The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009686	Bacillus cereus strain FORC_005 chromosome, complete genome	5349617	258311	266259	5349617		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|258311_258596_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_044307015.1|258634_260269_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	2.6e-157
WP_000743909.1|260675_262214_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_000833082.1|262598_263924_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.1	6.4e-45
WP_000929885.1|264068_264770_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_000719205.1|264753_266259_+	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.3	5.4e-32
>prophage 2
NZ_CP009686	Bacillus cereus strain FORC_005 chromosome, complete genome	5349617	311832	320208	5349617		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|311832_313140_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170544.1|313228_313948_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|313940_314195_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666786.1|314191_314875_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055562.1|314858_317078_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.6e-163
WP_000879025.1|317062_318478_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262439.1|318583_319624_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000088594.1|319620_320208_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 3
NZ_CP009686	Bacillus cereus strain FORC_005 chromosome, complete genome	5349617	651025	659177	5349617		Bacillus_phage(66.67%)	8	NA	NA
WP_116269190.1|651025_651994_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.9	1.4e-17
WP_000085783.1|652073_652595_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_046392352.1|652760_654152_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.2	1.1e-31
WP_006918011.1|654163_654841_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	1.1e-32
WP_000738879.1|655016_656264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277056.1|656397_656928_+	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	34.3	2.5e-16
WP_025710086.1|656940_657285_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	77.2	4.2e-41
WP_025710085.1|657725_659177_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	54.0	9.8e-140
>prophage 4
NZ_CP009686	Bacillus cereus strain FORC_005 chromosome, complete genome	5349617	1689783	1706577	5349617		Brevibacillus_phage(100.0%)	11	NA	NA
WP_046392570.1|1689783_1690236_+	hypothetical protein	NA	A0A0K2CP30	Brevibacillus_phage	45.8	8.6e-26
WP_000077128.1|1690235_1691324_+	hypothetical protein	NA	A0A0K2CNX7	Brevibacillus_phage	55.8	1.2e-94
WP_046392571.1|1691557_1692028_+	hypothetical protein	NA	A0A0K2CPC8	Brevibacillus_phage	69.4	7.1e-31
WP_000743719.1|1692114_1692357_+	hypothetical protein	NA	A0A0K2CP74	Brevibacillus_phage	55.0	2.1e-18
WP_046392572.1|1692429_1697769_+	hypothetical protein	NA	A0A0K2CPN3	Brevibacillus_phage	26.8	5.4e-143
WP_000068593.1|1697827_1698445_+	S-layer homology domain-containing protein	NA	A0A0K2CPJ2	Brevibacillus_phage	60.7	1.4e-71
WP_046392573.1|1698447_1699521_+	hypothetical protein	NA	A0A0K2CP35	Brevibacillus_phage	40.3	4.1e-74
WP_046392574.1|1699534_1702726_+	M23 family metallopeptidase	NA	A0A0K2CNY2	Brevibacillus_phage	50.0	3.7e-06
WP_046392575.1|1702804_1703521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046392576.1|1703535_1703976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046392577.1|1703991_1706577_+	hypothetical protein	NA	A0A0K2CPJ7	Brevibacillus_phage	44.2	1.6e-31
>prophage 5
NZ_CP009686	Bacillus cereus strain FORC_005 chromosome, complete genome	5349617	1719505	1734070	5349617		Brevibacillus_phage(66.67%)	12	NA	NA
WP_000022193.1|1719505_1720627_+	hypothetical protein	NA	A0A0K2CPP1	Brevibacillus_phage	37.0	7.3e-66
WP_000537240.1|1720638_1721370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000345536.1|1721448_1721892_+	hypothetical protein	NA	A0A0K2CPK2	Brevibacillus_phage	40.6	3.0e-23
WP_001111326.1|1721967_1722459_+	hypothetical protein	NA	A0A0K2CNZ3	Brevibacillus_phage	55.2	2.4e-37
WP_046392583.1|1722499_1723111_+	hypothetical protein	NA	A0A127AW14	Bacillus_phage	51.6	6.3e-48
WP_046392584.1|1723095_1725990_+	hypothetical protein	NA	A0A0K2CPP4	Brevibacillus_phage	30.4	2.2e-13
WP_046392585.1|1726032_1730388_+	DNRLRE domain-containing protein	NA	A0A0K2CP88	Brevibacillus_phage	24.3	1.7e-33
WP_046392586.1|1730957_1731326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000655295.1|1731325_1731703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046392587.1|1731902_1732910_+	LysM peptidoglycan-binding domain-containing protein	NA	D6QWN1	uncultured_phage	36.1	4.1e-28
WP_046392588.1|1732926_1733226_+	hypothetical protein	NA	A0A0K2CPL0	Brevibacillus_phage	58.2	1.1e-21
WP_000540599.1|1733245_1734070_+	hypothetical protein	NA	A7KV11	Bacillus_phage	69.4	1.4e-79
>prophage 6
NZ_CP009686	Bacillus cereus strain FORC_005 chromosome, complete genome	5349617	1742193	1751581	5349617		Brevibacillus_phage(100.0%)	9	NA	NA
WP_000177372.1|1742193_1742901_-	DNA polymerase I	NA	A0A0K2CNW2	Brevibacillus_phage	53.5	7.3e-64
WP_000781409.1|1743069_1743474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002164576.1|1744097_1745492_-	DNA polymerase I	NA	A0A0K2CP19	Brevibacillus_phage	45.6	1.9e-103
WP_000207534.1|1745578_1746238_-	hypothetical protein	NA	A0A0K2CPH8	Brevibacillus_phage	56.9	4.7e-57
WP_001090550.1|1746703_1747261_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CPD2	Brevibacillus_phage	41.1	2.4e-25
WP_046392596.1|1747288_1748365_-	toprim domain-containing protein	NA	A0A0K2CNW6	Brevibacillus_phage	54.0	4.9e-104
WP_046392597.1|1748389_1749682_-	DNA helicase	NA	A0A0K2CP24	Brevibacillus_phage	57.9	2.5e-139
WP_046392598.1|1750161_1750932_-	ATP-binding protein	NA	A0A0K2CNX1	Brevibacillus_phage	48.8	2.0e-62
WP_000277551.1|1750990_1751581_-	helix-turn-helix domain-containing protein	NA	A0A0K2CNS5	Brevibacillus_phage	43.4	2.3e-26
>prophage 7
NZ_CP009686	Bacillus cereus strain FORC_005 chromosome, complete genome	5349617	1926050	1934153	5349617		Bacillus_phage(66.67%)	7	NA	NA
WP_044307235.1|1926050_1927346_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.3	1.3e-13
WP_001194314.1|1927445_1928210_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016122339.1|1928450_1930211_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	9.1e-273
WP_000612413.1|1930296_1930974_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	98.7	2.5e-122
WP_001231629.1|1930970_1932044_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.8	1.4e-186
WP_000818985.1|1932271_1932991_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001258539.1|1933280_1934153_+	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	44.4	2.8e-65
>prophage 8
NZ_CP009686	Bacillus cereus strain FORC_005 chromosome, complete genome	5349617	2545950	2618427	5349617	holin,capsid,terminase,tail,head,bacteriocin,portal,protease,integrase	Bacillus_phage(63.41%)	79	2563132:2563161	2625009:2625038
WP_001071364.1|2545950_2546271_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002024190.1|2546760_2547246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046392719.1|2547557_2548229_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_046392720.1|2548297_2549407_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	78.4	4.1e-146
WP_046392721.1|2549710_2550949_+	collagen-like protein	NA	NA	NA	NA	NA
WP_046392722.1|2551590_2552742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046392723.1|2552779_2552926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016095531.1|2553245_2553599_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	87.1	9.6e-49
WP_046392724.1|2553799_2553991_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SLC2	Bacillus_phage	86.9	8.3e-23
WP_000522030.1|2554047_2554314_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	94.1	2.9e-37
WP_046392726.1|2554535_2555591_+	DnaD domain protein	NA	W8CYG5	Bacillus_phage	41.7	1.1e-58
WP_046392727.1|2555594_2555873_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	60.3	2.3e-13
WP_016512772.1|2555865_2556225_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	51.7	3.5e-30
WP_000717826.1|2556243_2556411_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.4e-13
WP_000109500.1|2556436_2556688_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	37.3	2.2e-07
WP_046392728.1|2556707_2557190_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	47.4	4.4e-20
WP_046392729.1|2557334_2558123_-	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	72.7	5.0e-106
WP_046392730.1|2558451_2558916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046392731.1|2559739_2560309_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	94.3	1.5e-88
WP_046392732.1|2560505_2560973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001123250.1|2562429_2562714_-	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_116344833.1|2563000_2563132_+	DUF3983 domain-containing protein	NA	A0A1B1P7V8	Bacillus_phage	81.4	1.3e-11
2563132:2563161	attL	AATATAGTCCGGCTAGAAAACTAGAGGACA	NA	NA	NA	NA
WP_046392734.1|2563434_2563917_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	80.0	1.1e-68
WP_046392735.1|2563916_2564459_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	90.6	4.3e-88
WP_001170296.1|2564673_2565624_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_046392736.1|2566018_2566720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046392737.1|2567263_2568016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046392738.1|2568059_2568239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046392739.1|2568252_2568504_+	hypothetical protein	NA	A0A288WFY9	Bacillus_phage	41.9	6.0e-05
WP_046392740.1|2568500_2568815_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	53.1	1.7e-09
WP_046392741.1|2568819_2569050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046392742.1|2569042_2569378_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.9	1.0e-52
WP_016125621.1|2569501_2569813_+	hypothetical protein	NA	D2XR14	Bacillus_phage	87.3	1.6e-39
WP_016125622.1|2569809_2571495_+|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	85.9	2.9e-276
WP_046392743.1|2571515_2572667_+|portal	phage portal protein	portal	A8AT96	Listeria_phage	51.1	1.8e-104
WP_000791073.1|2572656_2573382_+|protease	Clp protease ClpP	protease	A0A2H4J8Y7	uncultured_Caudovirales_phage	53.2	1.7e-44
WP_000245092.1|2573408_2574575_+|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	77.7	9.6e-162
WP_016125626.1|2574587_2574881_+	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	78.4	2.4e-37
WP_023522880.1|2574882_2575233_+|head	phage head closure protein	head	D2XR20	Bacillus_phage	87.8	1.9e-52
WP_025710295.1|2575234_2575579_+	hypothetical protein	NA	D2XR21	Bacillus_phage	86.6	2.5e-49
WP_046392744.1|2575575_2575905_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	93.6	7.1e-54
WP_046392745.1|2575905_2576493_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	81.5	8.7e-87
WP_046392746.1|2576497_2576860_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	89.2	2.2e-56
WP_046392747.1|2577090_2578554_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	85.1	4.1e-186
WP_046392748.1|2578771_2580937_+|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A2H4JC82	uncultured_Caudovirales_phage	82.9	9.0e-97
WP_046392749.1|2580978_2582436_+|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	59.5	9.8e-172
WP_046392750.1|2582432_2587532_+	phage minor structural protein	NA	A0A0S2MVB4	Bacillus_phage	58.4	0.0e+00
WP_046392751.1|2587543_2587924_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	71.7	2.9e-43
WP_046392752.1|2587958_2588384_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	97.2	6.3e-71
WP_046392753.1|2588383_2589100_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	94.5	8.1e-87
WP_046392754.1|2589294_2590767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046392755.1|2590901_2591486_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_046392756.1|2591637_2591916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116344820.1|2592305_2593988_+	RNAseH domain-containing protein	NA	NA	NA	NA	NA
WP_044307542.1|2594194_2594962_+	DUF3959 family protein	NA	NA	NA	NA	NA
WP_000905571.1|2595106_2595523_+	DUF3995 domain-containing protein	NA	NA	NA	NA	NA
WP_000878369.1|2595643_2595847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362067.1|2596176_2596389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025710280.1|2596598_2597603_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_000282680.1|2597748_2598153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046392757.1|2598312_2599548_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000106383.1|2599815_2601099_+	MFS transporter	NA	NA	NA	NA	NA
WP_046392758.1|2601088_2601721_+	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	42.4	2.7e-25
WP_000046095.1|2601791_2601947_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_044307539.1|2602048_2602546_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016122580.1|2602686_2603901_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000954432.1|2604009_2604588_+	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_000766385.1|2604763_2605615_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_046392759.1|2606065_2607853_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_044307537.1|2608087_2610214_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_046392760.1|2610310_2610820_+	signal peptidase I	NA	NA	NA	NA	NA
WP_000932145.1|2611079_2612267_+	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	24.1	8.9e-06
WP_044307535.1|2612357_2613038_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_001038210.1|2613447_2613996_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044307534.1|2614006_2615707_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.4	4.0e-15
WP_000556373.1|2615699_2616500_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000120182.1|2616636_2616744_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_046392761.1|2616836_2618105_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	2.0e-24
WP_080342248.1|2618241_2618427_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A090EUH1	Clostridium_phage	53.3	1.2e-10
2625009:2625038	attR	AATATAGTCCGGCTAGAAAACTAGAGGACA	NA	NA	NA	NA
>prophage 9
NZ_CP009686	Bacillus cereus strain FORC_005 chromosome, complete genome	5349617	3641246	3651404	5349617	bacteriocin	Bacillus_phage(54.55%)	14	NA	NA
WP_000413738.1|3641246_3641867_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
WP_006920048.1|3641957_3642761_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000031384.1|3642761_3643304_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_001102628.1|3643296_3643620_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000392444.1|3643991_3644222_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	73.7	1.5e-23
WP_016123244.1|3644283_3645180_-	hypothetical protein	NA	A0A0S2MVR5	Bacillus_phage	52.1	4.6e-79
WP_006920050.1|3645452_3646295_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	47.7	6.1e-33
WP_033692154.1|3646413_3647400_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	43.9	1.7e-34
WP_000464425.1|3647638_3648025_-	DUF1492 domain-containing protein	NA	A0A288WG73	Bacillus_phage	71.4	2.6e-47
WP_033696536.1|3648143_3649010_-	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	63.0	1.2e-95
WP_001189065.1|3649162_3649357_-	hypothetical protein	NA	A0A1C8E9A1	Bacillus_phage	71.0	1.7e-15
WP_046392955.1|3649368_3650127_-	antirepressor	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	69.0	1.2e-96
WP_000283431.1|3650329_3650542_-	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	1.6e-11
WP_006920059.1|3650732_3651404_+	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	41.0	6.8e-35
>prophage 10
NZ_CP009686	Bacillus cereus strain FORC_005 chromosome, complete genome	5349617	4439080	4446766	5349617		Staphylococcus_phage(16.67%)	9	NA	NA
WP_000221064.1|4439080_4440004_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	9.0e-46
WP_000247679.1|4440129_4441065_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.3	1.1e-22
WP_000018029.1|4441066_4441759_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.4e-06
WP_001014310.1|4442101_4442296_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255971.1|4442334_4443534_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	1.6e-71
WP_000587820.1|4443829_4444153_+	heme oxygenase	NA	NA	NA	NA	NA
WP_001086122.1|4444225_4444990_-	class B sortase	NA	NA	NA	NA	NA
WP_044306745.1|4445022_4445793_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.9	7.6e-14
WP_001036848.1|4445782_4446766_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	1.1e-17
