The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011331	Escherichia coli O104:H4 str. C227-11 isolate 368 shch chromosome, complete genome	5292862	197356	281045	5292862	protease,transposase,integrase,plate,tRNA	Pseudomonas_phage(18.75%)	61	235106:235123	280044:280061
WP_001390300.1|197356_199159_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001173975.1|199149_200082_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000198270.1|200094_202077_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	35.6	2.2e-12
WP_000005080.1|202087_202555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001390299.1|202564_202864_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_001033155.1|202867_203944_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000152746.1|203951_204503_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_001154665.1|204521_205934_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001028113.1|206272_206863_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000914956.1|206868_210273_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000029846.1|210276_212826_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.8	4.6e-92
WP_001189118.1|214432_215941_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001391950.1|218609_218828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359994.1|219306_220461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000555380.1|221775_222909_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077577697.1|222948_223311_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.5	6.4e-40
WP_000080172.1|223643_225257_-|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_000624688.1|225287_225638_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001309734.1|225634_226069_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_001045650.1|227040_231159_-|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
WP_001189118.1|231886_233395_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001254936.1|234557_235709_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
235106:235123	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000747051.1|235628_235979_-|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
WP_001091149.1|236048_236342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081335.1|236430_239301_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000105162.1|239303_240932_-	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	42.6	4.6e-85
WP_000126413.1|240941_243329_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_001273465.1|243338_244319_-	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
WP_000286652.1|244344_247194_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.2e-183
WP_001218809.1|250177_251440_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
WP_000234526.1|251818_252526_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839766.1|252923_255059_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|255108_256365_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_001298916.1|256566_257646_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|257710_257986_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001297399.1|258013_259066_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|259226_259946_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|259945_260272_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|260455_261175_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394125.1|261350_262397_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745217.1|262513_263521_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239939.1|263675_264812_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174743.1|264804_265398_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|265405_265696_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|265692_266259_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|266276_266981_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001349546.1|266998_267979_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017106.1|268154_268571_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000126441.1|268570_269206_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593273.1|269242_270193_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222508.1|270205_270937_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286500.1|271016_271724_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000858396.1|271818_272316_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001112301.1|272392_273787_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001062128.1|274222_275377_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001303650.1|275680_275896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297406.1|276031_276163_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001295380.1|276171_278148_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000758915.1|278293_279025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105559.1|279160_280081_+	agmatinase	NA	NA	NA	NA	NA
280044:280061	attR	AGATGCTGTATATTCAGG	NA	NA	NA	NA
WP_000701841.1|280286_281045_-|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
>prophage 2
NZ_CP011331	Escherichia coli O104:H4 str. C227-11 isolate 368 shch chromosome, complete genome	5292862	512870	520010	5292862		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|512870_513509_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|513505_514768_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|514764_515673_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|515838_516636_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141316.1|516686_517343_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	1.5e-50
WP_001272924.1|517448_520010_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 3
NZ_CP011331	Escherichia coli O104:H4 str. C227-11 isolate 368 shch chromosome, complete genome	5292862	880612	931098	5292862	protease,transposase,integrase,portal,terminase,head	Enterobacteria_phage(48.57%)	54	878144:878160	915824:915840
878144:878160	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000194515.1|880612_882046_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274887.1|882261_883176_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197025.1|883247_884495_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001163428.1|885024_885225_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001277767.1|885356_885536_-	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_000208008.1|885632_886262_-	DUF550 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	58.6	1.1e-55
WP_000951713.1|886258_886468_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000034245.1|886830_887502_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	73.2	3.0e-83
WP_001214454.1|887498_887666_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
WP_000855556.1|887662_887953_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	99.0	2.4e-45
WP_001111299.1|887963_888260_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	99.0	3.9e-51
WP_000951329.1|888283_888667_-	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	97.6	1.2e-65
WP_000031367.1|888666_889272_-	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_000050554.1|889282_889453_-	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_001243355.1|889528_889681_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|889665_889797_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_000807788.1|890843_891086_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000113732.1|891088_891529_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000200769.1|891525_892938_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	9.8e-278
WP_000852341.1|892940_895067_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.0	0.0e+00
WP_000426730.1|895080_895965_+	hypothetical protein	NA	Q716H1	Shigella_phage	99.0	2.0e-143
WP_001133485.1|895976_897248_+|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	1.2e-239
WP_000375637.1|897290_897476_+	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
WP_000246749.1|897450_897933_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	99.4	8.4e-88
WP_001122379.1|897941_899360_+	Packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.9	3.9e-274
WP_000785547.1|899359_900208_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.5	3.4e-100
WP_000614045.1|900207_900663_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	5.7e-86
WP_000964882.1|900665_901358_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000246924.1|901367_902834_+	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	62.0	8.4e-139
WP_001387755.1|902833_904678_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	73.8	4.0e-247
WP_000749286.1|904692_905178_-	lipoprotein	NA	NA	NA	NA	NA
WP_000820795.1|905203_905518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283829.1|905514_905766_-	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	93.9	1.5e-35
WP_000865490.1|905871_906012_+	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	56.8	7.5e-05
WP_000835342.1|906244_907123_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.1	5.8e-95
WP_000129924.1|907223_909203_+	hypothetical protein	NA	A5VW57	Enterobacteria_phage	93.5	6.2e-60
WP_000178979.1|909273_911184_-	acyltransferase	NA	C6ZR20	Salmonella_phage	32.6	4.7e-57
WP_000958672.1|911412_912570_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.3e-221
WP_000368131.1|912881_913814_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000776768.1|914107_914863_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000937848.1|915044_916103_-	hypothetical protein	NA	NA	NA	NA	NA
915824:915840	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001296861.1|916468_917809_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030901.1|918180_918465_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531990.1|918644_919955_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000426166.1|919954_922099_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|922301_922787_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033328.1|923461_924025_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001112829.1|924106_926749_+	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_001281615.1|926768_927521_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000842082.1|927495_928044_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|928040_928511_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000730291.1|928507_929032_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001387754.1|929018_929891_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|930117_931098_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP011331	Escherichia coli O104:H4 str. C227-11 isolate 368 shch chromosome, complete genome	5292862	1146372	1155814	5292862		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569326.1|1146372_1147299_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1147303_1148035_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1148015_1148123_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1148182_1148914_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1149135_1150821_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1150817_1151537_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1151583_1152054_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1152094_1152556_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001351453.1|1152680_1154681_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292767.1|1154677_1155814_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 5
NZ_CP011331	Escherichia coli O104:H4 str. C227-11 isolate 368 shch chromosome, complete genome	5292862	1446393	1507864	5292862	integrase,tRNA,holin,portal,terminase,head,tail,capsid	Enterobacteria_phage(39.34%)	75	1452289:1452303	1487491:1487505
WP_001025327.1|1446393_1448127_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001326063.1|1448342_1448909_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185740.1|1448922_1449669_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214304.1|1450056_1451157_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176815.1|1451181_1453611_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
1452289:1452303	attL	ACGCTGGCGGCGATG	NA	NA	NA	NA
WP_000564745.1|1453776_1454748_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|1454744_1455488_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|1455528_1455924_-	membrane protein	NA	NA	NA	NA	NA
WP_044713004.1|1455976_1456747_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000362003.1|1456728_1458039_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	95.4	3.0e-244
WP_000528718.1|1458094_1458331_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_001030156.1|1458339_1458486_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000457723.1|1458489_1458732_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_000628772.1|1458816_1459575_-	phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	82.0	2.7e-109
WP_000065512.1|1460088_1460637_-	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	97.5	1.4e-59
WP_000476208.1|1460633_1460873_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	94.9	1.6e-34
WP_000111289.1|1460865_1461069_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_001242713.1|1461065_1461428_-	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_000008178.1|1461418_1461955_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_000081306.1|1462082_1462907_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	1.1e-148
WP_000179185.1|1462972_1463335_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	7.5e-57
WP_001387485.1|1464037_1464730_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	6.4e-121
WP_001191669.1|1464827_1465088_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526669.1|1465080_1465638_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.1	5.3e-94
WP_001087340.1|1465634_1466780_+	peptidase	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
WP_000620687.1|1466776_1467001_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
WP_000061508.1|1466997_1467816_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
WP_001387484.1|1467812_1468307_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
WP_000066917.1|1468306_1468960_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210143.1|1468956_1469283_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000767110.1|1469279_1469675_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072672.1|1469837_1470653_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.6	2.2e-149
WP_001390267.1|1470660_1471650_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.4e-193
WP_001205460.1|1471667_1472009_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131905.1|1472021_1472570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|1472556_1473483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|1473747_1473951_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000935520.1|1474102_1475152_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	91.4	3.1e-188
WP_000874354.1|1475943_1477797_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	90.6	0.0e+00
WP_000284510.1|1477947_1478163_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731196.1|1478167_1478974_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	99.6	4.8e-152
WP_000551290.1|1478983_1479298_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	100.0	4.7e-55
WP_001092910.1|1479426_1479960_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.6	1.1e-101
WP_001151822.1|1480116_1480299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|1480313_1480445_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_071587457.1|1480667_1480853_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	9.9e-21
WP_000347013.1|1481265_1481406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|1481538_1481724_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000867568.1|1482118_1482667_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001390579.1|1482638_1484567_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
WP_000259002.1|1484550_1484757_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831738.1|1484753_1486346_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	4.2e-184
WP_001253973.1|1486335_1487841_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.3e-99
1487491:1487505	attR	ACGCTGGCGGCGATG	NA	NA	NA	NA
WP_000256823.1|1487877_1488225_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522601.1|1488282_1489311_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.1e-113
WP_000201501.1|1489362_1489746_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204556.1|1489738_1490092_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000975010.1|1490106_1490682_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
WP_000683079.1|1490678_1491074_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235108.1|1491081_1491834_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.5e-133
WP_000479035.1|1491847_1492270_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.1	1.1e-70
WP_000533444.1|1492296_1492710_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.2	2.1e-42
WP_000081812.1|1492690_1495303_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.1	0.0e+00
WP_000847391.1|1495299_1495629_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	90.8	8.7e-52
WP_001152522.1|1495628_1496327_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140762.1|1496331_1497075_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_000090891.1|1497011_1497644_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515718.1|1497704_1501100_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_001228314.1|1501167_1501767_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_001387718.1|1501918_1503457_+|tail	tail fiber protein	tail	A0A2D1UII2	Escherichia_phage	92.2	8.8e-54
WP_085968187.1|1503540_1504074_+	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	47.2	5.4e-35
WP_071827722.1|1504216_1504477_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001217553.1|1504612_1504861_-	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000891610.1|1505215_1505782_-	hydrolase	NA	NA	NA	NA	NA
WP_001258662.1|1506091_1507864_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP011331	Escherichia coli O104:H4 str. C227-11 isolate 368 shch chromosome, complete genome	5292862	1645893	1704472	5292862	transposase,integrase,plate,tRNA,holin,portal,terminase,head,tail,capsid	Enterobacteria_phage(77.55%)	72	1656257:1656273	1708464:1708480
WP_000019440.1|1645893_1646874_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_085968646.1|1646908_1647136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001010722.1|1647139_1648531_-	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_001295408.1|1648663_1649254_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000106834.1|1649416_1650085_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_000222172.1|1650231_1650768_+	membrane protein	NA	NA	NA	NA	NA
WP_000267645.1|1650808_1651669_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000146159.1|1651774_1652065_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000251735.1|1652164_1653094_-	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000771396.1|1653380_1654139_+	YdiY family protein	NA	NA	NA	NA	NA
WP_001142445.1|1654191_1654299_-	hypothetical protein	NA	NA	NA	NA	NA
1656257:1656273	attL	GAGCTGGCGCGCAAATT	NA	NA	NA	NA
WP_001144190.1|1656896_1658825_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
WP_001700733.1|1658828_1659371_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|1659467_1659665_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|1659717_1660074_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|1660196_1660241_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|1660523_1661507_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672359.1|1661521_1663909_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|1663913_1664213_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000078916.1|1664514_1664655_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488099.1|1664845_1665106_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000019440.1|1665299_1666280_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_000965749.1|1666624_1667707_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000132828.1|1667798_1668908_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	3.7e-195
WP_000005414.1|1669065_1670250_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	3.8e-222
WP_000290443.1|1670249_1670762_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_000665305.1|1670816_1671182_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
WP_001391627.1|1671217_1671346_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	95.2	1.5e-15
WP_001390260.1|1671332_1674140_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_000979946.1|1674152_1674641_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000954195.1|1674797_1675370_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144016.1|1675413_1675992_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_000108557.1|1675991_1678124_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	1.2e-130
WP_000071739.1|1678126_1678657_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001111965.1|1678649_1679546_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
WP_000213447.1|1679549_1679900_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271909.1|1679896_1680478_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_000356370.1|1680474_1681110_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	5.3e-114
WP_000921128.1|1681102_1681570_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.1	2.1e-83
WP_000202135.1|1681593_1683474_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	3.8e-301
WP_000780558.1|1683612_1684020_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.2e-63
WP_000072317.1|1684016_1684409_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	6.4e-70
WP_000104350.1|1684405_1684729_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864897.1|1684731_1684932_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000063103.1|1684931_1685426_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632318.1|1685527_1686328_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_001055094.1|1686373_1687426_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_001262665.1|1687449_1688286_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.8e-149
WP_000613796.1|1688440_1690192_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_000087812.1|1690191_1691238_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000224219.1|1691749_1692013_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	1.1e-30
WP_000201251.1|1692014_1692446_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	43.3	4.7e-21
WP_000211292.1|1692465_1692780_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_000686540.1|1692784_1693744_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.3e-180
WP_001272076.1|1693820_1696661_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.4	0.0e+00
WP_000564228.1|1696657_1697047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157847544.1|1697043_1697661_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	49.4	1.5e-09
WP_000104300.1|1697672_1697972_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	6.2e-41
WP_000153687.1|1697968_1698214_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	87.7	8.4e-36
WP_000985715.1|1698210_1698414_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	94.0	3.4e-30
WP_001038613.1|1698403_1698724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021658.1|1698812_1698926_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.4e-09
WP_000514277.1|1698922_1699165_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159452.1|1699176_1699464_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.9	2.7e-33
WP_000917807.1|1699474_1699813_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	2.2e-50
WP_000163908.1|1699827_1700106_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000094527.1|1700197_1700509_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_001247218.1|1700597_1701533_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.5	4.8e-79
WP_000416308.1|1701543_1701939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956518.1|1702128_1703109_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154183.1|1703171_1703723_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|1703722_1704472_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
1708464:1708480	attR	AATTTGCGCGCCAGCTC	NA	NA	NA	NA
>prophage 7
NZ_CP011331	Escherichia coli O104:H4 str. C227-11 isolate 368 shch chromosome, complete genome	5292862	1824216	1898848	5292862	protease,integrase,lysis,holin,portal,terminase,tail,capsid	Shigella_phage(43.66%)	87	1828320:1828337	1856370:1856387
WP_001260841.1|1824216_1825038_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1825137_1825221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|1825313_1825649_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091806.1|1826045_1827299_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019532.1|1827405_1828299_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
1828320:1828337	attL	CCCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000225276.1|1828433_1829654_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|1829778_1830474_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071820512.1|1830489_1831719_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|1831877_1832492_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|1832534_1833389_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000254426.1|1833390_1833945_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.7	1.4e-62
WP_001387389.1|1833982_1835146_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
WP_097517905.1|1835001_1835448_-	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	73.1	7.2e-41
WP_000497813.1|1835407_1835659_-	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
WP_000186868.1|1835706_1836387_-	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	98.2	1.5e-130
WP_000100829.1|1836383_1837169_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
WP_000995032.1|1837174_1837471_-	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
WP_001271588.1|1837467_1839540_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	87.4	0.0e+00
WP_000660961.1|1839647_1840034_-	hypothetical protein	NA	V5USC5	Shigella_phage	78.9	9.5e-50
WP_000560214.1|1840117_1840339_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	94.4	1.1e-34
WP_000189936.1|1840795_1841005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005963.1|1840973_1841333_-	hypothetical protein	NA	A0A088CBI5	Shigella_phage	72.6	2.3e-37
WP_000211196.1|1841364_1842078_-	hypothetical protein	NA	A0A088CC14	Shigella_phage	98.7	1.8e-126
WP_000198438.1|1842081_1842465_-	antitermination protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
WP_000528776.1|1842959_1843736_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001074607.1|1843723_1844266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001274758.1|1844312_1845026_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.6	4.1e-131
WP_000437871.1|1845126_1845327_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
WP_000438525.1|1845465_1845762_+	hypothetical protein	NA	A0A088CBI6	Shigella_phage	98.0	3.4e-47
WP_000438870.1|1845776_1845995_+	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_001390256.1|1846015_1847098_+	hypothetical protein	NA	V5URT9	Shigella_phage	96.4	2.8e-200
WP_000790392.1|1847104_1847845_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	87.4	2.3e-121
WP_000450864.1|1847870_1848641_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	82.4	8.1e-109
WP_001118163.1|1848656_1849052_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	52.9	2.0e-31
WP_000206792.1|1849108_1849693_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001278450.1|1849808_1849913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887482.1|1850101_1850314_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	62.9	8.4e-16
WP_000119356.1|1850523_1850703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818160.1|1850721_1851207_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000042397.1|1851257_1851575_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000211990.1|1852281_1852953_+	hypothetical protein	NA	A0A088CD42	Shigella_phage	82.6	9.0e-96
WP_001076834.1|1853007_1853418_+	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	98.5	3.9e-70
WP_001254268.1|1853414_1853606_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	87.7	8.9e-25
WP_000002252.1|1853629_1853920_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	96.9	9.3e-50
WP_001008115.1|1853916_1854279_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	98.3	9.2e-63
WP_000992060.1|1854278_1854473_+	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001204886.1|1854465_1854900_+	antitermination protein	NA	G9L695	Escherichia_phage	98.6	2.4e-81
WP_000874468.1|1855665_1857576_+	SASA family carbohydrate esterase	NA	A0A0N7CGH9	Escherichia_phage	74.8	6.4e-280
1856370:1856387	attR	CCCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000142783.1|1857714_1857897_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	91.7	1.6e-23
WP_001290236.1|1857922_1858168_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000284506.1|1858244_1858460_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087450.1|1858464_1858998_+	lysozyme	NA	A0A088CC28	Shigella_phage	91.5	5.6e-93
WP_000675931.1|1859218_1859332_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_077627825.1|1859553_1859739_+|lysis	lysis protein	lysis	A0A0P0ZDR7	Stx2-converting_phage	96.7	2.8e-23
WP_000934362.1|1859872_1860454_-	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	100.0	6.7e-47
WP_001086085.1|1861056_1861872_+|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	99.6	6.6e-125
WP_001387707.1|1861852_1863559_+|terminase	terminase	terminase	A0A2L1IV76	Escherichia_phage	99.1	0.0e+00
WP_000787512.1|1863558_1865703_+|portal	portal protein	portal	A0A088CE71	Shigella_phage	99.6	0.0e+00
WP_000344999.1|1865860_1866868_+	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	93.4	1.2e-168
WP_000214480.1|1866890_1868105_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2L1IV46	Escherichia_phage	99.0	1.8e-232
WP_001140435.1|1868159_1868549_+	hypothetical protein	NA	V5UT93	Shigella_phage	97.7	1.9e-61
WP_001290749.1|1868599_1869061_+	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	99.3	6.9e-71
WP_000829400.1|1869044_1869608_+	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	99.5	8.3e-103
WP_000207910.1|1869607_1870258_+	hypothetical protein	NA	A0A2L1IV63	Escherichia_phage	99.1	1.5e-119
WP_000117962.1|1870254_1872162_+|tail	tail fiber protein	tail	V5USF3	Shigella_phage	66.0	4.2e-82
WP_000537686.1|1872244_1872790_+	hypothetical protein	NA	A0A088CD67	Shigella_phage	99.4	2.0e-93
WP_000276176.1|1872802_1873030_+	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	98.7	2.6e-39
WP_001146337.1|1873370_1874996_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	96.7	0.0e+00
WP_000038927.1|1874992_1876261_+	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	94.3	1.6e-218
WP_000455633.1|1876275_1876554_+	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_001390575.1|1876559_1877177_+	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	6.3e-120
WP_000078908.1|1878227_1878368_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	97.8	2.0e-18
WP_001387532.1|1878424_1878826_+	hypothetical protein	NA	Q08J75	Stx2-converting_phage	98.5	5.0e-70
WP_000509022.1|1878917_1879574_+	hypothetical protein	NA	A0A0H4IPM7	Shigella_phage	99.1	7.4e-103
WP_000455643.1|1879576_1880023_+	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	100.0	4.0e-76
WP_000540395.1|1880032_1880284_+	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	97.5	7.9e-13
WP_000012439.1|1880294_1881560_+	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	95.0	1.5e-192
WP_000331660.1|1881628_1889980_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.8	0.0e+00
WP_000481378.1|1890103_1890379_+	hypothetical protein	NA	A0A088CD78	Shigella_phage	89.3	4.0e-18
WP_000628768.1|1890380_1890884_-	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	98.2	2.6e-95
WP_001290012.1|1891397_1892234_-	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	87.7	6.1e-126
WP_000020909.1|1892220_1892505_-	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	98.9	6.1e-46
WP_000763355.1|1892501_1892723_-	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	98.6	2.9e-35
WP_000184488.1|1892770_1893406_-	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	81.0	2.8e-91
WP_000213043.1|1893813_1893927_-	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
WP_077787044.1|1893937_1896361_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	5.7e-209
WP_000041536.1|1896421_1898848_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.3e-213
>prophage 8
NZ_CP011331	Escherichia coli O104:H4 str. C227-11 isolate 368 shch chromosome, complete genome	5292862	2186696	2248166	5292862	protease,integrase,holin,portal,terminase,head,tail,capsid	Enterobacteria_phage(43.14%)	73	2231398:2231412	2252337:2252351
WP_000422045.1|2186696_2187746_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559283.1|2187965_2188724_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_001278904.1|2188720_2189311_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2189350_2190223_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|2190323_2190944_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|2190940_2191822_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001386774.1|2191959_2192004_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194599.1|2192095_2193658_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2193657_2195253_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|2195256_2196615_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|2196626_2197820_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443069.1|2197819_2198626_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2199006_2199186_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2199271_2199772_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|2199817_2200324_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000926528.1|2201097_2201367_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_000240999.1|2201423_2202092_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885576.1|2202146_2202731_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.7e-103
WP_000216502.1|2202730_2205565_-|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	59.1	5.7e-83
WP_001228314.1|2205716_2206316_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_000515776.1|2206383_2209863_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001332187.1|2209929_2210268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090879.1|2210341_2210944_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000140761.1|2210880_2211624_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	1.8e-145
WP_001152522.1|2211628_2212327_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847379.1|2212326_2212656_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000082359.1|2212652_2215226_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
WP_000533402.1|2215206_2215620_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|2215646_2216078_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000235040.1|2216091_2216844_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	6.7e-132
WP_000683079.1|2216851_2217247_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974999.1|2217243_2217819_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	9.2e-49
WP_001204198.1|2217833_2218187_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
WP_000201506.1|2218179_2218548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522596.1|2218599_2219628_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
WP_000256823.1|2219685_2220033_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253926.1|2220069_2221575_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.8	3.0e-99
WP_001387697.1|2221564_2223157_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_000259002.1|2223153_2223360_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_088888698.1|2223343_2225314_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	1.6e-262
WP_000867569.1|2225243_2225792_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000240372.1|2226192_2226597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343118.1|2227050_2227338_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	58.9	4.0e-29
WP_001390467.1|2227416_2227569_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	2.8e-21
WP_001228710.1|2227597_2227804_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	95.6	2.9e-29
WP_032159578.1|2228025_2228112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092853.1|2228666_2229200_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	8.7e-102
WP_000731197.1|2229242_2230049_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	94.8	3.3e-145
WP_000284510.1|2230053_2230269_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000874307.1|2230419_2232273_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
2231398:2231412	attL	ACCGTGTTCTTGTTT	NA	NA	NA	NA
WP_000871291.1|2232533_2232869_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001438304.1|2233149_2233281_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_000935536.1|2234079_2235129_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_000917746.1|2235279_2235477_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	96.9	1.4e-28
WP_000762880.1|2235703_2236525_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000904106.1|2236521_2236896_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.8e-36
WP_001265083.1|2236908_2237955_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.9e-110
WP_001329966.1|2237956_2238229_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|2238396_2238609_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|2238789_2239455_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151211.1|2239629_2240055_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_000095671.1|2240095_2241058_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693888.1|2241080_2241506_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2241502_2241757_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2241836_2242256_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000379548.1|2242552_2242705_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000394541.1|2242716_2243055_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_012601410.1|2243043_2243310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2243804_2243993_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2243989_2244181_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048530.1|2244273_2246745_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.2	1.8e-56
WP_000113189.1|2246809_2247058_+	excisionase	NA	NA	NA	NA	NA
WP_000113686.1|2247035_2248166_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	4.4e-103
2252337:2252351	attR	ACCGTGTTCTTGTTT	NA	NA	NA	NA
>prophage 9
NZ_CP011331	Escherichia coli O104:H4 str. C227-11 isolate 368 shch chromosome, complete genome	5292862	2473669	2624243	5292862	protease,transposase,integrase,lysis,holin,portal,terminase,tail,capsid,bacteriocin	Escherichia_phage(80.72%)	145	2475136:2475151	2625302:2625317
WP_001182410.1|2473669_2474749_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	1.8e-37
WP_000797369.1|2474748_2475705_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
2475136:2475151	attL	ATGCCAACGCTGGAAA	NA	NA	NA	NA
WP_000506893.1|2475715_2476924_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176769.1|2476941_2477409_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_001388628.1|2477872_2478511_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116682.1|2478533_2479172_+	TerD family protein	NA	NA	NA	NA	NA
WP_001253659.1|2479171_2479810_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253656.1|2479894_2480935_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000081058.1|2480934_2482572_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001284316.1|2482597_2484097_+	protein kinase	NA	NA	NA	NA	NA
WP_000179885.1|2485681_2485858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333359.1|2486840_2487785_-	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000677245.1|2488129_2488849_+	amino acid racemase	NA	NA	NA	NA	NA
WP_000262203.1|2488914_2490213_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_032159458.1|2490456_2491245_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	4.5e-62
WP_000502839.1|2491980_2492100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024199857.1|2493825_2495994_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001229396.1|2496748_2497324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032150361.1|2498036_2498246_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124173.1|2498298_2498532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260393.1|2498627_2499251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|2499339_2499849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001387494.1|2500306_2500765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000586634.1|2501136_2501550_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001390454.1|2502161_2502485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001183600.1|2502545_2504666_-	microcin export transporter peptidase/ATP-binding subunit MchF	NA	F2Y165	Organic_Lake_phycodnavirus	24.2	9.4e-14
WP_001391574.1|2504640_2505882_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000291472.1|2506067_2506520_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_000019320.1|2506545_2508096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001375214.1|2508367_2508595_-	microcin H47	NA	NA	NA	NA	NA
WP_001390451.1|2508622_2508832_-	microcin H47 immunity protein MchI	NA	NA	NA	NA	NA
WP_077627293.1|2509764_2510079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019460.1|2510231_2511212_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	2.0e-184
WP_001390448.1|2511817_2513092_+	esterase family protein	NA	NA	NA	NA	NA
WP_001231529.1|2513233_2514358_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|2515087_2515285_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|2515350_2515566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001390447.1|2515854_2516127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299815.1|2516215_2516395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|2516446_2516641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000477616.1|2518409_2518628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223341.1|2520080_2522171_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	3.4e-08
WP_000839179.1|2522866_2523271_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|2523267_2523615_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000035067.1|2524858_2525047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233439.1|2525064_2527425_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.0	1.5e-33
WP_000282072.1|2527579_2528143_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001258868.1|2529478_2531314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070932.1|2531414_2531702_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001390445.1|2531673_2533203_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000279857.1|2533372_2534590_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.7	6.5e-44
WP_000611858.1|2535137_2536124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627404.1|2536120_2536612_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_000169541.1|2536714_2537014_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000878218.1|2537010_2537877_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000409841.1|2537917_2539276_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
WP_000287459.1|2539862_2542286_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_000945561.1|2542294_2544313_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000610451.1|2544305_2545631_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_001061095.1|2545632_2546046_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_001307105.1|2546095_2547019_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
WP_001199172.1|2547502_2548774_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154414.1|2548779_2549907_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|2549964_2550795_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018486.1|2551336_2552845_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|2553003_2553213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299828.1|2553267_2557230_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|2557269_2557908_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|2558195_2559287_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307708.1|2559286_2559979_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126777.1|2559990_2560377_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001307099.1|2560384_2561185_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001196.1|2561194_2561785_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028096.1|2561795_2562290_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_001326838.1|2562310_2563639_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001273658.1|2563721_2563895_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_000331685.1|2564826_2573208_-	hypothetical protein	NA	A0A0P0ZFK4	Escherichia_phage	100.0	0.0e+00
WP_000012452.1|2573277_2574543_-	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	100.0	2.4e-206
WP_000540391.1|2574553_2574805_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455649.1|2574814_2575261_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000509489.1|2575263_2575920_-	hypothetical protein	NA	A0A0P0ZGB7	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|2576013_2576415_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|2576471_2576612_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|2576844_2577579_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|2577669_2578287_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|2578292_2578571_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|2578585_2579854_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001391593.1|2579850_2581476_-	hypothetical protein	NA	A0A0P0ZG21	Escherichia_phage	100.0	0.0e+00
WP_000513231.1|2581709_2582222_-	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
WP_000117967.1|2582308_2584501_-|tail	tail fiber protein	tail	A0A0H4IU95	Shigella_phage	98.0	1.9e-86
WP_000207927.1|2584497_2585148_-	hypothetical protein	NA	A0A0P0ZGL1	Escherichia_phage	100.0	4.6e-121
WP_000829200.1|2585147_2585711_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001367376.1|2585694_2586156_-	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_001140442.1|2586205_2586595_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|2586650_2587865_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|2587888_2588896_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787034.1|2589053_2591198_-|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|2591197_2592904_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086073.1|2592884_2593691_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_001109019.1|2593983_2594535_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_024017835.1|2594737_2595175_-|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	100.0	1.4e-70
WP_000455397.1|2595177_2595327_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	100.0	4.8e-18
WP_001056879.1|2595326_2595896_-	hypothetical protein	NA	A0A0N7KZV8	Escherichia_phage	100.0	1.8e-105
WP_000087737.1|2596169_2596703_-	lysozyme	NA	A0A0P0ZGA2	Escherichia_phage	100.0	5.1e-102
WP_001072901.1|2596707_2596923_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|2597000_2597246_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2597286_2597466_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874432.1|2597602_2599540_-	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	100.0	0.0e+00
WP_000738068.1|2600025_2600295_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|2600306_2601266_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|2601648_2601801_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204859.1|2602049_2602484_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|2602476_2602671_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_000813671.1|2602667_2603231_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|2603238_2603688_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001260358.1|2603687_2604659_-	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000913116.1|2604648_2606169_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001271433.1|2606162_2606540_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001369601.1|2606706_2606901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|2607071_2607275_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|2607370_2608084_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939558.1|2608178_2609648_+	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001064714.1|2609644_2610598_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_111351848.1|2611214_2612000_+	hypothetical protein	NA	A0A0P0ZG86	Escherichia_phage	96.2	1.5e-139
WP_000917252.1|2612070_2612283_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_000934197.1|2612294_2612576_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000995345.1|2612596_2612878_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000459721.1|2612894_2613845_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000187063.1|2613841_2614531_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000344637.1|2614530_2615118_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_001071603.1|2615192_2615540_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|2615603_2616425_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001159715.1|2616501_2616897_+	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
WP_000206047.1|2617047_2617773_+	ead/Ea22-like family protein	NA	A0A0P0ZFU9	Escherichia_phage	100.0	3.3e-128
WP_000034212.1|2617769_2618177_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_001014298.1|2618178_2618370_+	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000206786.1|2618372_2619269_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	100.0	5.4e-173
WP_000203831.1|2619624_2620263_+	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	100.0	4.2e-119
WP_000809302.1|2620318_2620750_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163446.1|2620746_2621373_+	adenine methylase	NA	A0A0P0ZG10	Escherichia_phage	100.0	8.0e-123
WP_001291842.1|2621332_2621545_+	DUF1382 family protein	NA	A0A0P0ZG72	Escherichia_phage	100.0	2.7e-30
WP_000994790.1|2621580_2621934_+	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	100.0	3.5e-59
WP_000497815.1|2622298_2622550_+	DUF4222 domain-containing protein	NA	G9L6F5	Escherichia_phage	100.0	8.4e-39
WP_001208773.1|2622595_2622880_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013658.1|2622932_2624243_+|integrase	site-specific integrase	integrase	A0A0P0ZGA8	Escherichia_phage	100.0	9.2e-254
2625302:2625317	attR	ATGCCAACGCTGGAAA	NA	NA	NA	NA
>prophage 10
NZ_CP011331	Escherichia coli O104:H4 str. C227-11 isolate 368 shch chromosome, complete genome	5292862	2835059	2931595	5292862	transposase,integrase,lysis,portal,head,tail,capsid	Enterobacteria_phage(45.45%)	108	2861343:2861377	2933029:2933063
WP_000399648.1|2835059_2836040_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000961458.1|2836318_2837911_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_001056384.1|2838129_2839050_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000056442.1|2839108_2840227_-	anion transporter	NA	NA	NA	NA	NA
WP_000091016.1|2840223_2840691_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_001001761.1|2840876_2841005_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_001054697.1|2841276_2842860_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001295296.1|2842908_2843424_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|2843476_2843542_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|2843776_2844664_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|2844962_2845466_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|2845869_2846616_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|2846754_2847414_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|2847410_2848133_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001267242.1|2848249_2850475_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_001387659.1|2850471_2851398_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_001387658.1|2851673_2851934_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430039.1|2852198_2854481_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990161.1|2854522_2855200_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	3.1e-19
WP_000146343.1|2855273_2855540_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|2855804_2856065_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443512.1|2856293_2857379_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386540.1|2857519_2858482_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|2858509_2860660_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145128.1|2860779_2861262_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
2861343:2861377	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000007101.1|2861493_2862858_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|2863086_2863758_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000976401.1|2863757_2864756_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996091.1|2864748_2866485_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000070131.1|2866477_2867611_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|2867621_2868728_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|2868689_2869100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113348.1|2869232_2869994_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|2869990_2871232_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045450.1|2871231_2872188_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_001088647.1|2872223_2872937_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_001331162.1|2873006_2873654_-	membrane protein	NA	NA	NA	NA	NA
WP_000373624.1|2873855_2874560_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|2874696_2875149_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598616.1|2875150_2875396_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|2875388_2875874_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084632.1|2875876_2876389_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|2876410_2877400_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|2877796_2878705_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|2878896_2880918_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044868.1|2881496_2882174_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|2882166_2882922_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118840.1|2882908_2884063_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|2884059_2885100_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001307065.1|2885186_2886476_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767389.1|2886534_2887011_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000586343.1|2887756_2889088_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	2.5e-20
WP_000885623.1|2889161_2889746_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	9.2e-105
WP_001387657.1|2889745_2892820_-	membrane protein	NA	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001233090.1|2892884_2893484_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_000515639.1|2893554_2897052_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
WP_000090917.1|2897112_2897745_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000140717.1|2897681_2898425_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.1e-146
WP_001152576.1|2898430_2899129_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
WP_000847379.1|2899128_2899458_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840297.1|2899454_2902016_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.8	0.0e+00
WP_000459457.1|2902008_2902443_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479200.1|2902424_2902847_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	1.4e-59
WP_001390429.1|2902862_2903603_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
WP_000683129.1|2903610_2904006_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975081.1|2904002_2904581_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|2904592_2904946_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|2904957_2905353_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063238.1|2905394_2906420_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_001299443.1|2906475_2906808_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123216.1|2906817_2908137_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.4e-230
WP_001316944.1|2908117_2909719_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000198149.1|2909715_2909922_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_000453580.1|2911817_2912363_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_000105084.1|2912751_2912985_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|2913041_2913452_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001028465.1|2913801_2914323_-	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000092234.1|2914527_2914965_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
WP_001135297.1|2914961_2915459_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
WP_000839596.1|2915458_2915674_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737263.1|2916262_2917345_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_001204791.1|2917533_2917917_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|2918002_2918143_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_000774504.1|2918497_2918788_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224912.1|2918780_2918951_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_001053034.1|2918950_2919406_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_072147432.1|2919402_2919504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000990013.1|2919600_2920110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338663.1|2920428_2920668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000948436.1|2920779_2921574_-	recombinase	NA	A0A2K9V406	Faecalibacterium_phage	28.9	7.5e-09
WP_000145901.1|2921819_2922122_-	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
WP_000788812.1|2922118_2922820_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_001386644.1|2922816_2923746_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	6.8e-110
WP_001182903.1|2923832_2924372_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001067458.1|2924441_2924672_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|2924777_2925467_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|2926064_2926271_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995433.1|2926346_2926643_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|2926648_2927434_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186833.1|2927430_2928111_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000682318.1|2928107_2928290_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548541.1|2928262_2928454_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	4.7e-26
WP_001386642.1|2928464_2928746_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763367.1|2928844_2929066_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000120064.1|2929276_2929879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|2930121_2930289_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|2930328_2930547_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533642.1|2930524_2931595_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
2933029:2933063	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 11
NZ_CP011331	Escherichia coli O104:H4 str. C227-11 isolate 368 shch chromosome, complete genome	5292862	3449837	3506142	5292862	integrase,plate	Enterobacteria_phage(27.27%)	52	3451218:3451237	3464178:3464197
WP_000772650.1|3449837_3451052_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.7	8.8e-134
3451218:3451237	attL	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_032145704.1|3451322_3452657_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001240678.1|3452737_3453415_-	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	51.8	8.6e-46
WP_000891726.1|3453462_3455304_-	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.5	1.9e-18
WP_001387927.1|3455338_3455536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999102.1|3455687_3456719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013184.1|3456733_3457117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807036.1|3457121_3457319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390662.1|3458309_3458609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000580786.1|3458608_3458812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532776.1|3458869_3459253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221926.1|3459350_3459620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000594462.1|3459629_3460298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296967.1|3460445_3460628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001273869.1|3462302_3462854_+	recombinase family protein	NA	Q2A092	Sodalis_phage	43.9	3.2e-30
WP_000893256.1|3464368_3465622_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.3e-95
3464178:3464197	attR	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_001285288.1|3465633_3466737_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749877.1|3467024_3468080_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.2e-117
WP_000174677.1|3468118_3468520_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|3468577_3469822_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3469913_3470372_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293014.1|3470632_3472090_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602103.1|3472146_3472761_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_000528869.1|3472757_3473897_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.0e-31
WP_001059855.1|3474142_3474595_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226164.1|3474591_3475647_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207574.1|3475717_3476503_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001386594.1|3476447_3478187_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000598758.1|3478291_3478570_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030484.1|3478562_3478919_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000543895.1|3478975_3479749_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|3479934_3480195_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615974.1|3480197_3480476_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3480631_3481372_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3481342_3482110_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3482315_3482894_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973081.1|3483133_3485578_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|3485620_3486094_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118029.1|3486247_3487018_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_122985282.1|3489505_3489691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939262.1|3489605_3490088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103304.1|3493810_3495952_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	3.7e-26
WP_001142958.1|3496161_3496680_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037389.1|3497376_3497877_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3497911_3498136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056978.1|3498186_3499662_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611748.1|3499668_3500082_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393853.1|3500085_3501936_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3501899_3502982_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|3503006_3504287_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3504283_3504808_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246421.1|3504810_3506142_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 12
NZ_CP011331	Escherichia coli O104:H4 str. C227-11 isolate 368 shch chromosome, complete genome	5292862	3945376	4084541	5292862	protease,tRNA,integrase,transposase	Enterobacteria_phage(17.39%)	116	4030448:4030463	4071178:4071193
WP_001162171.1|3945376_3946729_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|3946822_3947374_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219816.1|3947524_3948898_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|3949073_3950072_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595979.1|3950104_3951100_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001387274.1|3951086_3952109_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205794.1|3952122_3953625_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265933.1|3953934_3954891_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|3955200_3955731_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000239579.1|3955810_3956161_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223208.1|3956154_3956406_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|3956617_3956959_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060946.1|3956961_3960741_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|3960737_3962471_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|3962676_3963315_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935042.1|3963637_3964981_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|3965042_3965249_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175289.1|3965573_3966131_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|3966120_3966861_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589423.1|3967050_3968994_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|3969122_3969503_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560563.1|3969591_3970452_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001296686.1|3970559_3971525_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331456.1|3971632_3972295_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|3972339_3973752_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|3974060_3974681_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|3974899_3975538_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826425.1|3975672_3976881_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_000604912.1|3976888_3977320_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_001351393.1|3977942_3978737_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|3978807_3979257_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|3979298_3979526_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|3979530_3979845_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|3979851_3980247_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|3980573_3980849_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000996728.1|3980923_3981475_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|3981571_3982258_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949539.1|3982257_3983112_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|3983121_3983772_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776505.1|3983785_3984250_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|3984259_3984565_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001300695.1|3984580_3985978_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|3986332_3987397_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|3987504_3988260_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569708.1|3988256_3989006_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|3989187_3989517_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|3989665_3989941_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001339483.1|3990057_3991683_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943976.1|3991766_3992930_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.3e-81
WP_000101644.1|3992932_3993571_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|3993996_3994656_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|3994706_3995405_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|3995423_3995825_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|3995951_3996683_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|3996862_3999304_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|3999342_3999768_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|3999972_4001271_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4001374_4001572_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4001653_4002658_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312490.1|4002660_4003920_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|4004005_4005286_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4005362_4005671_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|4005756_4006707_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122523.1|4006699_4008547_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.6	2.6e-60
WP_000990321.1|4008556_4009894_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4009912_4010374_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|4010345_4011893_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|4011891_4013031_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4013013_4013067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4013809_4014355_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|4014449_4015502_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934933.1|4015598_4016567_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236813.1|4016588_4019912_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|4019940_4020255_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|4020251_4020566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|4020617_4022120_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|4022338_4023316_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192973.1|4023640_4025449_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|4025441_4026176_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|4026186_4026582_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|4026592_4026952_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001367937.1|4027014_4028148_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|4028236_4028770_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|4028766_4029084_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|4029258_4029405_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|4029515_4029641_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|4029692_4030259_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|4030300_4031329_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
4030448:4030463	attL	CTGTTTGCCCTGCGTG	NA	NA	NA	NA
WP_001008073.1|4031718_4032588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|4032790_4033144_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|4033281_4034928_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4034971_4035265_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|4035540_4036797_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|4036812_4037289_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|4037625_4039062_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961957.1|4039179_4040481_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883400.1|4040596_4040935_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068978.1|4040910_4042608_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001387262.1|4042644_4043220_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218804.1|4043599_4044862_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
WP_071588995.1|4049903_4050941_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001034110.1|4051301_4055159_+|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
WP_000291751.1|4055205_4055787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422750.1|4059685_4060111_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	4.4e-48
WP_001189118.1|4061796_4063305_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001387241.1|4064269_4066465_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750143.1|4066470_4067808_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015710.1|4067804_4069547_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287497.1|4069546_4070494_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001387605.1|4070494_4072219_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
4071178:4071193	attR	CACGCAGGGCAAACAG	NA	NA	NA	NA
WP_000074478.1|4072354_4073548_+	MFS transporter	NA	NA	NA	NA	NA
WP_001387604.1|4073497_4074424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000555385.1|4075163_4076306_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_085970120.1|4076345_4077559_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	6.0e-167
WP_001390760.1|4078136_4079261_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.3e-199
WP_001045650.1|4080422_4084541_-|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
>prophage 13
NZ_CP011331	Escherichia coli O104:H4 str. C227-11 isolate 368 shch chromosome, complete genome	5292862	4649337	4673785	5292862	integrase,transposase	Escherichia_phage(30.0%)	27	4651907:4651936	4673925:4673939
WP_000844627.1|4649337_4649580_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001300563.1|4650451_4651564_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
4651907:4651936	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_000429836.1|4651931_4652366_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
4651907:4651936	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_001294663.1|4652437_4652788_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|4652801_4653077_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|4653112_4653535_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|4653586_4655281_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|4655298_4655661_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|4655657_4655894_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|4655929_4656598_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|4656636_4657941_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|4657987_4658692_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|4658752_4659589_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|4659588_4660392_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|4660452_4661268_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|4661575_4662427_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|4663182_4663887_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|4663933_4664335_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|4664484_4665345_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|4665844_4666549_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000259029.1|4666582_4667362_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_000679427.1|4667355_4667703_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000703418.1|4667932_4668406_-	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
WP_000845048.1|4668563_4669577_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|4669779_4670130_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|4670255_4670816_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|4670818_4673785_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
4673781:4673810	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
>prophage 1
NZ_CP011332	Escherichia coli O104:H4 str. C227-11 isolate 368 shch plasmid unnamed, complete sequence	75079	5280	10527	75079	transposase	Stx2-converting_phage(66.67%)	6	NA	NA
WP_001339397.1|5280_5958_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|5957_6305_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381397.1|6324_7896_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
WP_000624689.1|8208_8505_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	64.4	3.4e-31
WP_001387845.1|8501_8936_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	3.4e-19
WP_000205736.1|9780_10527_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
>prophage 2
NZ_CP011332	Escherichia coli O104:H4 str. C227-11 isolate 368 shch plasmid unnamed, complete sequence	75079	50121	57752	75079	integrase,transposase	Stx2-converting_phage(50.0%)	8	39672:39686	61566:61580
39672:39686	attL	TACTCGAAATTCTTC	NA	NA	NA	NA
WP_000019427.1|50121_51102_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
WP_001387337.1|51916_52456_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000869859.1|52459_53488_-	class 1 isoprenoid biosynthesis enzyme	NA	NA	NA	NA	NA
WP_000033204.1|53923_54424_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	28.2	2.4e-08
WP_001387384.1|55148_55406_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	90.9	1.3e-15
WP_000997981.1|55439_56978_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000612591.1|57027_57375_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001401984.1|57371_57752_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	2.7e-65
61566:61580	attR	GAAGAATTTCGAGTA	NA	NA	NA	NA
>prophage 3
NZ_CP011332	Escherichia coli O104:H4 str. C227-11 isolate 368 shch plasmid unnamed, complete sequence	75079	63757	69935	75079	integrase	Enterobacteria_phage(33.33%)	10	63589:63601	70316:70328
63589:63601	attL	TGATTTTCAGCCT	NA	NA	NA	NA
WP_032159540.1|63757_64324_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	45.6	4.8e-34
WP_000457137.1|64455_64833_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.2	6.1e-25
WP_001387848.1|64832_65732_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.9	9.8e-98
WP_001392133.1|65758_66028_+	hypothetical protein	NA	F1C5A5	Cronobacter_phage	59.5	1.3e-21
WP_071589020.1|66034_66106_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001278815.1|66107_66524_-	recombinase	NA	NA	NA	NA	NA
WP_000688504.1|66516_67497_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	2.2e-79
WP_000030204.1|67910_68219_-	molecular chaperone GroEL	NA	NA	NA	NA	NA
WP_001144032.1|68305_68950_-	ParA family protein	NA	NA	NA	NA	NA
WP_000016961.1|69128_69935_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.9	2.7e-54
70316:70328	attR	TGATTTTCAGCCT	NA	NA	NA	NA
