The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010441	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4607634	1008835	1057519	4607634	transposase,integrase	Streptococcus_phage(20.0%)	49	1023321:1023380	1057629:1057688
WP_000006255.1|1008835_1009333_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|1009556_1011296_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|1011240_1012026_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|1012096_1013152_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|1013203_1013497_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|1013499_1013898_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|1013907_1014360_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|1014665_1014932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|1014864_1015401_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|1015457_1016915_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1017175_1017634_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|1017725_1018970_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|1019027_1019429_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|1019467_1020523_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|1020810_1021914_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|1021925_1023179_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
1023321:1023380	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|1023750_1024092_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|1024112_1024430_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|1024448_1024670_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|1024678_1025155_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|1025170_1025629_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|1025726_1025966_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|1026042_1026510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|1026532_1026976_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|1026975_1027203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|1027606_1028428_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|1028519_1029383_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|1029711_1030605_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|1031025_1032177_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|1034523_1035540_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|1035747_1037151_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|1037137_1038070_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|1038178_1039225_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|1040446_1040785_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|1040807_1041158_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|1041251_1042406_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|1042700_1043609_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|1043623_1045591_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|1045817_1047200_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|1047211_1048822_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|1048826_1049585_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|1049723_1050728_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|1051922_1052654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|1052744_1053371_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|1053642_1054341_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|1054367_1055222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|1055340_1055565_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|1055561_1056002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|1056118_1057519_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
1057629:1057688	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP010441	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4607634	1279468	1342427	4607634	terminase,tRNA,transposase,protease,integrase,lysis	Enterobacteria_phage(50.0%)	66	1325085:1325131	1346387:1346433
WP_001295836.1|1279468_1280092_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1280062_1280749_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|1280745_1283160_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|1283590_1287871_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|1287910_1288279_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|1288969_1289230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|1290461_1291556_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1291624_1292551_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|1292780_1293263_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1293340_1294156_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|1294245_1296027_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|1296039_1296816_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1296915_1297794_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|1297962_1299417_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|1299476_1300838_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|1300894_1302196_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|1302217_1303363_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|1303590_1304376_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|1304386_1305622_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|1305643_1306693_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|1307009_1308677_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|1308686_1309946_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|1309956_1310772_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|1310768_1311662_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|1311856_1312924_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1312920_1313430_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|1313547_1314270_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|1314272_1314767_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|1314940_1316326_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|1316361_1316883_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1316990_1317203_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1317204_1318071_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1318541_1319084_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1319303_1319996_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|1320026_1322630_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|1322608_1323649_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|1323659_1324175_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1324177_1324810_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1325085:1325131	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|1325144_1326308_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|1326427_1326691_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|1327013_1327109_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|1327171_1327471_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|1327467_1328334_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|1328644_1328977_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|1329024_1329174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1329231_1330758_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|1331222_1331774_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1331783_1332581_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1332697_1332799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|1332795_1333251_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|1333250_1333421_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|1333413_1333704_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|1333700_1334063_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1334059_1334200_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|1334285_1334669_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|1335066_1336083_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|1336087_1337155_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|1337727_1337943_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|1337942_1338440_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|1338656_1338839_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|1338929_1339223_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|1339513_1339924_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|1340209_1340416_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1340580_1340775_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|1341163_1341709_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|1341683_1342427_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
1346387:1346433	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP010441	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4607634	2150135	2214081	4607634	tRNA,transposase,integrase,tail,lysis	Escherichia_phage(40.62%)	60	2140795:2140813	2171169:2171187
2140795:2140813	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000628058.1|2150135_2151368_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2151622_2152606_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2153083_2154457_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|2154585_2155521_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|2155572_2156808_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2156809_2157025_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2157103_2157313_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2157305_2157500_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2157556_2158366_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|2158358_2160959_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|2161060_2161336_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2161410_2161581_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|2161580_2161802_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|2162243_2162732_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2162728_2162884_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|2163337_2163814_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|2163937_2164234_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|2164256_2164679_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|2164691_2165549_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|2165555_2166302_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|2166324_2166885_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|2166972_2167158_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2167354_2168812_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|2168948_2169212_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|2169192_2169552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|2171317_2172298_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2171169:2171187	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_071842875.1|2172620_2175983_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	6.2e-12
WP_001698950.1|2175982_2176558_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|2176655_2177246_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|2177562_2177796_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|2177864_2177978_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|2178756_2179191_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|2179331_2180465_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_000628244.1|2180831_2184356_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|2184629_2184896_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|2184892_2185315_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762236.1|2185425_2186415_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_046377550.1|2186622_2189202_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|2189258_2189444_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001300734.1|2189451_2189778_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067514.1|2189949_2190855_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|2191090_2192590_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535469.1|2192647_2194921_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186469.1|2195168_2197214_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191077.1|2197498_2198428_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|2198439_2198727_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072837.1|2198735_2199482_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189201.1|2199496_2199994_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206388.1|2200001_2201072_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292353.1|2201068_2201836_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969784.1|2201835_2202624_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973360.1|2202625_2204053_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|2204042_2204465_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206197.1|2204464_2205670_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632280.1|2205696_2207010_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039887.1|2207110_2208061_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123464.1|2208042_2208633_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_010723099.1|2208736_2208802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|2211492_2212766_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001254932.1|2212929_2214081_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 4
NZ_CP010441	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4607634	2373023	2392234	4607634	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|2373023_2374484_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|2374572_2375856_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2376460_2376574_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|2376642_2376876_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000078177.1|2377192_2377783_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|2377880_2378456_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|2378455_2379418_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|2379368_2379938_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|2380326_2380560_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2380617_2381028_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2381179_2381353_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2381524_2381680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2381758_2381824_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2381826_2382015_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2382025_2382238_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2382600_2383098_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2383094_2383628_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2383624_2383936_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2383940_2384156_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2384909_2385125_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2385425_2385638_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2385692_2385782_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2386059_2386812_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|2386825_2387875_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2387876_2388155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2388221_2388473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2388689_2388845_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2388916_2389204_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2389203_2389443_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2389467_2389773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2389975_2390308_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|2390744_2390894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2391190_2391421_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2391504_2391912_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2392078_2392234_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 5
NZ_CP010441	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4607634	3208831	3220042	4607634	integrase,tail	Enterobacteria_phage(50.0%)	17	3206806:3206822	3223717:3223733
3206806:3206822	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|3208831_3209764_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|3210075_3211233_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|3211385_3211748_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|3211744_3212665_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|3212661_3213993_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|3214027_3214309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|3214607_3215048_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|3215074_3215593_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|3215642_3215918_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|3215917_3216412_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|3216408_3216777_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|3217135_3217498_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|3217563_3218388_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|3218515_3219052_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|3219042_3219405_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|3219404_3219710_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|3219841_3220042_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
3223717:3223733	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 6
NZ_CP010441	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4607634	3594173	3601312	4607634		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|3594173_3596735_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|3596840_3597497_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272547.1|3597547_3598345_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000848004.1|3598510_3599419_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|3599415_3600582_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278991.1|3600673_3601312_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	3.1e-82
