182496_2182760_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|2182740_2183100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|2184865_2185846_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2184717:2184735	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_071842875.1|2186168_2189531_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	6.2e-12
WP_001698950.1|2189530_2190106_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|2190203_2190794_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|2191110_2191344_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|2191412_2191526_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|2192304_2192739_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|2192879_2194013_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_000628244.1|2194379_2197904_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|2198177_2198444_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|2198440_2198863_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762236.1|2198973_2199963_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_046377550.1|2200170_2202750_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|2202806_2202992_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001300734.1|2202999_2203326_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067514.1|2203497_2204403_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|2204638_2206138_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535469.1|2206195_2208469_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186469.1|2208716_2210762_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191077.1|2211046_2211976_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|2211987_2212275_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072837.1|2212283_2213030_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189201.1|2213044_2213542_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206388.1|2213549_2214620_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292353.1|2214616_2215384_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969784.1|2215383_2216172_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973360.1|2216173_2217601_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|2217590_2218013_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206197.1|2218012_2219218_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632280.1|2219244_2220558_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039887.1|2220658_2221609_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123464.1|2221590_2222181_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_010723099.1|2222284_2222350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|2225040_2226314_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001254932.1|2226477_2227629_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 5
NZ_CP010440	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4621164	2386564	2405775	4621164	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|2386564_2388025_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|2388113_2389397_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2390001_2390115_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|2390183_2390417_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000078177.1|2390733_2391324_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|2391421_2391997_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|2391996_2392959_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|2392909_2393479_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|2393867_2394101_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2394158_2394569_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2394720_2394894_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2395065_2395221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2395299_2395365_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2395367_2395556_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2395566_2395779_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2396141_2396639_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2396635_2397169_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2397165_2397477_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2397481_2397697_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2398450_2398666_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2398966_2399179_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2399233_2399323_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2399600_2400353_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|2400366_2401416_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2401417_2401696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2401762_2402014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2402230_2402386_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2402457_2402745_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2402744_2402984_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2403008_2403314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2403516_2403849_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|2404285_2404435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2404731_2404962_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2405045_2405453_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2405619_2405775_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 6
NZ_CP010440	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4621164	3222365	3233576	4621164	tail,integrase	Enterobacteria_phage(50.0%)	17	3220340:3220356	3237251:3237267
3220340:3220356	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|3222365_3223298_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|3223609_3224767_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|3224919_3225282_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|3225278_3226199_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|3226195_3227527_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|3227561_3227843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|3228141_3228582_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|3228608_3229127_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|3229176_3229452_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|3229451_3229946_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|3229942_3230311_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|3230669_3231032_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|3231097_3231922_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|3232049_3232586_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|3232576_3232939_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|3232938_3233244_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|3233375_3233576_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
3237251:3237267	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 7
NZ_CP010440	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4621164	3607707	3614846	4621164		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|3607707_3610269_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|3610374_3611031_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272547.1|3611081_3611879_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000848004.1|3612044_3612953_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|3612949_3614116_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278991.1|3614207_3614846_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	3.1e-82
